Literature DB >> 25606357

Development and characterization of microsatellite loci in the mistletoe Psittacanthus schiedeanus (Loranthaceae).

Clementina González1, Nick Harvey2, Juan Francisco Ornelas1.   

Abstract

PREMISE OF THE STUDY: Microsatellite primers were developed for the parasitic Psittacanthus schiedeanus, a common mistletoe species on cloud forest-adapted tree hosts in Mesoamerica, to investigate intraspecific genetic patterns of diversity and genetic structure. • METHODS AND
RESULTS: Using an enriched library, 10 polymorphic microsatellite loci were developed in P. schiedeanus. All loci consisted of dinucleotide repeats. Average alleles per locus were 12 (4-17), and a total of 120 alleles were recorded across 39 individuals from four populations in Mexico. Primers were tested in 11 additional species, but only amplified successfully in P. calyculatus and P. angustifolius. •
CONCLUSIONS: The polymorphic loci described will be useful in studies of genetic diversity and genetic population differentiation in natural populations of these parasitic plants, and will provide valuable information to understand the importance of host distribution.

Entities:  

Keywords:  Loranthaceae; Psittacanthus schiedeanus; hemiparasite; microsatellites; mistletoe

Year:  2015        PMID: 25606357      PMCID: PMC4298235          DOI: 10.3732/apps.1400099

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Mistletoes are considered the most damaging pathogens to attack commercially important coniferous and hardwood timber stands (Mathiasen et al., 2008). Despite their negative economic impact, mistletoes are ecologically important in forest ecosystems as they provide food, cover, and nesting sites for a variety of birds, mammals, and insects (Watson, 2001). The geographic range of mistletoes is related to the availability of suitable host trees, and the genetic structuring of mistletoe populations is potentially influenced by the distribution of host populations (Norton and Carpenter, 1998). The genus Psittacanthus Mart. (c. 119 species; Loranthaceae), an aerial hemiparasite distributed throughout the Neotropics on a wide range of tree hosts, is distinguished by its large and conspicuous red, yellow, or orange flowers, bulky haustorial connections to the host trees, and large fruits with seeds that lack endosperm (Kuijt, 2009). Psittacanthus schiedeanus (Cham. & Schlecht.) G. Don is characteristic of the canopy in the cloud forest edges in Mesoamerica and often parasitizes tall trees (López de Buen and Ornelas, 2002). The hermaphroditic, hummingbird-pollinated flowers are self-compatible (Ramírez and Ornelas, 2010), and ripe, lipid-rich, purplish-black fleshy fruits are dispersed by a variety of resident and migratory bird species (López de Buen and Ornelas, 1999, 2001; Ramírez and Ornelas, 2009). The foraging and flocking behavior and local abundance of birds differ widely (López de Buen and Ornelas, 2001), and consequently affect the spatial patterns of mistletoe seed deposition (López de Buen and Ornelas, 1999; López de Buen et al., 2002). At a local scale, mistletoes can develop specificity on particular host trees depending on the heterogeneity of host patches, which may lead to gene flow changes and the eventual formation of mistletoe races (Overton, 1997; Norton and Carpenter, 1998). Cross-infection experiments, which have proven useful to demonstrate host specificity in other mistletoes (Overton, 1997; Lara et al., 2009), have shown local host adaptation of P. schiedeanus on Liquidambar styraciflua L. (Ramírez and Ornelas, 2012). However, the parasite-host interaction is predominantly on other host species in areas where L. styraciflua is not distributed. Thus, geologic- and climate-driven processes implicated in the fragmentation of the Mesoamerican cloud forests and the distribution of potential host species across a geographic range could have influenced the distribution of genetic variation among populations of P. schiedeanus. Our aim is to determine to what extent the historically fragmented distribution of cloud forest in Mesoamerica and the distributions of host species have affected the spatial genetic variability of P. schiedeanus and interactions with its hosts, pollinators, and seed dispersers. For these purposes, we isolated and characterized 10 polymorphic nuclear microsatellite loci that are being successfully applied to describe spatial patterns of genetic structure. To date, microsatellite primers have not been developed for this mistletoe species.

