T-cell cytokine gene polymorphisms and vitamin D pathway gene polymorphisms in end-stage renal disease due to type 2 diabetes mellitus nephropathy: comparisons with health status and other main causes of end-stage renal disease.

BACKGROUND: T-cell cytokine gene polymorphisms and vitamin D pathway gene polymorphisms were evaluated as possibly associated with end-stage renal disease (ESRD) resulting from type 2 diabetes mellitus (DM) nephropathy.
METHODS: Studies were conducted among hemodialysis (HD) patients with ESRD due to type 2 DM nephropathy, chronic glomerulonephritis, chronic infective tubulointerstitial nephritis, and hypertensive nephropathy as well as in healthy subjects. A frequency distribution of T-cell-related interleukin (IL) genes (IL18 rs360719, IL12A rs568408, IL12B rs3212227, IL4R rs1805015, IL13 rs20541, IL28B rs8099917, IL28B, and rs12979860) and vitamin D pathway genes (GC genes: rs2298849, rs7041, and rs1155563; VDR genes: rs2228570, rs1544410; and RXRA genes: rs10776909, rs10881578, and rs749759) was compared between groups.
RESULTS: No significant differences in a frequency distribution of tested polymorphisms were shown between type 2 DM nephropathy patients and controls. A difference was found in IL18 rs360719 polymorphic distribution between the former group and chronic infective tubulointerstitial nephritic patients (P trend = 0.033), which also differed in this polymorphism from controls (P trend = 0.005).
CONCLUSION: T-cell cytokine and vitamin D pathway gene polymorphisms are not associated with ESRD due to type 2 DM nephropathy in Polish HD patients. IL18 rs360719 is probably associated with the pathogenesis of chronic infective tubulointerstitial nephritis.

1. Introduction

Diabetes mellitus (DM) is the most common cause of end-stage renal disease (ESRD) in many hemodialysis (HD) centers. In Australia and New Zealand, the incident ESRD population (1991–2005) who began renal replacement therapy (RRT) included 30.0% type 2 DM and 4.5% type 1 DM subjects [1]. In the HEMODIALYSIS (HEMO) study, the group of HD patients comprised approximately 45% of DM subjects [2].

Diabetic ESRD patients compared to nondiabetic ESRD subjects show higher both mortality rate [3] and prevalence of coronary artery disease (CAD) [4], are more prone to severe infections [5] and worse response to hepatitis B vaccination [6], and more often suffer from adynamic bone disease associated with low serum parathyroid hormone (PTH) levels [7]. In this paper we will focus on ESRD due to type 2 DM nephropathy. Together with altered glucose metabolism and insulin resistance, deficiency of vitamin D [8] and aberrant T-cell cytokine balance [9] were found to be associated with this severe complication of type 2 DM. There is a link between vitamin D and T-cell functional balance: active form of vitamin D [1,25(OH)2D] has the inhibitory effect on the T helper (Th) 17 and Th1 response [10].

Abnormalities in T-cell cytokine equilibrium [11-13] and plasma vitamin D concentrations [14-16] are related to cardiovascular events [13, 16] and immunononcompetence during infections [11, 14] and vaccinations [12, 15]. Serum PTH levels are dependent on serum vitamin D concentrations [17], and T cells are implicated in the mechanism of PTH action in bone [18].

Vitamin D activity may be adequately expressed if vitamin D pathway components (vitamin D binding protein, also referred to as group-specific component (GC), vitamin D receptor (VDR), and retinoid X receptors (RXRs)) are properly structured and regulated. The recent study by Zhang et al. [19] has shown that VDR BsmI polymorphism correlates with type 2 DM nephropathy and may be susceptible for early onset of this nephropathy. Among T-cell-related cytokine gene polymorphisms, promoter polymorphic variants of IL10 [20, 21] and IL6 [22] were already associated with the risk of type 2 DM nephropathy. Monocyte chemoattractant protein 1 (MCP-1) has been reported to participate in the pathogenesis of early type 2 DM nephropathy [23], but MCP1 polymorphism in the promoter region was not differentially distributed between ESRD patients with type 2 DM nephropathy and healthy controls [24, 25].

To our knowledge, there are scarce data, if any, on ESRD due to type 2 DM nephropathy showing a frequency distribution of single nucleotide polymorphisms (SNPs) of T-cell-related IL genes: IL18 rs360719, IL12A rs568408, IL12B rs3212227, IL4R rs1805015, IL13 rs20541, IL28B rs8099917, and IL28B rs12979860 as well as vitamin D pathway genes: GC genes (GC rs2298849, rs7041, and rs1155563), VDR genes (VDR rs2228570, rs1544410), and RXR α genes (RXRA rs10776909, rs10881578, and rs749759). The aim of our study was to determine the potential association between aforementioned polymorphisms of T-cell-related cytokine genes and vitamin D pathway genes and ESRD due to type 2 DM nephropathy. For comparisons, aforementioned genotype frequencies of healthy controls as well as ESRD patients with other main causes of ESRD were used. Polymorphism related associations, if exist, could contribute to explanation of susceptibility to ESRD due to type 2 DM nephropathy and phenotype differences between ESRD patients with type 2 DM nephropathy and other causes of ESRD.

2. Material and Methods

2.1. Patients and Controls

Blood samples for genotype analyses are collected since 2009 from ESRD patients (estimated glomerular filtration rate (eGFR) category G5 in accordance with KDIGO recommendations [26]). All subjects were treated with HD on enrolment. Controls were recruited from blood donors and healthy volunteers unrelated to patients. All enrolled individuals live/lived in the Greater Poland region of Poland.

Genotyping of IL18 rs360719, IL12A rs568408, IL12B rs3212227, IL4R rs1805015, and IL13 rs20541 polymorphisms was performed in 2009–2012 using currently available material. Results had been analyzed in our previous studies in the context of responsiveness to the surface antigen of hepatitis B virus (HBsAg) using data of all (not segregated) patients [27-30]. For this study, we used results of controls and patients with type 2 DM nephropathy, chronic glomerulonephritis, chronic infective tubulointerstitial nephritis, and hypertensive nephropathy.

IL28B rs8099917, IL28B rs12979860, GC rs2298849, GC rs7041, GC rs1155563, VDR rs2228570, VDR rs1544410, RXRA rs10776909, RXRA rs10881578, and RXRA rs749759 polymorphisms were analyzed in winter 2013/2014 among HD patients with ESRD (n = 893) due to type 2 DM nephropathy (n = 366), chronic glomerulonephritis (n = 178), chronic infective tubulointerstitial nephritis (n = 118), and hypertensive nephropathy (n = 231) as well as healthy controls (n = 378).

DM was not diagnosed in patients having renal diseases other than type 2 DM nephropathy.

Healthy individuals and HD patients with other renal diseases as cause of ESRD served as reference groups for a frequency distribution of tested polymorphic variants. All examined subjects were of Caucasian race.

Basic clinical and laboratory data were collected on enrolment and they are updated every year.

2.2. Genotyping

Genomic DNA for genotype analysis was isolated from peripheral blood lymphocytes by salt-out extraction procedure.

Genotyping of IL18 rs360719, IL12A rs568408, IL12B rs3212227, IL4R rs1805015, and IL13 rs20541 polymorphisms was performed as previously described [27-30].

