Literature DB >> 25582841

Secretory production of tetrameric native full-length streptavidin with thermostability using Streptomyces lividans as a host.

Shuhei Noda1, Takuya Matsumoto2, Tsutomu Tanaka3, Akihiko Kondo4,5.   

Abstract

BACKGROUND: Streptavidin is a tetrameric protein derived from Streptomyces avidinii, and has tight and specific biotin binding affinity. Applications of the streptavidin-biotin system have been widely studied. Streptavidin is generally produced using protein expression in Escherichia coli. In the present study, the secretory production of streptavidin was carried out using Streptomyces lividans as a host.
RESULTS: In this study, we used the gene encoding native full-length streptavidin, whereas the core region is generally used for streptavidin production in E. coli. Tetrameric streptavidin composed of native full-length streptavidin monomers was successfully secreted in the culture supernatant of S. lividans transformants, and had specific biotin binding affinity as strong as streptavidin produced by E. coli. The amount of Sav using S. lividans was about 9 times higher than using E. coli. Surprisingly, streptavidin produced by S. lividans exhibited affinity to biotin after boiling, despite the fact that tetrameric streptavidin is known to lose its biotin binding ability after brief boiling.
CONCLUSION: We successfully produced a large amount of tetrameric streptavidin as a secretory-form protein with unique thermotolerance.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25582841      PMCID: PMC4328045          DOI: 10.1186/s12934-014-0188-y

Source DB:  PubMed          Journal:  Microb Cell Fact        ISSN: 1475-2859            Impact factor:   5.328


Background

Streptavidin (Sav) is a tetrameric protein produced by Streptomyces avidinii, and has tight and specific biotin binding affinity with a dissociation constant of about 10−15 M [1-3]. The Sav-biotin system is widely used for biomolecule labeling, purification, immobilization, and more sophisticated biotechnology applications [4-6]. Sav is usually produced using recombinant Escherichia coli carrying the gene encoding the Sav core region (Savcore) [7-10]. Savcore consists of the residues Glu-14 to Ala-138 of native full-length Sav (Savnat), and is known to have resistance against further degradation by various proteases (Figure 1) [2,11]. The molecular weight of Savcore is 53 kDa, whereas that of Savnat is 66 kDa. Various Sav variants, such as Sav with higher affinity to biotin, have been produced using Savcore as the base [3,12]; however, there are few reports about the production of Savnat or its variants, and the N- and C-terminus regions have been recognized as useless parts in Sav.
Figure 1

Sav variants constructed in this study. (A) Savnat, native full-length Sav; (B) Savcore, Sav composed of the core region; (C) SavΔN, N-terminal region truncated Sav; (D) SavΔC, C-terminal region truncated Sav. Underline indicates original signal peptides of Sav.

Sav variants constructed in this study. (A) Savnat, native full-length Sav; (B) Savcore, Sav composed of the core region; (C) SavΔN, N-terminal region truncated Sav; (D) SavΔC, C-terminal region truncated Sav. Underline indicates original signal peptides of Sav. Streptomyces are gram-positive, filamentous soil bacteria known for their ability to secrete heterologous proteins in culture supernatants [13-15]. Streptomyces lividans is the most versatile host among this genus for the production of useful proteins. The secretory production of useful proteins is an important tool for protein production, and is industrially effective due to the simple purification procedures involved without refolding or protein extraction from the cell. There are a large number of reports concerning the secretory production of useful proteins using S. lividans as the host. Pozidis et al. successfully used it to produce a biopharmaceutical, mTNFa, derived from mouse [14]. Zhang et al. reported the secretory production of human interleukin-4 receptor [15]. Thus, S. lividans has great ability to express heterologous proteins, and has attracted attention as an industrial host for protein production [12]. Although the secretory production of various complex proteins, including mammalian proteins, using S. lividans has been demonstrated, there are few reports concerning the secretory production of multimeric proteins, such as dimers or tetramers. In the present study, we carried out the secretory production of tetrameric Savnat, which retained affinity to biotin, using recombinant S. lividans as the host. We previously reported the secretory production of various useful proteins using S. lividans as a host [16]. Using this system, we tried to produce Savnat and successfully demonstrated that S. lividans can be used for the secretory production of active-form tetrameric Sav. This result strongly suggests that S. lividans can be used for the secretory production of other useful multimeric proteins. In addition, to investigate the contribution of the N- and C-terminal regions of Savnat in Sav production using S. lividans, three truncated Sav variants, SavΔN, SavΔC, and Savcore, were constructed. Using these variants, we demonstrated that the N- and C-terminal regions of Sav were of significance in Sav production using S. lividans.

