Hye-Jin Lee1, Shin-Bum Jo1, Anthony I Romer2, Hyo-Jeong Lim1, Min-Jung Kim3, Seung-Hoi Koo3, Robert S Krauss4, Jong-Sun Kang5. 1. Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, Samsung Biomedical Research Institute, Suwon, Republic of Korea. 2. Department of Developmental and Regenerative Biology, Icahn School of Medicine at Mount Sinai, New York, NY Graduate School of Biological Sciences, Icahn School of Medicine at Mount Sinai, New York, NY. 3. Division of Life Sciences, Korea University, Seoul, Republic of Korea. 4. Department of Developmental and Regenerative Biology, Icahn School of Medicine at Mount Sinai, New York, NY Graduate School of Biological Sciences, Icahn School of Medicine at Mount Sinai, New York, NY kangj01@skku.edu robert.krauss@mssm.edu. 5. Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, Samsung Biomedical Research Institute, Suwon, Republic of Korea kangj01@skku.edu robert.krauss@mssm.edu.
Abstract
Obesity arises from a combination of genetic, environmental, and behavioral factors. However, the processes that regulate white adipose tissue (WAT) expansion at the level of the adipocyte are not well understood. The Hedgehog (HH) pathway plays a conserved role in adipogenesis, inhibiting fat formation in vivo and in vitro, but it has not been shown that mice with reduced HH pathway activity have enhanced adiposity. We report that mice lacking the HH coreceptor BOC displayed age-related overweight and excess WAT. They also displayed alterations in some metabolic parameters but normal food intake. Furthermore, they had an exacerbated response to a high-fat diet, including enhanced weight gain and adipocyte hypertrophy, livers with greater fat accumulation, and elevated expression of genes related to adipogenesis, lipid metabolism, and adipokine production. Cultured Boc(-/-) mouse embryo fibroblasts showed enhanced adipogenesis relative to Boc(+/+) cells, and they expressed reduced levels of HH pathway target genes. Therefore, a loss-of-function mutation in an HH pathway component is associated with WAT accumulation and overweight in mice. Variant alleles of such HH regulators may contribute to WAT accumulation in human individuals with additional genetic or lifestyle-based predisposition to obesity.
Obesity arises from a combination of genetic, environmental, and behavioral factors. However, the processes that regulate white adipose tissue (WAT) expansion at the level of the adipocyte are not well understood. The Hedgehog (HH) pathway plays a conserved role in adipogenesis, inhibiting fat formation in vivo and in vitro, but it has not been shown that mice with reduced HH pathway activity have enhanced adiposity. We report that mice lacking the HH coreceptor BOC displayed age-related overweight and excess WAT. They also displayed alterations in some metabolic parameters but normal food intake. Furthermore, they had an exacerbated response to a high-fat diet, including enhanced weight gain and adipocyte hypertrophy, livers with greater fat accumulation, and elevated expression of genes related to adipogenesis, lipid metabolism, and adipokine production. Cultured Boc(-/-) mouse embryo fibroblasts showed enhanced adipogenesis relative to Boc(+/+) cells, and they expressed reduced levels of HH pathway target genes. Therefore, a loss-of-function mutation in an HH pathway component is associated with WAT accumulation and overweight in mice. Variant alleles of such HH regulators may contribute to WAT accumulation in human individuals with additional genetic or lifestyle-based predisposition to obesity.
The prevalence of obesity and associated metabolic pathologies has attracted attention to the identification of etiological factors (1,2). Obesity arises from genetic, environmental, and behavioral factors that influence energy balance. The principal feature of obesity is excessive accumulation of white adipose tissue (WAT) (1,3–5). Although obesity is understood to be a centrally regulated consequence of overnutrition and/or reduced expenditure of energy, the processes that regulate WAT expansion at the level of the adipocyte are not well characterized.WAT expansion occurs through adipocyte hypertrophy and hyperplasia, so such processes presumably engage at some level the process of adipogenesis (3,4). Adipogenesis has been analyzed with preadipocyte cell lines such as 3T3-L1 and various mutant mouse lines (6). These studies elucidated a transcriptional network centered around PPARγ and C/EBP family members, which drive differentiation of preadipocytes into lipid-accumulating adipocytes (6). Recent studies have identified cells in the stromal vascular fraction (SVF) of WAT that are bona fide adipocyte progenitor cells (7,8). Such cells in WAT must respond to hormonal and local cues that regulate homeostatic maintenance of this tissue. The cues that act on adipocyte progenitor cells are not well understood, but among those implicated is the Hedgehog (HH) signaling pathway.HH proteins regulate developmental events in organisms as diverse as insects and mammals. Among mammalian HH proteins, Sonic Hedgehog (SHH) plays the broadest role and is involved in the growth and/or morphogenesis of many body structures (9). HH proteins activate a conserved signal transduction pathway (10–12). In the absence of ligand, the primary HH receptor PTCH1 functions to inhibit signaling by a second membrane protein, SMO. Binding of HH to PTCH1 relieves inhibition of SMO, and SMO signals to activate pathway target genes via GLI transcription factors. Among such target genes are Gli1 and Ptch1 