IL28B rs8099917 and IL28B rs12979860 polymorphisms were genotyped using high-resolution melting curve analysis (HRM) on the LightCycler 480 system (Roche Diagnostics, Mannheim, Germany) with the use of 5x HOT FIREPol EvaGreen HRM Mix (Solis BioDyne, Tartu, Estonia). The PCR program consisted of an initial step at 95°C for 15 min to activate HOT FIREPol DNA polymerase, followed by 50 amplification cycles of denaturation at 95°C for 10 s, annealing at 61°C for 10 s, and elongation at 72°C for 15 s. Amplified DNA fragments were then subjected to HRM with 0.1°C increments in temperatures ranging from 76 to 96°C. Primers used for PCR with subsequent HRM analysis were as follows: rs8099917F 5′TTTGTCACTGTTCCTCCTTTTG3′, rs8099917R 5′AAGACATAAAAAGCCAGCTACCA3′, rs12979860F 5′CGTGCCTGTCGTGTACTGAA3′, and rs12979860R 5′AGGCTCAGGGTCAATCACAG3′.

Genotyping of the GC rs1155563, GC rs2298849, RXRA rs10881578, and RXRA rs10776909 polymorphisms was carried out by HRM on the Bio-Rad CFX96 Real Time PCR system (Bio-Rad, Hercules, CA). DNA fragments amplified with the use of specific primers were subjected to HRM with 0.1°C increments in temperatures ranging from 71 to 92°C. Genotyping of the GC rs7041, RXRA rs749759, VDR rs1544410, and VDR rs2228570 was performed using the polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method according to the manufacturer's instructions (Fermentas, Vilnius, Lithuania). Primer sequences and conditions for HRM and PCR-RFLP analyses are presented in Table 1.

Table 1

HRM and RFLP conditions for the identification of polymorphisms genotyped in the vitamin D pathway related genes.

Gene symbol	rs number	Alleles	Primers for PCR amplification (5′-3′)	Annealing temp. (°C)	PCR product length (bp)	HRMa analysis	RFLPb analysis
						Melting temp. range (°C)	Restriction enzyme	Restriction fragment length (bp)
GC	rs7041	G/T	F: GGAGGTGAGTTTATGGAACAGC	66.3	493		HaeIII	T = 493
			R: GGCATTAAGCTGGTATGAGGTC					G = 414 + 79
	rs1155563	C/T	F: GGTTATTCTAAGACTGTGCTCTTGC	63.0	116	71–78
			R: ATGTGTTCTCACTGTTCGACTCC
	rs2298849	C/T	F: TCCACTGGCAAAACACATTAC	60.6	118	73–83
			R: GGGACATCTGCATTTATCCTG
RXRA	rs10881578	A/G	F: TCTTGAGCAATGCCAGCAG	60.6	75	80–90
			R: CCACAGCTCACACATCCAATC
	rs10776909	C/T	F: CAGCCTGTGGCCTGCTCA	60.6	95	82–92
			R: AACCTCCGGCCCTTGGAG
	rs749759	A/G	F: ATAGGGCTTGCCTGCCTAGA	62.6	382		BstXI	A = 382
			R: CTCCACCATAGCCCAAGTGA					G = 243 + 139
VDR	rs1544410	A/G	F: GGAGACACAGATAAGGAAATAC	60.6	248		FspI	A (B) = 248
			R: CCGCAAGAAACCTCAAATAACA					G (b) = 175 + 73
	rs2228570	C/T	F: GCACTGACTCTGGCTCTGAC	72.5	341		FokI	C (F) = 341
			R: ACCCTCCTGCTCCTGTGGCT					T (f) = 282 + 59

aHRM analysis: high resolution melt analysis.

bRFLP analysis: restriction fragment length polymorphism analysis.

For quality control, the genotyping analysis was blinded to the subject's case-control status. In addition, approximately 10% of the randomly chosen samples were regenotyped. Samples that failed the genotyping were excluded from further statistical analyses.

2.3. 25(OH)D Testing

Plasma 25(OH)D was determined in blindly selected 162 HD patients in the winter season of the year to avoid differences in sunlight exposure between patients who used to sunbathe and those who did not. Plasma 25(OH)D concentration was measured in HD patients who had not been treated with vitamin D or had stopped such a treatment for at least 3 weeks to obtain the so-called basic vitamin D concentrations. Under these conditions, there were no patients showing optimal plasma 25(OH)D levels (35–80 ng/mL for adults). To examine plasma 25(OH)D levels, a chemiluminescent microparticle immunoassay (CMIA) was used according to the manufacturer's instructions (Abbott Diagnostics ARCHITECT 25-OH VITAMIN D CMIA).

2.4. Statistical Methods

Results are presented as percentage for categorical variables, as mean with one standard deviation for normally distributed continuous variables or as median with range for not normally distributed continuous variables as tested by the Shapiro-Wilk test. Statistical tests used for comparison of data obtained in selected groups are indicated at P values.

Hardy-Weinberg equilibrium (HWE) was tested to compare the observed genotype frequencies to the expected ones using Chi-square test. Distributions of tested polymorphisms were consistent with HWE with three exceptions which are indicated in tables showing analysis of genotype and allele distributions. The Fisher exact probability test or Chi-square test was used to evaluate differences in genotype and allele prevalence between the examined groups. Homozygotes for the major allele were the reference group. The odds ratio (OR) with P value and 95% confidence intervals (95% CI) value were calculated. All probabilities were two-tailed. Polymorphisms were tested for association using the Chi-square test for trend (P trend). Power analysis was performed by Fisher's exact test.

Values of P < 0.05 were judged to be significant. However, associations were reported only if the following conditions were fulfilled.

A genotype distribution was consistent with HWE in a tested group and a referent group.

P trend was below 0.05.

Odds ratio remained significant after the Bonferroni correction applied for multiple testing, if appropriate.

Aforementioned statistical calculations were performed using GraphPad InStat 3.10, 32 bit for Windows, created on July 9, 2009 (GraphPad Software, Inc., La Jolla, USA), CytelStudio version 10.0, created on January 16, 2013 (CytelStudio Software Corporation, Cambridge, USA), and Statistica version 10, 2011 (StatSoft, Inc., Tulsa, USA).

3. Results

Characteristics of the examined HD patients are presented in Tables 2 and 3. ESRD patients due to type 2 DM nephropathy compared to non-DM ESRD patients showed older age at RRT onset, shorter treatment with RRT, higher death rate on RRT, higher prevalence of CAD and myocardial infarction, lower serum PTH level, and lower frequency of parathyroidectomy and treatment with cinacalcet.

Table 2

Characteristics of hemodialysis patients (n = 893).

Parameter	Type 2 DM nephropathy	Other causes of ESRD	P value
Demographic data	n = 366	n = 527
Male sex, n (% of all)	201 (54.9)	307 (58.3)	0.337b
Age at RRT beginning, years	62.9 ± 14.1	57.2 ± 17.2	<0.0001c
RRT duration, years	3.29 (0.06–28.0)	4.42 (0.12–28.2)	<0.0001c
Death rate, cases per 100 patient-years	0.48	0.42
Death rate, cases per 100 RRT-years	7.97	4.63
Clinical data	n = 332	n = 527
Coronary artery disease, n (% of all)	174 (52.4)	168 (31.9)	<0.0001b
Myocardial infarction, n (% of all)	98 (29.5)	101 (19.2)	0.009b
Parathyroidectomy, n (% of all)	2 (0.60)	21 (3.98)	0.0009b
Treatment with cinacalcet hydrochloride	24 (7.2)	98 (18.6)	<0.0001b
Laboratory data	n = 366	n = 527
Anti-HBc positive, n (% of all)	95 (26.0)	126 (23.9)	0.528b
HBsAg positive, n (% of all anti-HBc positive)	7 (7.4)	11 (8.7)	0.807b
Anti-HCV positive, n (% of all)	26 (7.1)	57 (10.8)	0.062b
HCV RNA positive, n (% of all anti-HCV positive)	14 (53.8)	39 (68.4)	0.225b
Responders to hepatitis B vaccine, n (% of all)	202 (55.2)	315 (59.8)	0.191b
25(OH)D (ng/mL)a	13.3 ± 3.9	14.5 ± 5.6	0.182a,d
Total calcium (mg/dL)	8.83 ± 0.67	8.91 ± 0.82	0.264d
Phosphates (mg/dL)	5.03 ± 1.44	5.25 ± 1.49	0.054d
PTH (pg/mL)	296 (12.9–3,757)	463 (12.7–3,741)	<0.0001c
Total alkaline phosphatase (U/L)	98.2 (25.8–1,353)	97.1 (40.5–1,684)	0.528c