Results and discussion

The secretory production of Savnat using S. lividans and evaluation of biotin binding ability

Today, Sav is commercially produced using an E. coli expression system. Although Sav is a secretory-form protein originating from a species of Streptomyces, S. avidinii, its production using recombinant Streptomyces hasn’t been demonstrated. In the present report, we carried out secretory production of tetrameric Sav using S. lividans as the host strain. In order to produce Sav as a secretory-form protein using S. lividans, we constructed a vector for Sav expression. Although the synthetic gene of Savcore is usually used for Sav production in E. coli systems, we adopted the original full-length gene of Savnat derived from S. avidinii, which has high GC-content similar to the genome of S. lividans. Savnat involves additional amino acid residues at the N- and C-termini compared to Savcore (Figure 1). Figure 2(A) shows SDS-PAGE analysis of a standard sample of Sav (calculated MW, 53 kDa) and the purified Savnat produced by S. lividans (calculated MW, 66 kDa). Here, we evaluated biotin binding ability of Savnat produced by recombinant S. lividans. After immobilization of Savnat on a biotin-coated polystyrene plate, the unbound molecules were washed out, and then the biotin binding ability was assayed using biotin-HRP. Figure 2(B) shows the assay results for Savnat produced by S. lividans and a standard sample of Sav. Similar curves were observed between Savnat produced by S. lividans and the standard sample of Sav, whereas no corresponding curve was found when using BSA as a control. We thus successfully obtained active-form tetrameric Savnat using the secretory production system of S. lividans.
Figure 2

Sav standard sample and Sav produced in this study were evaluated using SDS-PAGE and biotin-avidin conjugation assay using biotin coated plates. (A) SDS-PAGE of Sav standard sample (Lane 1) and purified Savnat produced by S. lividans (Lane 2). (B) Biotin-avidin conjugation assays of Sav standard sample (diamonds), purified Savnat (circles), and BSA as a control (triangles).

Sav standard sample and Sav produced in this study were evaluated using SDS-PAGE and biotin-avidin conjugation assay using biotin coated plates. (A) SDS-PAGE of Sav standard sample (Lane 1) and purified Savnat produced by S. lividans (Lane 2). (B) Biotin-avidin conjugation assays of Sav standard sample (diamonds), purified Savnat (circles), and BSA as a control (triangles). One of the advantages of secretory production system using S. lividans is the productivity of the protein of interest. There are a lot of reports concerning the secretory production system using S. lividans as the host [13-16]. The secretory production of useful protein is one of practical ways for industrial protein production due to the simple purification procedures that proteins could be purified directly from the culture broth [14]. Here, to evaluate the utility of our secretory production system in Sav production, the Sav productivity using S. lividans was compared to that of using E. coli. 0.61 mg of SavEco was purified from the 100 mL culture broth, whereas the amount of purified Savnat using S. lividans as the host reached 3.1 mg from the 100 mL culture broth. In order to achieve the further Sav productivity, the signal peptide derived from phospholipase D from S. cinnamoneus (pld signal peptide) was fused in front of the gene encoding Savnat [16], meaning that Pld signal peptide existed in the N-terminus of the original signal peptide of Sav, and S. lividans/psSavnat was created. As the result, 5.6 mg of Savnat was purified from the 100 mL culture broth using S. lividans/psSavnat. Thus, the productivity of Sav using S. lividans was 9.2 times higher than that of using E.coli. There are some reports concerning Sav production using E. coli expression system. The amount of purified full-length Sav from 100 mL of culture broth reached 20 mg [9]. However, in that expression system, fermentor was used for Sav production, and the culture condition needed to be strictly controlled. In this study, Sav and the variants can be expressed and purified by using our simple and conventional procedure. This has a great benefit that we can rapidly produce and evaluate various types of Sav mutants. Recently, Nogueira et al. demonstrated full-length Sav production using the secretory production system using Pichia pastoris [17], and this system may be also applied to Sav variants production. Thus, secretory production can be one of promising tools to produce Sav variants, whereas the large amount of Sav could be obtained using large scale fermentation.