METHODS AND RESULTS

Microsatellite isolation was performed by the simple sequence repeat (SSR) development company Genetic Marker Services (Brighton, United Kingdom; http://www.geneticmarkerservices.com). We extracted genomic DNA from a single P. schiedeanus (PSI) individual collected in Jardín Botánico Francisco Xavier Clavijero, near the city of Xalapa, Veracruz, Mexico (Appendix 1), with the DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA) to develop an enriched library, and to design and test primer pairs for microsatellite-containing loci. Enrichment involved incubating adapter-ligated restricted DNA with filter-bonded synthetic repeat motifs: (AG)17, (AC)17, (AAC)10, (CCG)10, (CTG)10, and (AAT)10. We detected and sequenced 29 microsatellite-positive Escherichia coli clones, of which 27 contained repeat motifs, and 19 of these loci had sufficient flanking regions to design F/R primer pairs using the primer design software Primer3 (Rozen and Skaletsky, 2000). All repeat motifs were perfect dinucleotides. Primer pairs were developed to amplify products ranging from 100–250 bp, to help minimize later multiloading overlap ambiguities during sequencer genotyping. The primers were then tested on seven individuals from different populations (Xilitla, Coacoatzintla, Tlalnelhuayocan, Actópan, La Mancha, Motozintla, Jitotol; Appendix 1) using the same touchdown PCR, to maximize specificity. PCR amplifications were performed in a 25-μL final volume containing 7 pmol of each primer, 1.5 mM of MgCl2, 0.2 mM of each dNTP, 1× PCR buffer, 0.8 μg/μL bovine serum albumin (BSA), 0.5 unit Taq polymerase (Promega Corporation, Madison, Wisconsin, USA), and 1.5 μL of DNA diluted 20-fold. Touchdown PCR consisted of 32 cycles of denaturation at 95°C for 60 s, annealing temperature step downs every two cycles of 1°C from 64°C to 59°C (12 cycles), then 10 cycles at 58°C and 10 cycles at 57°C for 60 s, elongation at 72°C for 60 s, and a final extension at 72°C for 5 min. Specificity and active polymorphism were checked on a cooled high-resolution agarose gel. The products were run on 4% MetaPhor agarose gels (Lonza, Basel, Switzerland) in TAE at 10°C. Ten microsatellite loci out of 19 showed specific bands and clearly differed in product sizes among the seven individuals used to test polymorphism, and seven loci showed specific bands but are probably monomorphic. Characteristics of microsatellite loci are shown in Table 1.
Table 1.

Characteristics of 17 microsatellite loci developed in Psittacanthus schiedeanus.

LocusPrimer sequences (5′–3′)Repeat motifAllele size range (bp)Fluorescent dyeGenBank accession no.
Psi1F: GGTGAAATGTGTGAAATATGGA(AG)1895–1316FAMKP027826
R: GCACATTGTGTCTCTGCTTG
Psi29F: CCAGAGTTAGAGATGATCCAG AGTC(AG)14139–145VICKP027827
R: TCCATTTGTCCCTTTTAACCA
Psi6F: CATCTTGGCTTGAGG GAACT(AG)22 145–199NEDKP027828
R: CCCTCTCCCTCTCTCACTCA
Psi8F: TGCACT TTCCCTTCTCGATT(GA)23209–247PETKP027829
R: CTTTCACATCACCGCTTTCA
Psi25F: CGGTTAATCAAACCCATTAAG(GT)19157–2276FAMKP027830
R: AAGCTAAGGACTAAGAAGTGACA
Psi15F: AAGAAAGGGAGATTCCAACC(AG)1478–102PETKP027831
R: TTTTACATAAAGAGGGCTTATAAATG
Psi2F: TCGAAGGTGTTGGAGGAAGA(AG)2188–1306FAMKP027832
R: ACACACATATACACTTGATGCAC
Psi16F: TGAATG GGAGGGAAACTT TG(AG)10168–180VICKP027833
R: GGGCATCCACATTTTTCATT
Psi17F: CAAAGGGAGGTTGCCTACAA(AG)12196–208NEDKP027834
R: ACAGGGACCAACAGACATCC
Psi19F: GTGTGTGTGTGTGTGTGCGA(GA)17145–179PETKP027835
R: CCGGAAACCTTATCACTGCT
*Psi7F: TGGGGTTTTGAATTGTAACAAAA(GA)12(GT)12(GA)13192KP027836
R: GAGGCATTATGACCCGAGTG
*Psi18F: TCATGCTCCCACTTATGGAA(CT)9163KP027837
R: TAGAGGGGGCTCAAAGTGTC
*Psi21F: GCTACACAGTGCGTTTACGG(AC)9107KP027838
R: TGCCAAAAATTTGATGCATAG
*Psi22F: TCTGCCCAAAAATACATCCT(AC)10122KP027839
R: CTGGATTTCACGATTGTGTTG
*Psi24F: CATTGGGATCTGTGATGCTC(GT)8114KP027840
R: AAGAACTGGGAGGTGGCATT
*Psi27F: ACCAGTTTCTCCAAAACCAAG(AG)7100KP027841
R: CTCTCTATCTCCACTTCAATTC
*Psi12F: CACGAGCATCCTCAAATAGCC(GT)11122KP027842
R: TGTGACATCAGGGGCCATAC