25(OH)D: 25-hydroxycholecalciferol, anti-HBc: antibodies to core antigen of hepatitis B virus, anti-HCV: antibodies to hepatitis C virus, HBsAg: surface antigen of hepatitis B virus, DM: diabetes mellitus, ESRD: end-stage renal disease, HCV RNA: ribonucleic acid of hepatitis C virus, PTH: parathyroid hormone, and RRT: renal replacement therapy.

A significant difference is indicated using bold font.

a n = 66 for type 2 DM nephropathy; n = 96 for other renal diseases.

bFisher's exact test.

cMann-Whitney test.

dUnpaired t-test, Welch corrected.

Table 3

Characteristics of hemodialysis patients grouped by a cause of ESRD.

Parameter	Type 2 DM nephropathy (1)	Chronic glomerulonephritis (2)	Chronic tubulointerstitial nephritis (3)	Hypertensive nephropathy (4)	P value
Demographic data	n = 366	n = 178	n = 118	n = 231
Male sex, n (% of all)	201 (54.9)	110 (61.8)	63 (53.4)	134 (58.0)	0.386b
Age at RRT beginning, years	62.9 ± 14.1	47.4 ± 17.6	59.9 ± 16.6	63.3 ± 13.6	<0.0001c  1  versus  2: <0.001c  2  versus  3: <0.001c  2  versus  4: <0.001c
RRT duration, years	3.29 (0.06–28.0)	5.73 (0.16–28.2)	4.82 (0.33–26.5)	3.82 (0.12–20.4)	<0.0001c  1  versus  2: <0.001c  1  versus  3: <0.01c  2  versus  4: <0.001c
Death rate, cases per 100 patient-years	0.48	0.41	0.44	0.42
Death rate, cases per 100 dialysis-years	7.97	2.87	5.28	6.70
Clinical data	n = 332	n = 178	n = 118	n = 231
Coronary artery disease, n (% of all)	174 (52.4)	43 (24.2)	29 (24.6)	96 (41.5)	<0.0001b   1  versus  2: <0.0001e  1  versus  3: <0.0001e  1  versus  4: 0.013e  2  versus  4: 0.0002e  3  versus  4: 0.002e
Myocardial infarction, n (% of all)	98 (29.5)	25 (14.0)	17 (14.4)	59 (25.5)	<0.0001b  1  versus  2: <0.0001e  1  versus  3: <0.0001e  1  versus  4: <0.0001e  2  versus  4: 0.005e  3  versus  4: 0.02e
PTX, n (% of all)	2 (0.60)	14 (7.9)	5 (4.2)	2 (0.87)	<0.0001b  1  versus  2: <0.0001e  1  versus  3: 0.015e  2  versus  4: 0.0004e  3  versus  4: 0.046e
Treatment with cinacalcet hydrochloride	24 (7.2)	48 (27.0)	21 (17.8)	29 (12.6)	<0.0001b  1  versus  2: <0.0001e  1  versus  3: 0.0008e  1  versus  4: 0.017e  2  versus  4: 0.0003e
Laboratory data	n = 366	n = 178	n = 118	n = 231
Anti-HBc positive, n (% of all)	95 (26.0)	53 (29.8)	25 (21.2)	48 (20.8)	0.233b
HBsAg positive, n (% of all anti-HBc positive)	7 (7.4)	10 (18.9)	0 (0.0)	1 (2.08)	0.0007b  1  versus  2: 0.032e  2  versus  3: 0.007e  2  versus  4: 0.001e
Anti-HCV positive, n (% of all)	26 (7.1)	33 (18.5)	11 (9.3)	13 (5.6)	<0.0001b  1  versus  2: 0.0004e  2  versus  3: 0.031e  2  versus  4: <0.0001e
HCV RNA positive, n (% of all anti-HCV positive)	14 (53.8)	27 (81.8)	4 (36.4)	8 (61.5)	<0.0001b  1  versus  2: <0.0001e  2  versus  3: 0.0004e  2  versus  4: <0.0001e
Responders to hepatitis B vaccine, n (% of all)	202 (55.2)	107 (60.1)	70 (59.3)	138 (59.7)	0.598b
25(OH)D (ng/mL)a	13.3 ± 3.9	14.2 ± 7.3	15.7 ± 4.3	14.1 ± 3.9	0.453d
Total calcium (mg/dL)	8.83 ± 0.67	8.85 ± 0.85	9.04 ± 0.61	8.88 ± 0.87	0.239d
Phosphates (mg/dL)	5.03 ± 1.44	5.63 ± 1.59	4.92 ± 1.29	5.15 ± 1.47	0.0007d  1  versus  2: <0.001c  2  versus  3: <0.01c  2  versus  4: <0.05c
PTH (pg/mL)	296 (12.9–3,757)	632 (12.7–3,118)	426 (45.8–3,741)	364 (19.5–2,351)	<0.0001c  1  versus  2: <0.001c  1  versus  3: <0.05c  1  versus  4: <0.05c  2  versus  4: <0.001c
Total ALP (U/L)	98.2 (25.8–1,353)	113 (44.5–860)	89.0 (40.5–1,684)	90.9 (41.0–1,110)	0.010c  2  versus  4: <0.05c

25(OH)D: 25-hydroxycholecalciferol, anti-HBc: antibodies to core antigen of hepatitis B virus, anti-HCV: antibodies to hepatitis C virus, HBsAg: surface antigen of hepatitis B virus, DM: diabetes mellitus, ESRD: end-stage renal disease, HCV RNA: ribonucleic acid of hepatitis C virus, PTH: parathyroid hormone, and RRT: renal replacement therapy.

a n = 66 for type 2 DM nephropathy, n = 40 for chronic glomerulonephritis, n = 13 for chronic interstitial nephritis, and n = 43 for hypertensive nephropathy.

bChi squared test.

cKruskal-Wallis test.

dANOVA test.

eFisher's exact test.

In respect of the examined parameters, type 2 DM nephropathy patients differed the most significantly from chronic glomerulonephritic subjects, the least significantly from hypertensive nephropathy patients.

There were no differences in frequency distributions of tested genotypes between type 2 DM nephropathy patients and healthy subjects (Table 4) as well as other ESRD patients analyzed together (Table 5) which could be judged as significant associations.

Table 4

Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due to type 2 DM nephropathy and healthy subjects.