Production of truncated Sav variants and evaluation of the biotin binding ability

There are many reports concerning Sav production using E. coli as the host [7,9,10,18]. In these studies, Sav is produced as Savcore, which consists of the residues Glu-14 to Ala-138 of Savnat, and Savcore is famous for having resistance to further degradation by many kinds of proteases [2]. However, there are few reports concerning Savnat production, and the N- and C-terminal regions are not usually regarded as important in Sav production using E. coli. Here, we hypothesized that, in the case of secretory-form Sav production using S. lividans, the N- and C-terminal regions in Sav are significant. To investigate the role of the N- and C-terminal regions of Savnat, we tried to construct three Sav variants using S. lividans: Savcore, SavΔN, and SavΔC (Figure 1). S. lividans/Savcore, S. lividans/SavΔN, and S. lividans/SavΔC were successfully created. After cultivation, SavΔN and SavΔC were purified from the culture supernatants of S. lividans transformants; however, not enough Savcore was obtained for purification. Figure 3(A) shows SDS PAGE of purified SavΔN, and SavΔC using affinity column chromatography. We then evaluated their biotin binding ability. Figure 3(B) shows biotin binding assay results for each Sav variant. SavΔN and SavΔC showed lower biotin binding ability, compared to Savnat (Figure 3(B)).
Figure 3

Sav , Sav and Sav produced in this study were evaluated using SDS-PAGE and biotin-avidin conjugation assay using nickel coated plates. (A) SDS-PAGE of purified Sav variants (Lane 1, SavΔN; Lane 2, SavΔC). (B) Biotin-avidin conjugation assays of each Sav and the variant, Savnat (circles), SavΔC (diamonds), and SavΔN (squares).

Sav , Sav and Sav produced in this study were evaluated using SDS-PAGE and biotin-avidin conjugation assay using nickel coated plates. (A) SDS-PAGE of purified Sav variants (Lane 1, SavΔN; Lane 2, SavΔC). (B) Biotin-avidin conjugation assays of each Sav and the variant, Savnat (circles), SavΔC (diamonds), and SavΔN (squares). Some secretory proteins derived from Streptomyces are expressed as pro-proteins with a pro-domain. The pro-domain is known to play an important role and to promote correct folding and translocation of the protein into the culture supernatant. In secretory production of transglutaminase (MTG), the pro-domain of MTG is a significant factor governing its specific activity and productivity [19]. In the present study, Savcore couldn’t be obtained by using S. lividans secretory system although Sav is usually produced as Savcore in E.coli system. In addition, the biotin binding affinity of SavΔN and SavΔC were decreased, compared to that of Savnat (Figure 3(B)). Our current research might indicate that the N- and C-terminal regions of Sav are of significance to retain the activity, as well as the pro-domain of MTG.