Loci untested for polymorphism, probably monomorphic.

Characteristics of 17 microsatellite loci developed in Psittacanthus schiedeanus. Loci untested for polymorphism, probably monomorphic. To determine the number of alleles per locus, observed and expected heterozygosity, significant deviations of Hardy–Weinberg equilibrium (HWE), and linkage disequilibrium, we amplified the 10 microsatellite loci that showed variation in band sizes in 39 individuals from four distantly located populations (Jitotol, Motozintla, Xilitla, Rancho Viejo; Appendix 1). We amplified microsatellite loci with the Multiplex PCR Kit (QIAGEN) using two mixes, each of five fluorescently labeled primers (Applied Biosystems, Foster City, California, USA; Table 1): Mix 1 (Psi1, Psi29, Psi6, Psi8, Psi25) and Mix 2 (Psi15, Psi2, Psi16, Psi17, Psi19). Multiplex PCR amplifications were performed in a 5-μL final volume containing final concentrations of 1× Multiplex PCR Master Mix, 1 mM of additional MgCl2, 0.08 μM of primer mix, and 1–1.5 μL of DNA, with the following cycling conditions: an initial heat activation at 95°C for 15 min, 28 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 80 s, extension at 72°C for 1 min, and a final extension at 60°C for 30 min. PCR products (1 μL) were run on an ABI-PRISM 310 Genetic Analyzer including the GeneScan 600 LIZ Size Standard (Applied Biosystems). Fragment sizing was performed in GeneMapper 3.2 (Applied Biosystems). The locus Psi6 failed to amplify in one population (Jitotol), and others were monomorphic in specific populations (Psi29 in Xilitla, and Psi17 in Jitotol, Xilitla, and Rancho Viejo). The number of different alleles per locus across populations ranged from four to 17. Observed and expected heterozygosity, deviations from HWE, and linkage disequilibrium between pairs of loci were estimated in Arlequin 3.5.1.2 (Excoffier et al., 2005). Significant deviations from expectations under HWE after Bonferroni correction for multiple comparisons were inconsistently found in two loci from Jitotol and Motozintla, and in three loci from Rancho Viejo, probably due to the presence of null alleles. No significant linkage disequilibrium was detected among paired loci comparisons after Bonferroni correction (Table 2).
Table 2.

Genetic properties of the 10 newly developed polymorphic microsatellites of Psittacanthus schiedeanus.

Jitotol (n = 5)Motozintla (n = 7)Rancho Viejo (n = 19)Xilitla (n = 8)
LocusAHoHeHWEAHoHeHWEAHoHeHWEAHoHeHWE
Psi140.6000.8220.159720.000.2630.0771110.6310.8290.182471.000.8750.6202
Psi2940.8000.7770.693930.5710.6481.00050.3880.4950.03861
Psi630.0000.6660.0043*100.5550.7920.0021*81.000.8570.1551
Psi840.7500.8210.317230.2000.5110.110580.7050.7980.566530.3750.6750.1994
Psi2540.6000.7770.695160.5710.8680.0012*60.4730.6050.035950.5000.7250.1767
Psi1560.2000.9110.0009*40.3330.6510.069940.4730.6130.302630.3750.4250.3835
Psi240.6000.7330.182940.4280.6480.2545100.8420.8320.009350.5000.5330.5869
Psi1630.6000.5111.00020.4280.3621.00050.0520.4820.0002*30.5000.4251.000
Psi1720.4280.3621.00011
Psi1940.0000.8000.0034*90.5710.9120.0058120.5000.8920.000*60.6250.8160.0678

Note: A = number of alleles sampled; He = expected heterozygosity; Ho = observed heterozygosity; HWE = P values of the exact test of Hardy–Weinberg equilibrium; n = number of individuals sampled.