Parameter	Type 2 DM nephropathy (frequency)	Healthy subjects (frequency)	Odds ratio (95% CI)	Two-tailed P	P trend
IL18 rs360719	n = 248	n = 240
TT	133 (0.54)	121 (0.50)	Referent		0.233
CT	102 (0.41)	98 (0.41)	0.947 (0.654–1.372)	0.777
CC	13 (0.05)	21 (0.09)	0.563 (0.270–1.174)	0.145
CT + CC	115 (0.46)	119 (0.50)	0.879 (0.616–1.254)	0.526
MAF	128 (0.26)	140 (0.29)	0.845 (0.638–1.119)	0.268
IL12A rs568408	n = 234	n = 240
GG	173 (0.74)	171 (0.71)	Referent		0.782
AG	52 (0.22)	63 (0.26)	0.816 (0.534–1.246)	0.389
AA	9 (0.04)	6 (0.03)	1.483 (0.517–4.256)	0.600
AG + AA	61 (0.26)	69 (0.29)	0.874 (0.583–1.309)	0.538
MAF	70 (0.15)	75 (0.16)	0.976 (0.684–1.393)	0.965
IL12B rs3212227	n = 247	n = 240
AA	156 (0.63)	151 (0.63)	Referent		0.639
AC	84 (0.34)	77 (0.32)	1.056 (0.721–1.547)	0.846
CC	7 (0.03)	12 (0.05)	0.563 (0.217–1.473)	0.345
AC + CC	91 (0.37)	89 (0.37)	0.990 (0.685–1.430)	1.000
MAF	98 (0.20)	101 (0.21)	0.927 (0.680–1.268)	0.699
IL4R rs1805015	n = 303	n = 225
TT	205 (0.68)	162 (0.72)	Referent		0.304
CT	82 (0.27)	53 (0.24)	1.223 (0.818–1.828)	0.360
CC	16 (0.05)	10 (0.04)	1.264 (0.559–2.861)	0.684
CT + CC	98 (0.32)	63 (0.28)	1.229 (0.843–1.793)	0.295
MAF	114 (0.19)	73 (0.16)	1.197 (0.866–1.653)	0.313
IL13 rs20541	n = 303	n = 230
CC	168 (0.55)	124 (0.54)	Referent		0.457
CT	114 (0.38)	84 (0.36)	1.002 (0.695–1.443)	1.000
TT	21 (0.07)	22 (0.10)	0.705 (0.371–1.338)	0.324
CT + TT	135 (0.45)	106 (0.46)	0.940 (0.666–1.326)	0.726
MAF	156 (0.26)	128 (0.28)	0.899 (0.684–1.182)	0.489
IL28B rs8099917	n = 339	n = 375
TT	219 (0.65)	245 (0.65)	Referent		0.504
GT	107 (0.31)	123 (0.33)	0.973 (0.709–1.336)	0.872
GG	13 (0.04)	7 (0.02)	2.078 (0.814–5.302)	0.169
GT + GG	120 (0.35)	130 (0.35)	1.033 (0.759–1.405)	0.875
MAF	133 (0.20)	137 (0.18)	1.092 (0.837–1.423)	0.560
IL28B rs12979860	n = 336	n = 372
CC	141 (0.42)	164 (0.44)	Referent		0.669
CT	157 (0.47)	166 (0.45)	1.100 (0.804–1.505)	0.576
TT	38 (0.11)	42 (0.11)	1.052 (0.643–1.723)	0.900
CT + TT	195 (0.56)	208 (0.56)	1.090 (0.809–1.469)	0.595
MAF	116 (0.29)	250 (0.34)	1.049 (0.842–1.307)	0.713
GC rs2298849	n = 364a	n = 375
TT	226 (0.62)	237 (0.63)	Referent		0.250
CT	110 (0.30)	124 (0.33)	0.930 (0.679–1.274)	0.688
CC	28 (0.08)	14 (0.04)	2.097 (1.077–4.086)	0.035
CT + CC	138 (0.38)	138 (0.37)	1.049 (0.778–1.413)	0.762
MAF	166 (0.23)	152 (0.20)	1.162 (0.907–1.490)	0.262
GC rs7041	n = 343	n = 361
GG	112 (0.33)	116 (0.32)	Referent		0.572
GT	163 (0.47)	186 (0.52)	0.908 (0.650–1.268)	0.609
TT	68 (0.20)	59 (0.16)	1.194 (0.773–1.844)	0.440
GT + TT	231 (0.67)	245 (0.68)	0.977 (0.712–1.339)	0.936
MAF	299 (0.44)	304 (0.42)	1.062 (0.860–1.312)	0.612
GC rs1155563	n = 362	n = 377
TT	180 (0.50)	189 (0.50)	Referent		0.541
CT	141 (0.39)	155 (0.41)	0.955 (0.703–1.297)	0.815
CC	41 (0.11)	33 (0.09)	1.305 (0.789–2.155)	0.311
CT + CC	182 (0.50)	188 (0.50)	1.017 (0.762–1.356)	0.941
MAF	223 (0.31)	221 (0.29)	1.074 (0.859–1.341)	0.567
VDR rs2228570	n = 345	n = 371
CC	101 (0.29)	103 (0.28)	Referent		0.401
CT	175 (0.51)	183 (0.49)	0.975 (0.691–1.376)	0.930
TT	69 (0.20)	85 (0.23)	0.828 (0.544–1.260)	0.394
CT + TT	244 (0.71)	268 (0.72)	0.929 (0.671–1.285)	0.679
MAF	313 (0.45)	353 (0.48)	0.915 (0.743–1.126)	0.432
VDR rs1544410	n = 359	n = 372
GG	137 (0.38)	148 (0.40)	Referent		0.753
AG	165 (0.46)	165 (0.44)	1.080 (0.787–1.483)	0.686
AA	57 (0.16)	59 (0.16)	1.044 (0.678–1.607)	0.912
AG + AA	222 (0.62)	224 (0.60)	1.071 (0.795–1.442)	0.705
MAF	279 (0.39)	283 (0.38)	1.035 (0.839–1.278)	0.788
RXRA rs10776909	n = 364	n = 378
CC	233 (0.64)	250 (0.66)	Referent		0.426
CT	111 (0.30)	112 (0.30)	1.063 (0.774–1.461)	0.746
TT	20 (0.05)	16 (0.04)	1.341 (0.679–2.651)	0.490
CT + TT	131 (0.36)	128 (0.34)	1.098 (0.812–1.485)	0.590
MAF	151 (0.21)	144 (0.19)	1.112 (0.862–1.435)	0.452
RXRA rs10881578	n = 365	n = 377
AA	197 (0.54)	183 (0.48)	Referent		0.168
AG	134 (0.37)	154 (0.41)	0.808 (0.775–1.046)	0.185
GG	34 (0.09)	40 (0.11)	0.790 (0.479–1.301)	0.376
AG + GG	168 (0.46)	194 (0.51)	0.804 (0.603–1.073)	0.143
MAF	202 (0.28)	234 (0.31)	0.850 (0.680–1.063)	0.172
RXRA rs749759	n = 355	n = 370
GG	207 (0.58)	221 (0.60)	Referent		0.850
AG	125 (0.35)	123 (0.33)	1.085 (0.794–1.216)	0.632
AA	23 (0.06)	26 (0.07)	0.944 (0.522–1.708)	0.881
AG + AA	148 (0.42)	149 (0.40)	1.061 (0.789–1.426)	0.706
MAF	171 (0.24)	175 (0.24)	1.024 (0.804–1.304)	0.894

ESRD: end-stage renal disease, DM: diabetes mellitus, and MAF: minor allele frequency.

aNot consistent with Hardy-Weinberg equilibrium.

Table 5

Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due to type 2 DM nephropathy and the most common causes of ESRD other than type 2 DM nephropathy (chronic glomerulonephritis, chronic tubulointerstitial nephritis, and hypertensive nephritis).