Evaluation of the thermostability of Sav produced by S. lividans

Sav is a powerful tool in biotechnology and has been applied in various systems such as biomolecule labeling and immobilization of proteins or small molecules [4-6]. However, tetrameric Sav can usually be dissociated into monomeric Sav by simple boiling [3,9,12], and thus can be utilized only under mild conditions. Therefore, the construction of thermostable Sav can expand its potential applications. For instance, assembling biomass degradation enzymes from extreme thermophilic microbes on thermostable Sav will allow for artificial cellulosomes capable of reacting with high temperatures [20,21]. There are some reports concerning the importance of the thermostability of Sav or Sav mutants, and Chivers et al. successfully constructed a thermostable Sav mutant with the double mutation S52G/R53D [12]. In this study, we carried out the SDS-PAGE analysis of Savnat produced by S. lividans after boiling at 100°C for 60 min. Surprisingly, we found thermotolerance in this Savnat, although tetrameric Sav is generally known to dissociate into monomers and lose its biotin binding affinity after brief boiling. The molecular weight of Savnat monomer is 16.5 kDa whereas that of Savcore is 13.2 kDa. Figure 4(A) shows the SDS-PAGE analysis of the thermostability of SavEco produced by E. coli and Savnat produced by S. lividans. Each Sav was incubated at 100°C for 60 min. As shown in Figure 4(A), SavEco was almost completely dissociated after 5 min of incubation (Figure 4(A), lanes 1–3), whereas there was no complete dissociation of Savnat produced by S. lividans (Figure 4(A) lanes 4–6). According to previous reports concerning thermostability of streptavidin, streptavidin-biotin complex indicates high thermostability compared to streptavidin [22,23]. Here, we tried to quantify the amount of biotin binding to Savnat by HABA assay. However, no biotin was detected in purified Savnat, and thermostability of couldn’t be attributed to biotin binding. We also evaluated the biotin binding ability of each Sav. Figure 4(B) and (C) show the results of assays for biotin binding for each Sav after incubating at 100°C. In the case of SavEco produced by E. coli, the biotin binding ability was inactivated after only a 5-min incubation (Figure 4(B)). In the case of Savnat produced by S. lividans, although its biotin binding ability decreased, it retained much of its binding ability after boiling for 60 min. These results were consistent with those obtained from SDS analysis (Figure 4(A)). Although we also tested the thermostability of SavΔN and SavΔC, there was no complete dissociation of each Sav variant as well as Savnat (data not shown). These results may imply that N- and C-terminal regions of Savnat have no effect of the thermostability.
Figure 4

Thermostability of Sav produced by using in this study was evaluated, and compared to that of Sav produced by using . (A) SDS-PAGE of SavEco produced by E. coli (lanes 1–3) and purified Savnat produced by S. lividans (lanes 4–6) after boiling at 100°C for 0 min (lanes 1, 4), 10 min (lanes 2, 5), and 60 min (lanes 3, 6). (B) Biotin-avidin conjugation assays of SavEco after boiling at 100°C for 0 min (circles), 10 min (squares), and 60 min (diamonds). (C) Biotin-avidin conjugation assays of Savnat after boiling at 100°C for 0 min (circles), 10 min (squares), and 60 min (diamonds).

Thermostability of Sav produced by using in this study was evaluated, and compared to that of Sav produced by using . (A) SDS-PAGE of SavEco produced by E. coli (lanes 1–3) and purified Savnat produced by S. lividans (lanes 4–6) after boiling at 100°C for 0 min (lanes 1, 4), 10 min (lanes 2, 5), and 60 min (lanes 3, 6). (B) Biotin-avidin conjugation assays of SavEco after boiling at 100°C for 0 min (circles), 10 min (squares), and 60 min (diamonds). (C) Biotin-avidin conjugation assays of Savnat after boiling at 100°C for 0 min (circles), 10 min (squares), and 60 min (diamonds).

Conclusion

In the present study, Sav production using S. lividans as a host was successfully achieved. Sav was produced in its tetrameric form and had tight and specific biotin binding affinity. The Sav productivity using S. lividans system was 9.2 fold higher than E. coli system. In secretory production of Sav using S. lividans, the N- and C-terminal regions of Sav were necessary for correct folding and the Sav productivity. These results indicate that our protein secretion system may be used for the secretion of other multimeric proteins. In addition, Sav produced by S. lividans exhibited thermostability, and its biotin binding affinity was retained after boiling. This thermotolerant Sav has many potential applications in biotechnology.