All four populations are located in Mexico. See Appendix 1 for geographic coordinates and voucher information.

Locus showed significant deviations from Hardy–Weinberg equilibrium after Bonferroni correction (P < 0.005).

Genetic properties of the 10 newly developed polymorphic microsatellites of Psittacanthus schiedeanus. Note: A = number of alleles sampled; He = expected heterozygosity; Ho = observed heterozygosity; HWE = P values of the exact test of Hardy–Weinberg equilibrium; n = number of individuals sampled. All four populations are located in Mexico. See Appendix 1 for geographic coordinates and voucher information. Locus showed significant deviations from Hardy–Weinberg equilibrium after Bonferroni correction (P < 0.005). Cross-species amplifications of microsatellite loci were performed in one to three individuals of each of 11 species of Psittacanthus, with the same conditions above. Most primers amplified successfully only in P. calyculatus (DC.) G. Don and P. angustifolius Kuijt (Table 3).
Table 3.

Cross-species amplifications of microsatellite primers developed for Psittacanthus schiedeanus.

SpeciesPsi1Psi29Psi6Psi8Psi25Psi15Psi2Psi16Psi17Psi19
Psittacanthus robustus (Mart.) Mart.
Psittacanthus acinarius (Mart.) Mart.
Psittacanthus cordatus (Hoffmanns. ex Schult. f.) G. Don
Psittacanthus sonorae (S. Watson) Kuijt
Psittacanthus ramiflorus (Moc. & Sessé ex DC.) G. Don
Psittacanthus mayanus Standl. & Steyerm.
Psittacanthus macrantherus Eichler
Psittacanthus calyculatus (DC.) G. Don++++++
Psittacanthus angustifolius Kuijt+++++++++
Psittacanthus auriculatus (Oliv.) Eichler
Psittacanthus rhynchanthus (Benth.) Kuijt

Note: + = successful amplification; ∼ = amplification of multiple bands; – = failed amplification.

Cross-species amplifications of microsatellite primers developed for Psittacanthus schiedeanus. Note: + = successful amplification; ∼ = amplification of multiple bands; – = failed amplification.

CONCLUSIONS

The 10 microsatellites described here are the first to be developed for P. schiedeanus and the genus Psittacanthus. These polymorphic loci will be useful in studies of genetic diversity and genetic population differentiation and will provide valuable information to understand the importance of host distribution and abiotic factors involved in geographic variation and structure of this widespread mistletoe in Mesoamerica. Cross-species amplifications were successful in closely related P. calyculatus and P. angustifolius, but unsuccessful in most of the studied Psittacanthus species, likely due to their high genetic divergence.
Appendix 1.

Voucher, number of individuals sampled, and location information for Psittacanthus species in this study.