Genotype	Type 2 DM nephropathy (frequency)	Other causes of ESRD (frequency)	Odds ratio (95% CI)	Two-tailed P	P trend
IL18 rs360719	n = 248	n = 353
TT	133 (0.54)	186 (0.53)	Referent	—	0.362
CT	102 (0.41)	135 (0.38)	1.057 (0.752–1.485)	0.795
CC	13 (0.05)	32 (0.09)	0.568 (0.287–1.124)	0.107
CT + CC	115 (0.46)	167 (0.47)	0.963 (0.696–1.334)	0.868
MAF	128 (0.26)	199 (0.28)	0.886 (0.684–1.149)	0.370
IL12A rs568408	n = 234	n = 337
GG	173 (0.74)	234 (0.69)	Referent	—	0.303
AG	52 (0.22)	89 (0.26)	0.790 (0.533–1.060)	0.275
AA	9 (0.04)	14 (0.04)	0.870 (0.368–2.055)	0.831
AG + AA	61 (0.26)	103 (0.31)	0.801 (0.552–1.163)	0.260
MAF	70 (0.15)	117 (0.17)	0.837 (0.606–1.157)	0.319
IL12B rs3212227	n = 247	n = 352
AA	156 (0.63)	205 (0.58)	Referent	—	0.176
AC	84 (0.34)	132 (0.38)	0.836 (0.593–1.068)	0.337
CC	7 (0.03)	15 (0.04)	0.613 (0.244–1.540)	0.376
AC + CC	91 (0.37)	147 (0.42)	0.814 (0.582–1.136)	0.236
MAF	98 (0.20)	162 (0.23)	0.828 (0.624–1.098)	0.215
IL4R rs1805015	n = 303	n = 436
TT	205 (0.68)	295 (0.68)	Referent	—	0.871
CT	82 (0.27)	121 (0.28)	0.975 (0.700–2.360)	0.933
CC	16 (0.05)	20 (0.05)	1.151 (0.583–2.275)	0.728
CT + CC	98 (0.32)	141 (0.32)	1.000 (0.731–1.368)	1.000
MAF	114 (0.19)	161 (0.18)	1.023 (0.784–1.335)	0.919
IL13 rs20541	n = 303	n = 436
CC	168 (0.55)	242 (0.56)	Referent	—	0.902
CT	114 (0.38)	166 (0.38)	0.989 (0.726–1.348)	1.000
TT	21 (0.07)	28 (0.06)	1.080 (0.594–1.967)	0.878
CT + TT	135 (0.45)	194 (0.44)	1.002 (0.746–1.346)	1.000
MAF	156 (0.26)	222 (0.25)	1.015 (0.800–1.287)	0.950
IL28B rs8099917	n = 339	n = 493
TT	219 (0.65)	317 (0.64)	Referent	—	0.858
GT	107 (0.31)	162 (0.33)	0.956 (0.709–1.289)	0.820
GG	13 (0.04)	14 (0.03)	1.344 (0.620–2.916)	0.549
GT + GG	120 (0.35)	176 (0.36)	0.987 (0.739–1.318)	0.941
MAF	133 (0.20)	190 (0.19)	1.022 (0.799–1.309)	0.910
IL28B rs12979860	n = 336	n = 488
CC	141 (0.42)	209 (0.43)	Referent	—	0.952
CT	157 (0.47)	221 (0.45)	1.053 (0.783–1.415)	0.763
TT	38 (0.11)	58 (0.12)	0.971 (0.612–1.541)	0.907
CT + TT	195 (0.56)	279 (0.57)	1.036 (0.782–1.373)	0.830
MAF	116 (0.29)	337 (0.35)	1.006 (0.819–1.237)	0.994
GC rs2298849	n = 364a	n = 524
TT	226 (0.62)	339 (0.65)	Referent	—	0.109
CT	110 (0.30)	165 (0.31)	1.000 (0.745–1.342)	1.000
CC	28 (0.08)	20 (0.04)	2.100 (1.155–3.819)	0.014
CT + CC	138 (0.38)	185 (0.35)	1.119 (0.848–1.477)	0.436
MAF	166 (0.23)	205 (0.20)	1.215 (0.964–1.530)	0.111
GC rs7041	n = 343	n = 506
GG	112 (0.33)	182 (0.36)	Referent	—	0.247
GT	163 (0.47)	236 (0.47)	1.122 (0.824–1.528)	0.480
TT	68 (0.20)	88 (0.17)	1.256 (0.846–1.863)	0.267
GT + TT	231 (0.67)	324 (0.64)	1.159 (0.867–1.548)	0.340
MAF	299 (0.44)	412 (0.41)	1.125 (0.925–1.369)	0.259
GC rs1155563	n = 362	n = 527
TT	180 (0.50)	252 (0.48)	Referent	—	0.614
CT	141 (0.39)	213 (0.40)	0.927 (0.696–1.234)	0.610
CC	41 (0.11)	62 (0.12)	0.926 (0.597–1.435)	0.740
CT + CC	182 (0.50)	275 (0.52)	0.927 (0.709–1.211)	0.585
MAF	223 (0.31)	337 (0.32)	0.947 (0.772–1.161)	0.638
VDR rs2228570	n = 345	n = 503
CC	101 (0.29)	130 (0.26)	Referent	—	0.541
CT	175 (0.51)	275 (0.55)	0.819 (0.594–1.130)	0.249
TT	69 (0.20)	98 (0.19)	0.906 (0.606–1.356)	0.682
CT + TT	244 (0.71)	373 (0.74)	0.842 (0.620–1.143)	0.273
MAF	313 (0.45)	471 (0.47)	0.943 (0.776–1.145)	0.588
VDR rs1544410	n = 359	n = 512
GG	137 (0.38)	189 (0.37)	Referent	—	0.598
AG	165 (0.46)	235 (0.46)	0.969 (0.720–1.303)	0.880
AA	57 (0.16)	88 (0.17)	0.894 (0.599–1.332)	0.613
AG + AA	222 (0.62)	323 (0.63)	0.948 (0.718–1.253)	0.722
MAF	279 (0.39)	411 (0.40)	0.948 (0.778–1.152)	0.626
RXRA rs10776909	n = 364	n = 526
CC	233 (0.64)	308 (0.59)	Referent	—	0.298
CT	111 (0.30)	196 (0.37)	0.749 (0.561–0.999)	0.050
TT	20 (0.05)	22 (0.04)	1.202 (0.641–2.254)	0.629
CT + TT	131 (0.36)	218 (0.41)	0.794 (0.603–1.046)	0.108
MAF	151 (0.21)	240 (0.23)	0.883 (0.702–1.112)	0.317
RXRA rs10881578	n = 365	n = 525
AA	197 (0.54)	252 (0.48)	Referent	—	0.134
AG	134 (0.37)	220 (0.42)	0.779 (0.586–1.035)	0.096
GG	34 (0.09)	53 (0.10)	0.821 (0.513–1.312)	0.478
AG + GG	168 (0.46)	273 (0.52)	0.787 (0.602–1.029)	0.088
MAF	202 (0.28)	326 (0.31)	0.850 (0.690–1.046)	0.139
RXRA rs749759	n = 355	n = 514
GG	207 (0.58)	265 (0.52)	Referent	—	0.082
AG	125 (0.35)	212 (0.41)	0.755 (0.567–1.005)	0.059
AA	23 (0.06)	37 (0.07)	0.796 (0.459–1.381)	0.490
AG + AA	148 (0.42)	249 (0.48)	0.761 (0.579–1.000)	0.053
MAF	171 (0.24)	286 (0.28)	0.823 (0.661–1.025)	0.092

ESRD: end-stage renal disease, DM: diabetes mellitus, and MAF: minor allele frequency.

aNot consistent with Hardy-Weinberg equilibrium.