Methods

Plasmid construction, transformation, and cultivation

Escherichia coli NovaBlue {endA1 hsdR17(r− m+) supE44 thi-I gyrA96 relA1 lac recA1/F’[proAB+lacIq ZΔM15::Tn10(Tetr)]} (Novagen, Inc., Madison, WI, USA), used to construct plasmids, was grown in Luria-Bertani (LB) medium containing 40 μg/ml kanamycin at 37°C. The vectors for protein expression using S. lividans as a host were constructed as follows. The strains and the plasmids used in this study are summarized in Table 1. Polymerase chain reaction (PCR) was carried out using PrimeSTAR HS (TAKARA BIO, Shiga, Japan). The gene fragment encoding Savnat was amplified by PCR using S. avidinii (NBRC13429) as a template with the corresponding primers (Table 1). The Savnat fragment was introduced into the NdeI and HindIII sites of pTONA4. The resultant plasmid was called pTONA4- Savnat. The gene fragment encoding SavΔN or SavΔC was amplified by PCR using pTONA4-Savnat as a template with the corresponding primers (Table 1), respectively. The SavΔN or SavΔC fragments with the signal peptide sequences of Sav, Sav-sig_F, and Sav-sig_R, were introduced into the NdeI and HindIII sites of pTONA4, respectively. The resultant plasmids were called pTONA4-SavΔN and pTONA4-SavΔC, respectively. The gene fragment encoding Savcore or Savnat-ps was amplified by PCR using pTONA4-Savnat as a template with SavΔN to ps_F and SavΔC_R or Sav_os_to_ps_F and Sav_Rv, respectively (Table 1). The Savcore or Savnat-ps fragment was introduced into the NheI and BglII sites of pUC702-pro-sig-term, respectively. The resultant plasmid was called pUC702-ps-Savcore or pUC702-ps-Savnat, respectively. The gene fragment encoding ps-Savcore or ps-Savnat was amplified by PCR using pUC702-ps- Savcore or pUC702-ps- Savnat as a template with ps_F and SavΔC_R or ps_F and Sav_R, respectively (Table 1). The ps-Savcore or ps-Savnat fragment was introduced into the NdeI and HindIII sites of pTONA4, respectively [24]. The resultant plasmid was called pTONA4-Savcore or pTONA4-ps-Savnat, respectively. The nucleotide sequences of Sav and Sav variants expressed using S. lividans in this study are shown in Additional file 1. The gene fragment encoding Sav for the construction of the E. coli expression vector was amplified by PCR using pWI3SAFlo318 as a template with KpnI_XhoI_Sav_F and Sav_TAG_BamHI_EcoRI_R [25]. The SavEco fragment was digested using KpnI and EcoRI and introduced into the KpnI and EcoRI sites of pColdI. The resultant plasmid was called pColdI-SavEco.
Table 1