SpeciesLocalityLatitudeLongitudenVoucher no. (Herbarium ID)a
P. acinariusBrazil, Mato Grosso, Cuíaba−15°35′56″−56°05′42″3G. Ceccantini 3676 (USP)
P. angustifoliusMexico, Chiapas, Comitán16°13′46″−92°08′01″2A. Ortíz-Rodríguez s.n. (XAL)
P. angustifoliusMexico, Oaxaca, Puerto Escondido15°43′32″−96°39′48″1E. Ruiz-Sánchez 448 (XAL)
P. auriculatusMexico, Oaxaca, El Molino17°46′14″−97°44′58″3A. Ortiz-Rodríguez s.n. (XAL)
P. calyculatusMexico, Michoacán, Maravatío19°54′00″−100°27′00″1E. Ruiz-Sánchez 414 (XAL)
P. calyculatusMexico, Michoacán, Morelia19°60′05″−101°23′00″1A. González s.n. (XAL)
P. calyculatusMexico, Tlaxcala, Tlaxcala19°17′00″−98°14′00″1C. Lara s.n. (XAL)
P. cordatusBrazil, Mato Grosso, Cuiabá−15°35′56″−56°05′42″3G. Ceccantini 3671 (USP)
P. macrantherusMexico, Sinaloa, El Palmito23°33′00″−105°50′00″1E. Ruiz-Sánchez 348 (XAL)
P. mayanusMexico, Yucatán, Unucmá21°02′58″−89°54′38″1Nonvouchered
P. mayanusMexico, Yucatán, Cuxtal20°54′37″−89°37′15″1Nonvouchered
P. mayanusMexico, Chiapas, Ocozocuautla16°47′47″−93°24′30″1A. Ortiz-Rodríguez s.n. (XAL)
P. ramiflorusMexico, Chiapas, Berriozabal16°50′21″−93°18′11″3A. Ortiz-Rodríguez s.n. (XAL)
P. rhynchanthusGuatemala, Patutul14°22′24″−91°08′18″3J. J. Vega s.n. (UVAL)
P. robustusBrazil, Minas Gerais, Serra do Cipó−19°18′26″−43°52′33″3G. Ceccantini 3589 (USP)
P. schiedeanusMexico, San Luis Potosí, Xilitla21°22′39″−98°59′35″8E. Ruiz-Sánchez 281 (XAL)
P. schiedeanusMexico, Veracruz, Clavijero19°30′47″−96°56′28″1M. T. Mejía 2036 (XAL)
P. schiedeanus Mexico, Veracruz, Rancho Viejo19°31′11″−96°58′22″19M. T. Mejía 362 (XAL)
P. schiedeanusMexico, Veracruz, Coacoatzintla19°37′41″−96°52′56″1M. T. Mejía 2043 (XAL)
P. schiedeanusMexico, Veracruz, Tlalnelhuayocan19°34′47″−96°57′38″1M. T. Mejía 2041 (XAL)
P. schiedeanusMexico, Veracruz, Actópan19°23′13″−96°36′56″1M. T. Mejía 2049 (XAL)
P. schiedeanusMexico, Veracruz, La Mancha19°20′43″−96°36′05″1M. T. Mejía 2050 (XAL)
P. schiedeanus Mexico, Chiapas, Motozintla15°21′21″−92°14′54″7E. Ruiz-Sánchez 261 (XAL)
P. schiedeanus Mexico, Chiapas, Jitotol17°01′47″−92°50′46″5E. Ruiz-Sánchez 263 (XAL)
P. sonorae Mexico, Sonora, Nacapule27°59′04″−111°02′40″1Nonvouchered
P. sonoraeMexico, Sonora, Cruz de Piedra27°57′25″−110°40′51″1Nonvouchered
P. sonoraeMexico, Sonora, Paraiso La Manga27°53′43″−111°06′55″1Nonvouchered

IDs reported below refer to accession numbers in the Instituto de Ecología, A.C. (XAL), Universidad del Valle de Guatemala (UVAL), and the Universidade de São Paulo (USP) herbaria.

  4 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  Mistletoes as parasites: Host specificity and speciation.

Authors:  D A Norton; M A Carpenter
Journal:  Trends Ecol Evol       Date:  1998-03       Impact factor: 17.712

3.  Host compatibility of the cloud forest mistletoe Psittacanthus schiedeanus (Loranthaceae) in Central Veracruz, Mexico.

Authors:  Lorena López de Buen; Juan Francisco Ornelas
Journal:  Am J Bot       Date:  2002-01       Impact factor: 3.844

4.  Arlequin (version 3.0): an integrated software package for population genetics data analysis.

Authors:  Laurent Excoffier; Guillaume Laval; Stefan Schneider
Journal:  Evol Bioinform Online       Date:  2007-02-23       Impact factor: 1.625

  4 in total
  3 in total

1.  Polymorphic microsatellite markers in Anthoxanthum (Poaceae) and cross-amplification in the Eurasian complex of the genus.

Authors:  Irene Lema-Suárez; Elvira Sahuquillo; Neus Marí-Mena; Manuel Pimentel
Journal:  Appl Plant Sci       Date:  2016-10-13       Impact factor: 1.936

2.  A mistletoe tale: postglacial invasion of Psittacanthus schiedeanus (Loranthaceae) to Mesoamerican cloud forests revealed by molecular data and species distribution modeling.

Authors:  Juan Francisco Ornelas; Etelvina Gándara; Antonio Acini Vásquez-Aguilar; Santiago Ramírez-Barahona; Andrés Ernesto Ortiz-Rodriguez; Clementina González; María Teresa Mejía Saules; Eduardo Ruiz-Sanchez
Journal:  BMC Evol Biol       Date:  2016-04-12       Impact factor: 3.260

3.  Microsatellite markers: what they mean and why they are so useful.

Authors:  Maria Lucia Carneiro Vieira; Luciane Santini; Augusto Lima Diniz; Carla de Freitas Munhoz
Journal:  Genet Mol Biol       Date:  2016-08-04       Impact factor: 1.771

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.