Comparisons of genotype and allele frequencies between type 2 DM nephropathy patients and other ESRD groups revealed associations only with chronic infective tubulointerstitial nephritic patients in respect of IL18 rs360719 (Table 6, no significant results are shown). Frequency of IL18 rs360719 allele C carriers was higher in type 2 DM nephropathy patients than in those with chronic infective tubulointerstitial nephritis. The latter group showed lower frequency of IL18 rs360719 allele C carriers compared to healthy controls (Table 6).

Table 6

Selected comparisons of the polymorphic variants distribution of tested genes between type 2 DM nephropathy patients, chronic infective tubulointerstitial nephritic patients, and healthy subjects.

Genotype	Genotype frequencies		Odds ratio (95% CI)	Two-tailed P	P trend
Type 2 DM nephropathy versus chronic infective tubulointerstitial nephritis
IL18 rs360719	n = 248	n = 77
TT	133 (0.54)	54 (0.70)	Referent		0.033
CT	102 (0.41)	19 (0.25)	2.180 (1.217–3.905)	0.009a
CC	13 (0.05)	4 (0.05)	1.320 (0.412–4.228)	0.783
CT + CC	115 (0.46)	23 (0.30)	2.030 (1.173–3.512)	0.012a
MAF	128 (0.26)	27 (0.18)	1.636 (1.031–2.596)	0.046
Chronic infective tubulointerstitial nephritis versus healthy controls
IL18 rs360719	n = 77	n = 240
TT	54 (0.70)	121 (0.50)	Referent		0.005
CT	19 (0.25)	98 (0.41)	0.434 (0.242–0.781)	0.006a
CC	4 (0.05)	21 (0.09)	0.427 (0.140–1.303)	0.160
CT + CC	23 (0.30)	119 (0.50)	0.433 (0.250–0.750)	0.004a
MAF	27 (0.18)	140 (0.29)	0.516 (0.326–0.818)	0.006

DM: diabetes mellitus; MAF: minor allele frequency.

Significant differences are indicated using bold font.

aSignificant after the Bonferroni correction (P < 0.017).

Type 2 DM nephropathy patients with diagnosed CAD differed in tested genotype frequencies neither from type 2 DM nephropathy subjects without CAD (Table 7) nor from healthy controls (Table 8).

Table 7

Comparison of the distribution of polymorphic variants of tested genes between ESRD patients treated with hemodialysis due to type 2 DM nephropathy grouped by diagnosis of CAD.

Parameter	Type 2 DM nephropathy with CAD (frequency)	Type 2 DM nephropathy without CAD (frequency)	Odds ratio (95% CI)	Two-tailed P	P trend
IL18 rs360719	n = 124	n = 109
TT	68 (0.55)	53 (0.49)	Referent		0.269
CT	51 (0.41)	49 (0.45)	1.128 (0.725–1.754)	0.653
CC	5 (0.04)	7 (0.06)	0.628 (0.194–2.036)	0.557
CT + CC	56 (0.45)	56 (0.51)	0.879 (0.560–1.380)	0.645
MAF	61 (0.25)	63 (0.29)	0.803 (0.532–1.211)	0.345
IL12A rs568408	n = 117	n = 102
GG	83 (0.71)	77 (0.63)	Referent		0.361
AG	28 (0.24)	22 (0.22)	1.181 (0.623–2.236)	0.630
AA	6 (0.05)	3 (0.03)	1.855 (0.448–7.678)	0.502
AG + AA	34 (0.29)	25 (0.25)	1.262 (0.691–2.304)	0.542
MAF	40 (0.17)	28 (0.14)	1.311 (0.776–2.214)	0.378
IL12B rs3212227	n = 124	n = 109
AA	78 (0.63)	69 (0.63)	Referent		0.906
AC	43 (0.35)	36 (0.33)	1.057 (0.611–1.829)	0.889
CC	3 (0.02)	4 (0.04)	0.664 (0.143–3.069)	0.708
AC + CC	46 (0.37)	40 (0.37)	1.017 (0.597–1.734)	1.000
MAF	49 (0.20)	44 (0.20)	0.974 (0.618–1.535)	0.909
IL4R rs1805015	n = 144	n = 127
TT	95 (0.66)	86 (0.68)	Referent		0.947
CT	42 (0.29)	32 (0.25)	1.188 (0.689–2.048)	0.581
CC	7 (0.05)	9 (0.07)	0.704 (0.251–1.972)	0.605
CT + CC	49 (0.34)	41 (0.32)	1.082 (0.652–1.797)	0.797
MAF	56 (0.19)	50 (0.20)	0.985 (0.644–1.504)	0.944
IL13 rs20541	n = 144	n = 127
CC	80 (0.56)	71 (0.56)	Referent		0.867
CT	55 (0.38)	46 (0.36)	1.061 (0.640–1.759)	0.898
TT	9 (0.06)	10 (0.08)	0.799 (0.307–2.077)	0.808
CT + TT	64 (0.44)	56 (0.44)	1.014 (0.627–1.640)	1.000
MAF	73 (0.25)	92 (0.26)	0.967 (0.657–1.423)	0.944
IL28B rs8099917	n = 163	n = 145
TT	105 (0.64)	97 (0.67)	Referent		0.752
GT	52 (0.32)	42 (0.29)	1.144 (0.700–1.870)	0.618
GG	6 (0.04)	6 (0.04)	0.924 (0.288–2.961)	1.000
GT + GG	58 (0.36)	48 (0.33)	1.116 (0.697–1.189)	0.719
MAF	64 (0.20)	54 (0.19)	1.068 (0.714–1.597)	0.829
IL28B rs12979860	n = 163	n = 142
CC	69 (0.42)	66 (0.46)	Referent		0.352
CT	73 (0.45)	62 (0.44)	1.126 (0.698–1.816)	0.715
TT	21 (0.13)	14 (0.10)	1.435 (0.674–3.055)	0.448
CT + TT	94 (0.58)	76 (0.54)	1.183 (0.752–1.861)	0.490
MAF	115 (0.35)	90 (0.32)	1.175 (0.838–1.647)	0.396
GC rs2298849	n = 172	n = 158a
TT	99 (0.58)	106 (0.67)	Referent		0.173
CT	60 (0.35)	40 (0.25)	1.606 (0.989–2.608)	0.067
CC	13 (0.07)	12 (0.08)	1.160 (0.505–2.663)	0.833
CT + CC	73 (0.42)	52 (0.33)	1.503 (0.959–2.355)	0.088
MAF	166 (0.25)	64 (0.20)	1.313 (0.909–1.895)	0.174
GC rs7041	n = 161	n = 151
GG	57 (0.35)	46 (0.30)	Referent		0.844
GT	69 (0.43)	82 (0.54)	1.327 (0.825–2.134)	0.277
TT	35 (0.22)	23 (0.15)	1.629 (0.900–2.949)	0.136
GT + TT	104 (0.65)	105 (0.70)	1.061 (0.721–1.559)	0.769
MAF	139 (0.43)	128 (0.42)	1.025 (0.746–1.409)	0.943
GC rs1155563	n = 172	n = 157
TT	82 (0.48)	79 (0.50)	Referent		0.645
CT	70 (0.41)	61 (0.39)	1.106 (0.697–1.755)	0.724
CC	20 (0.12)	17 (0.11)	1.133 (0.554–2.321)	0.856
CT + CC	90 (0.52)	78 (0.50)	1.112 (0.721–1.714)	0.660
MAF	110 (0.32)	95 (0.30)	1.084 (0.779–1.508)	0.695
VDR rs2228570	n = 162	n = 152
CC	43 (0.27)	44 (0.29)	Referent		0.316
CT	93 (0.57)	68 (0.45)	1.400 (0.829–2.363)	0.230
TT	26 (0.16)	40 (0.26)	0.665 (0.348–1.272)	0.252
CT + TT	119 (0.73)	108 (0.71)	1.128 (0.688–1.849)	0.705
MAF	145 (0.45)	148 (0.49)	0.854 (0.624–1.169)	0.365
VDR rs1544410	n = 170	n = 155
GG	65 (0.38)	61 (0.39)	Referent		0.772
AG	79 (0.46)	72 (0.46)	1.030 (0.641–1.653)	0.905
AA	26 (0.15)	22 (0.14)	1.109 (0.569–2.160)	0.865
AG + AA	105 (0.62)	94 (0.61)	1.048 (0.671–1.639)	0.909
MAF	131 (0.39)	116 (0.37)	1.048 (0.763–1.440)	0.833
RXRA rs10776909	n = 172	n = 158
CC	112 (0.65)	104 (0.66)	Referent		0.621
CT	48 (0.28)	47 (0.30)	0.948 (0.585–1.537)	0.902
TT	12 (0.07)	7 (0.04)	1.592 (0.604–4.198)	0.473
CT + TT	60 (0.35)	54 (0.34)	1.032 (0.655–1.625)	0.908
MAF	72 (0.21)	61 (0.19)	1.107 (0.756–1.621)	0.672
RXRA rs10881578	n = 173	n = 158
AA	89 (0.51)	92 (0.58)	Referent		0.192
AG	65 (0.38)	53 (0.34)	1.268 (0.796–2.019)	0.345
GG	19 (0.11)	13 (0.08)	1.511 (0.704–3.241)	0.340
AG + GG	84 (0.49)	66 (0.42)	1.316 (0.852–2.032)	0.226
MAF	103 (0.30)	79 (0.25)	1.272 (0.902–1.793)	0.199
RXRA rs749759	n = 169	n = 153
GG	100 (0.59)	89 (0.58)	Referent		0.812
AG	59 (0.35)	54 (0.35)	0.972 (0.610–1.551)	1.000
AA	10 (0.06)	10 (0.07)	0.890 (0.354–2.238)	0.818
AG + AA	69 (0.41)	64 (0.42)	0.960 (0.615–1.496)	0.910
MAF	79 (0.23)	74 (0.24)	0.956 (0.665–1.375)	0.882