Strains, plasmids, transformants, and oligonucleotide primers used in this study

Strain, plasmid, primer, or transformant Relevant features Source or reference
Strains
Escherichia coli
Nova blue endA1 hsdR17(rK12 -mK12 +) supE44 thi-I gyrA96 relA1 lac recA1/F’[proAB+ lacIq ZΔM15::Tn10(Tetr)]Novagen
S17-1 λpir TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpirBIOMEDAL
BL21 (DE3) pLysSF ompT hsdS(r B m B ) gal dcm λ(DE3) pLysS (Camr) (λ(DE3): lacI,lacUV5-T7 gene 1,ind1,sam7,nin5)TAKARA BIO
Streptomyces lividans
Streptomyces lividans 1326WT strain (NBRC 15675)NBRC
Plasmids
pTONA4Versatile vector for protein expression in Streptomyces; thiostrepton and kanamycin resistance marker[24]
pUC702-pro-sig-termVersatile vector for protein expression; thiostrepton resistance marker[16]
pUC702-ps-Savcore Vector for Sav (core) expression; thiostrepton resistance markerThis study
pUC702-ps-Savnat Vector for Sav (native) expression; thiostrepton resistance markerThis study
pTONA4-Savnat Vector for Sav (native) expression; thiostrepton and kanamycin resistance markerThis study
pTONA4-ps-Savnat Vector for Sav (native) expression; thiostrepton and kanamycin resistance markerThis study
pTONA4-Savcore Vector for Sav (core) expression; thiostrepton and kanamycin resistance markerThis study
pTONA4-SavΔC Vector for Sav-ΔC expression; thiostrepton and kanamycin resistance markerThis study
pTONA4-SavΔN Vector for Sav-ΔN expression; thiostrepton and kanamycin resistance markerThis study
pWI3SAFlo318Vector used as a template for amplifying the synthetic gene of streptavidin[25]
pColdIVersatile vector for protein expression in E. coli; ampicillin resistance markerTAKARA BIO
pColdI-SavVector for Sav expression; ampicillin resistance markerThis study
Transformants
S. lividans/Savnat S. lividans transformant harboring pTONA4-Savnat This study
S. lividans/Savcore S. lividans transformant harboring pTONA4- Savcore This study
S. lividans/psSavnat S. lividans transformant harboring pTONA4-ps-Savnat This study
S. lividans/SavΔC S. lividans transformant harboring pTONA4- SavΔCThis study
S. lividans/SavΔN S. lividans transformant harboring pTONA4- SavΔNThis study
E. coli/SavEco E. coli transformant harboring pColdI-SavThis study
Oligonucleotide primers
Sav_FTCGTTTAAGGATGCAatgcgcaagatcgtcgttgca
Sav_RCGCTCAGTCGTCTCAgtggtggtggtggtggtgctgctgaacggcgtcgagcgggtt
SavΔN_FGCCAGCGCTTCGGCAgaggccggcatcaccggcacctgg
SavΔC_RCGCTCAGTCGTCTCAgtggtggtggtggtggtgggaggcggcggacggcttca
Sav-sig_FTCGTTTAAGGATGCAatgcgcaagatcgtcgttgcagccatcgccgtttccctgaccacggtctcgattacggccagcgcttcggca
Sav-sig_RtgccgaagcgctggccgtaatcgagaccgtggtcagggaaacggcgatggctgcaacgacgatcttgcgcatTGCATCCTTAAACGA
SavΔN_to_ps_FGCGGCTCCGGCCTTCgaggccggcatcaccggcacctgg
Sav_os_to_ps_FGCGGCTCCGGCCTTCatgcgcaagatcgtcgttgca
ps_FTCGTTTAAGGATGCAGCATGCTCCGCCACCGGCTCCGCCG
Kpn1_Xho1_Stav_FGGGGTACCCTCGAGGCCGAGGCCGGCATCACCGGCACCTGG
Stav_TAG_BamH1_EcoR1_RGGAATTCGGATCCCGCTAGGAGGCGGCGGACGGCTTCACCTTGGTGAAGGT
Strains, plasmids, transformants, and oligonucleotide primers used in this study E. coli S17-1 λpir (TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir) was transformed with each constructed plasmid. A single colony of each transformant was cultivated in 3 ml of LB medium containing 40 μg/ml kanamycin at 37°C for 8 h. Cells were harvested, and the cell suspension was washed three times with LB broth and centrifuged to remove kanamycin. The cells were then suspended in 500 μl of LB broth and mixed with S. lividans spores. The mixture was plated on ISP4 medium (1.0% soluble starch, 0.1% K2HPO4, 0.1% MgSO47H2O, 0.1% NaCl, 0.2% (NH4)2SO4, 0.2% CaCO3, 0.0001% FeSO4, 0.0001% MnCl2, 0.0001% ZnSO4, and 2.0% agar). The mixture was then incubated for 18 h at 30°C. A 3-ml aliquot of soft-agar nutrient broth containing kanamycin (50 μg/ml) and nalidixic acid (67 μg/ml) was dispensed in layers on the plate, which was then incubated at 30°C for 5–7 days. A single colony was streaked on an ISP4 agar plate containing kanamycin (50 μg/ml) and nalidixic acid (5 μg/ml). The plate was incubated at 30°C for 5–7 days, and selected transformants were named S. lividans/Savnat, S. lividans/Savcore, S. lividans/psSavnat, S. lividans/SavΔN, and S. lividans/SavΔC, respectively. For production of Sav variants, a single colony of S. lividans/Savnat, S. lividans/Savcore, S. lividans/psSavnat, S. lividans/SavΔN, and S. lividans/SavΔN were inoculated in a test tube containing 5 ml of TSB medium supplemented with 50 μg/ml of kanamycin, followed by cultivation at 28°C for 3 days. Then, 5 ml of the preculture media of S. lividans/Savnat, S. lividans/Savcore, S. lividans/psSavnat, S. lividans/SavΔN, and S. lividans/SavΔC were seeded into a shaker flask with a baffle containing 100 ml of modified TSB medium with 5% tryptone, 50 μg/ml kanamycin, and 3% glucose as a carbon source, followed by incubation at 28°C for 5–6 days. Hexahistidine tagged Sav produced by E. coli (SavEco) was produced as follows. The plasmid pColdI-Sav was introduced into E. coli BL21 (DE3) pLysS, and the resultant E. coli transformant was called E. coli/SavEco. Cells were grown in LB medium to an OD (600 nm) of 0.5 at 37°C, then cells were incubated a further 30 min at 15°C. Expression of the protein was induced by the addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM. After growth for an additional 24 h at 15°C, cells were harvested by centrifugation. The cell pellets were resuspended in 50 mM phosphate, 150 mM NaCl, pH 8.0 and lysed by sonication.

Purification of Sav and Sav variants

Each culture supernatant (300 ml) of S. lividans/Savnat, S. lividans/Savcore, S. lividans/SavΔN, and S. lividans/SavΔC was precipitated by ammonium sulfate. The precipitate of each was collected by centrifugation at 20,000 g for 30 min and dissolved with buffer B (50 mM Tris–HCl, 300 mM NaCl, pH 7.5). Each Sav was purified using TALON metal affinity resins (TAKARA BIO, Shiga, Japan) according to the manufacturer’s protocol. After purification, both of the purified protein fractions were dialyzed with 50 mM phosphate buffer and 150 mM NaCl at pH 7.5. In the case of SavEco purification, culture broth (600 ml) of cell extract of E. coli/SavEco was directly purified using TALON metal affinity resins in a similar fashion. In this study, biotin binding ability was quantified by using Pierce Biotin Quantitation Kit (Thermo Fisher Scientific, Waltham, MA).

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)

10 μl aliquots of each purified protein were directly mixed with SDS-PAGE buffer (2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.002% bromophenol blue, 0.125 M Tris–HCl, pH 6.8) and boiled. The protein samples were fractionated on a 15% SDS-PAGE gel which was then stained with Coomassie Brilliant Blue R-250 (Nacalai Tesque, Kyoto, Japan). The concentrations of purified Savnat, SavΔN, SavΔC, and SavEco were determined using a BCA protein assay kit (Thermo Fisher Scientific).

Immobilization and biotin-avidin conjugation assays of purified Sav variants

The standard sample of Sav (Nacalai Tesque, Kyoto, Japan) and Savnat produced by S. lividans were immobilized on biotin coated plates. The maximal amount of each Sav added to the plates was 300 μg/mL. Each Sav was incubated in a 96-well biotin-coated plate (Thermo Fisher Scientific) for 30 min at 4°C. The wells were then washed with TBST three times, and 5 μg/L biotinylated horseradish peroxidase (biotin-HRP) (Thermo Fisher Scientific) per well were incubated for 1 h at room temperature. After washing wells with TBST three times, HRP activity was assayed with an ELISA POD substrate TMB Kit (Nacalai Tesque). Then the absorbance of 450 nm was analyzed with a plate reader (Wallac 1420 ARVOsx). SavEco, SavΔN, and SavΔC were immobilized on nickel-coated plates (Thermo Fisher Scientific). The maximal amount of each Sav added to the plate was 300 μg/mL. After immobilization of each Sav, HRP activity was assayed in a similar fashion.
  25 in total