CAD: coronary artery disease, ESRD: end-stage renal disease, DM: diabetes mellitus, and MAF: minor allele frequency.

aNot consistent with Hardy-Weinberg equilibrium.

Table 8

Comparison of the distribution of polymorphic variants of tested genes between type 2 DM nephropathy patients with diagnosis of CAD and healthy controls.

Parameter	Type 2 DM nephropathy with CAD (frequency)	Healthy controls (frequency)	Odds ratio (95% CI)	Two-tailed P	P trend
IL18 rs360719	n = 124	n = 240
TT	68 (0.55)	121 (0.50)	Referent		0.186
CT	51 (0.41)	98 (0.41)	0.926 (0.590–1.453)	0.819
CC	5 (0.04)	21 (0.09)	0.424 (0.153–1.174)	0.122
CT + CC	56 (0.45)	119 (0.50)	0.837 (0.542–1.294)	0.440
MAF	61 (0.25)	140 (0.29)	0.792 (0.558–1.124)	0.223
IL12A rs568408	n = 117	n = 240
GG	83 (0.71)	171 (0.71)	Referent		0.626
AG	28 (0.24)	63 (0.26)	0.916 (0.546–1.535)	0.794
AA	6 (0.05)	6 (0.03)	2.060 (0.645–6.583)	0.348
AG + AA	34 (0.29)	69 (0.29)	1.015 (0.624–1.653)	1.000
MAF	40 (0.17)	75 (0.16)	1.113 (0.731–1.695)	0.695
IL12B rs3212227	n = 124	n = 240
AA	78 (0.63)	151 (0.63)	Referent		0.475
AC	43 (0.35)	77 (0.32)	1.081 (0.681–1.717)	0.813
CC	3 (0.02)	12 (0.05)	0.484 (0.133–1.766)	0.397
AC + CC	46 (0.37)	89 (0.37)	1.001 (0.639–1.567)	1.000
MAF	49 (0.20)	101 (0.21)	0.924 (0.631–1.354)	0.757
IL4R rs1805015	n = 144	n = 225
TT	95 (0.66)	162 (0.72)	Referent		0.285
CT	42 (0.29)	53 (0.24)	1.351 (0.838–2.179)	0.221
CC	7 (0.05)	10 (0.04)	1.194 (0.440–3.240)	0.798
CT + CC	49 (0.34)	63 (0.28)	1.326 (0.845–2.083)	0.246
MAF	56 (0.19)	73 (0.16)	1.247 (0.848–1.832)	0.305
IL13 rs20541	n = 144	n = 230
CC	80 (0.56)	124 (0.54)	Referent		0.469
CT	55 (0.38)	84 (0.36)	1.015 (0.653–1.578)	1.000
TT	9 (0.06)	22 (0.10)	0.634 (0.278–1.447)	0.324
CT + TT	64 (0.44)	106 (0.46)	0.936 (0.616–1.422)	0.831
MAF	73 (0.25)	128 (0.28)	0.881 (0.630–1.231)	0.510
IL28B rs8099917	n = 163	n = 375
TT	105 (0.64)	245 (0.65)	Referent		0.584
GT	52 (0.32)	123 (0.33)	0.986 (0.663–1.467)	1.000
GG	6 (0.04)	7 (0.02)	2.000 (0.656–6.094)	0.229
GT + GG	58 (0.36)	130 (0.35)	1.041 (0.709–1.530)	0.845
MAF	64 (0.20)	137 (0.18)	1.093 (0.786–1.521)	0.658
IL28B rs12979860	n = 163	n = 372
CC	69 (0.42)	164 (0.44)	Referent		0.281
CT	73 (0.45)	166 (0.45)	1.045 (0.705–1.549)	0.841
TT	21 (0.13)	42 (0.11)	1.188 (0.656–2.154)	0.644
CT + TT	94 (0.58)	208 (0.56)	1.074 (0.740–1.558)	0.776
MAF	115 (0.35)	250 (0.34)	1.077 (0.819–1.416)	0.644
GC rs2298849	n = 172	n = 375
TT	99 (0.58)	237 (0.63)	Referent		0.080
CT	60 (0.35)	124 (0.33)	1.158 (0.786–1.706)	0.486
CC	13 (0.07)	14 (0.04)	2.223 (1.008–4.901)	0.052
CT + CC	73 (0.42)	138 (0.37)	1.266 (0.876–1.830)	0.220
MAF	166 (0.25)	152 (0.20)	1.311 (0.969–1.774)	0.092
GC rs7041	n = 161	n = 361
GG	57 (0.35)	116 (0.32)	Referent		0.748
GT	69 (0.43)	186 (0.52)	0.755 (0.496–1.150)	0.196
TT	35 (0.22)	59 (0.16)	1.207 (0.714–2.040)	0.502
GT + TT	104 (0.65)	245 (0.68)	0.864 (0.584–1.278)	0.482
MAF	139 (0.43)	304 (0.42)	1.044 (0.801–1.362)	0.800
GC rs1155563	n = 172	n = 377
TT	82 (0.48)	189 (0.50)	Referent		0.378
CT	70 (0.41)	155 (0.41)	1.041 (0.710–1.527)	0.845
CC	20 (0.12)	33 (0.09)	1.397 (0.757–2.578)	0.332
CT + CC	90 (0.52)	188 (0.50)	1.103 (0.769–1.583)	0.646
MAF	110 (0.32)	221 (0.29)	1.134 (0.861–1.494)	0.411
VDR rs2228570	n = 162	n = 371
CC	43 (0.27)	103 (0.28)	Referent		0.386
CT	93 (0.57)	183 (0.49)	1.217 (0.788–1.880)	0.384
TT	26 (0.16)	85 (0.23)	0.733 (0.416–1.290)	0.321
CT + TT	119 (0.73)	268 (0.72)	1.064 (0.702–1.613)	0.833
MAF	145 (0.45)	353 (0.48)	0.893 (0.687–1.160)	0.434
VDR rs1544410	n = 170	n = 372
GG	65 (0.38)	148 (0.40)	Referent		0.880
AG	79 (0.46)	165 (0.44)	1.090 (0.734–1.620)	0.687
AA	26 (0.15)	59 (0.16)	1.003 (0.581–1.732)	1.000
AG + AA	105 (0.62)	224 (0.60)	1.067 (0.735–1.549)	0.776
MAF	131 (0.39)	283 (0.38)	1.021 (0.784–1.329)	0.931
RXRA rs10776909	n = 172	n = 378
CC	112 (0.65)	250 (0.66)	Referent		0.483
CT	48 (0.28)	112 (0.30)	0.957 (0.638–1.434)	0.838
TT	12 (0.07)	16 (0.04)	1.674 (0.767–3.656)	0.209
CT + TT	60 (0.35)	128 (0.34)	1.046 (0.716–1.529)	0.846
MAF	72 (0.21)	144 (0.19)	1.125 (0.819–1.545)	0.518
RXRA rs10881578	n = 173	n = 377
AA	89 (0.51)	183 (0.48)	Referent		0.682
AG	65 (0.38)	154 (0.41)	0.868 (0.591–1.275)	0.494
GG	19 (0.11)	40 (0.11)	0.977 (0.535–1.783)	1.000
AG + GG	84 (0.49)	194 (0.51)	0.890 (0.621–1.276)	0.582
MAF	103 (0.30)	234 (0.31)	0.942 (0.714–1.243)	0.725
RXRA rs749759	n = 169	n = 370
GG	100 (0.59)	221 (0.60)	Referent		0.924
AG	59 (0.35)	123 (0.33)	1.060 (0.718–1.566)	0.842
AA	10 (0.06)	26 (0.07)	0.850 (0.395–1.830)	0.710
AG + AA	69 (0.41)	149 (0.40)	1.023 (0.707–1.482)	0.925
MAF	79 (0.23)	175 (0.24)	0.985 (0.727–1.334)	0.983