1.  Designer cellulosomes for enhanced hydrolysis of cellulosic substrates.

Authors:  Yael Vazana; Sarah Moraïs; Yoav Barak; Raphael Lamed; Edward A Bayer
Journal:  Methods Enzymol       Date:  2012       Impact factor: 1.600

2.  Molecular cloning and nucleotide sequence of the streptavidin gene.

Authors:  C E Argaraña; I D Kuntz; S Birken; R Axel; C R Cantor
Journal:  Nucleic Acids Res       Date:  1986-02-25       Impact factor: 16.971

3.  Expression of a cloned streptavidin gene in Escherichia coli.

Authors:  T Sano; C R Cantor
Journal:  Proc Natl Acad Sci U S A       Date:  1990-01       Impact factor: 11.205

4.  Interaction of biotin with streptavidin. Thermostability and conformational changes upon binding.

Authors:  M González; L A Bagatolli; I Echabe; J L Arrondo; C E Argaraña; C R Cantor; G D Fidelio
Journal:  J Biol Chem       Date:  1997-04-25       Impact factor: 5.157

5.  High-yield production and purification of recombinant T7-tag mature streptavidin in glucose-stressed E. coli.

Authors:  Nicolas Humbert; Peter Schürmann; Andrea Zocchi; Jean-Marc Neuhaus; Thomas R Ward
Journal:  Methods Mol Biol       Date:  2008

6.  Cloning, expression, and purification of soluble human interleukin-4 receptor in Streptomyces.

Authors:  Yong Zhang; Wei Chi Wang; Yuan Li
Journal:  Protein Expr Purif       Date:  2004-07       Impact factor: 1.650

7.  Secretion of active-form Streptoverticillium mobaraense transglutaminase by Corynebacterium glutamicum: processing of the pro-transglutaminase by a cosecreted subtilisin-Like protease from Streptomyces albogriseolus.

Authors:  Yoshimi Kikuchi; Masayo Date; Kei-ichi Yokoyama; Yukiko Umezawa; Hiroshi Matsui
Journal:  Appl Environ Microbiol       Date:  2003-01       Impact factor: 4.792

8.  The quaternary structure of streptavidin in urea.

Authors:  G P Kurzban; E A Bayer; M Wilchek; P M Horowitz
Journal:  J Biol Chem       Date:  1991-08-05       Impact factor: 5.157

9.  High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis.

Authors:  Elisa S Nogueira; Thomas Schleier; Marc Dürrenberger; Kurt Ballmer-Hofer; Thomas R Ward; Rolf Jaussi
Journal:  Protein Expr Purif       Date:  2013-10-31       Impact factor: 1.650

10.  Benzoic acid fermentation from starch and cellulose via a plant-like β-oxidation pathway in Streptomyces maritimus.

Authors:  Shuhei Noda; Eiichi Kitazono; Tsutomu Tanaka; Chiaki Ogino; Akihiko Kondo
Journal:  Microb Cell Fact       Date:  2012-04-30       Impact factor: 5.328

View more
  2 in total

1.  The pilot-scale preparation of the SA-hGM-CSF bi-functional fusion protein.

Authors:  Xiaoqing Li; Shirong Zhou; Yao Wang; Hui Lian; Anxin Zuo; Kaihua Zhou; Ling Tong; Zhujun Zhou; Jimin Gao
Journal:  Bioengineered       Date:  2019-12       Impact factor: 3.269

Review 2.  Streptomyces as Microbial Chassis for Heterologous Protein Expression.

Authors:  Soonkyu Hwang; Yongjae Lee; Ji Hun Kim; Gahyeon Kim; Hyeseong Kim; Woori Kim; Suhyung Cho; Bernhard O Palsson; Byung-Kwan Cho
Journal:  Front Bioeng Biotechnol       Date:  2021-12-21
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.