CAD: coronary artery disease, DM: diabetes mellitus, and MAF: minor allele frequency.

4. Discussion

Genetic studies involving DM nephropathy and related complications are not consistent in many aspects [31-34]. Some polymorphisms tested in this study were reported as being associated with type 1 DM (IL12B rs3212227 [35], IL4R [36, 37], IL13 [37], VDR rs1544410 [38, 39], and VDR rs2228570 [38]), type 2 DM susceptibility (VDR rs2228570 [40], VDR rs1544410 [41]), and phenotype of type 2 DM (VDR rs2228570 [42], VDR rs1544410 [41, 43]). VDR rs2228570 and IL4 polymorphisms were also related to the risk of chronic kidney disease [44, 45]. On the other hand, there are also data indicating no major effect of IL12B on type 1 DM susceptibility in the entire study group [46], no association of IL4R with type 1 DM [47], no evident causal relationship between vitamin D pathway genes and type 2 DM, myocardial infarction or mortality [48], similar distribution of genotypes, allele and haplotypes of VDR rs2228570 and VDR rs731236 between type 2 DM patients and controls [49], no contribution of VDR rs1544410 to type 1 DM susceptibility [50], and no association of VDR rs1544410 with chronic kidney disease susceptibility [51].

In this study we were not able to show significant differences in the frequency distribution of tested polymorphic variants of T-cell-related cytokine genes or vitamin D pathway genes between HD patients with ESRD due to type 2 DM nephropathy and controls as well as HD patients with other causes of ESRD analyzed together. This lack of association was present although the examined type 2 DM nephropathy patients showed clinical complications more frequently than HD patients with other renal diseases: higher dialysis related mortality rate [3], higher prevalence of CAD including myocardial infarction [4], lower serum PTH, and lower frequency of parathyroidectomy and treatment with cinacalcet, all of them predictive for higher tendency to adynamic bone disease [7]. Type 2 DM nephropathy patients with or without diagnosis of CAD also did not differ in tested genotype distributions.

Development of ESRD substantially ameliorates interpatient clinical variability related to underlying renal impairment and exposes uremia-related signs and symptoms. Comparisons of type 2 DM nephropathy patients in respect of tested genotype frequencies with subjects showing other common causes of ESRD revealed that the former group has a higher IL18 rs360719 minor allele frequency than chronic infective tubulointerstitial nephritic group. In this case, lower IL18 rs360719 minor allele frequency in tubulointerstitial nephritic patients was observed also when their results were compared to those of healthy subjects. Sánchez et al. [52] have found a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor allele. IL-18 is IFN-γ inducing factor. Infective tubulointerstitial nephritic patients are known to have diminished ability of blood leukocytes to produce IFN-γ [53]. Our study indicates that this may be related to lower frequency of IL18 rs360719 minor allele in this group compared to controls and type 2 DM nephropathy patients. In type 2 DM patients with overt nephropathy, positive correlations between plasma IFN-γ, proteinuria, and eGFR were found [54].

Due to limited financial support, we did not perform any functional studies regarding T-cell-related interleukin and vitamin D pathway genes, especially that multiple influences independent or dependent on genetic profile need to be taken into account in such studies conducted in the uremic milieu. Although the examined patients showing ESRD due to type 2 DM nephropathy were well-defined group, they obviously were not consistent in HLA DRB1 alleles. The latter could be important in modulating susceptibility to advanced type 2 DM nephropathy and related complications, like it was shown for type 1 DM [55] or type 2 DM [41], regardless of their complications.

5. Summary

Distributions of tested T-cell cytokine gene polymorphisms or vitamin D pathway gene polymorphisms are not significantly different among patients with ESRD due to type 2 DM nephropathy and healthy individuals. Subjects with ESRD due to type 2 DM nephropathy differ in clinical manifestation from patients with other nephropathies leading to dialysis dependency, but differences in tested genotype distributions were found only in IL18 rs360719 compared with chronic tubulointerstitial nephritic patients. This difference probably arose from the fact that pathology of chronic infective tubulointerstitial nephritis might have been associated with this specific polymorphism.

6. Conclusions

In Polish HD patients, T-cell cytokine gene polymorphisms and vitamin D pathway gene polymorphisms are not associated with ESRD due to type 2 DM nephropathy. IL18 polymorphism is worthy to be further investigated in chronic infective tubulointerstitial nephritic patients as being possibly associated with this disease.