themselves, and they are often used as readouts of pathway activity (10–12).CDO (also called CDON), BOC, and GAS1 are cell surface proteins that promote HH pathway activity as ligand-binding coreceptors with PTCH1 (13–20). CDO and BOC are related transmembrane proteins (21,22), whereas GAS1 is a GPI-anchored protein unrelated to CDO and BOC (23). Analysis of mice with targeted mutations in Cdon, Boc, and Gas1 revealed that although none is essential for HH pathway activity, they are collectively required for pathway function in the early mouse embryo (13,14,16,19). A ternary complex of HH ligand, PTCH1, and at least one of these coreceptors appears to be required for successful signal transduction (15,16,24). Boc-null mice, the subject of this study, are viable and fertile but display defects in SHH-dependent neural patterning and axon guidance (19,25–28).The HH pathway negatively regulates adipogenesis. Activation of the HH pathway with either SHH or the SMO agonist purmorphamine inhibited adipogenesis of 3T3-L1 and additional cell lines (29–32). Furthermore, blockade of HH signaling, with a dominant-negativeform of GLI2 or the SMO antagonist cyclopamine, enhanced adipogenesis of these cells in response to inducing factors (31,32). HH signals blocked early steps of adipogenesis, upstream of the expression of PPARγ (29,31,32). These studies suggest that the HH pathway functions to block differentiation of preadipocytes in vitro. Experiments in mice are consistent with this notion. Adult mice homozygous for a hypomorphic allele of Ptch1 showed reduced WAT mass, which had lower levels of adipose markers and elevated levels of HH target genes (33). Adipose tissue–specific mutation of another HH pathway inhibitor, Sufu, led to a loss of WAT (34). Finally, mice with diet-induced or genetic (ob/ob) obesity displayed decreased expression of HH pathway components (31).Although mice with a genetic gain of function in HH pathway activity showed loss of WAT (33,34), it has not been demonstrated that mice with a loss of HH activity have enhanced adiposity. We report that mice with a germline mutation in Boc display age-dependent overweight due to an increase in WAT. These mice also show an exaggerated response to a high-fat diet (HFD), and Boc embryo fibroblasts differentiate into adipocytes more efficiently than wild-type cells. These results reveal that BOC, presumably acting as an SHH coreceptor, is required for maintenance of normal weight in vivo and appropriate regulation of adipogenic differentiation in vitro.
Research Design and Methods
Mice
Bocmice (19) were backcrossed onto a C57BL/6N background for at least six generations. For age-related effects, male Boc or Bocmice backcrossed for six generations were used and weighed every 4 weeks over 32 weeks. To assess food intake, food was weighed and replenished every other day for individually caged mice for 2 weeks. For HFD-induced effects, male Boc or Bocmice backcrossed for 10 generations were used. Four-week-old mice were fed with HFD (60% fat content; Harlan) and weighed weekly over 8 weeks. For blood glucose levels, tail vein blood was used after animals were fasted for 16 h, with free access to water. For the glucose tolerance test (GTT), mice were fasted for 16 h and injected intraperitoneally with 1.5 g 20% d-glucose/kg body weight (Sigma-Aldrich), followed by measurement of blood glucose levels. For the insulin tolerance test (ITT), mice were fasted for 6 h and injected intraperitoneally with 1 IU insulin/kg body weight (Sigma-Aldrich), followed by measurement of glucose levels. Mouse tissues were immediately frozen in liquid nitrogen and stored at −70°C or fixed in 4% paraformaldehyde (PFA). Plasma insulin was measured with the Mouse Insulin ELISA Kit (U-type; Shibayagi Corp.), and serum triglycerides and nonesterified fatty acids were measured by colorimetric assay kits (Wako).For assessment of metabolic parameters (Fig. 2), 5-month-old Boc and Bocmice were analyzed with metabolic cages (Harvard Apparatus; Panlab). Measurements were performed for 48 h, during which animals had access to food and water. Core body temperature was measured with an HB-101 homeothermic blanket/pad equipment (Harvard Apparatus).
Figure 2
Alterations in whole-body metabolism of Boc mice. A: Body weights. B: Body temperature. C: Rearing activity. D: Locomotion. E: O2 consumption (VO2). F: CO2 production (VCO2). G: Respiratory quotient (RQ). H: Energy expenditure (EE). Normal chow-fed, 5-month-old Boc and Boc mice were measured with metabolic cages (n = 6). Data in A–H represent means ± SEM. ***P < 0.001; *P < 0.05.
Histology, Oil Red O Staining, and Placental Alkaline Phosphatase Staining
For hematoxylin-eosin (H-E) staining, WAT and liver tissues were fixed and processed for 20-μm paraffin sections. For Oil Red O staining, livers were fixed in 4% PFA and dehydrated by sucrose gradient followed by an optimal cutting temperature compound-cryosection (10 μm) and Oil Red O staining. For Oil Red O staining of differentiated mouse embryonic fibroblasts (MEFs) and 3T3-L1 cells, cultures were fixed in 10% formaldehyde for 10 min and stained with Oil Red O. Stained plates were treated with 1 mL isopropanol/4% NP-40 for 10 min by a gentle shaking, and extracted Oil Red O was quantified by measuring optical density at 520 nm. For placental alkaline phosphatase (PLAP) staining, tissues were fixed with 2% PFA plus 0.2% glutaraldehyde for 2 h at 4°C, washed in PBS, permeabilized in 0.3% Triton overnight at 4°C, washed in saline, heat inactivated for 30 min at 72°C, washed in NTM (100 mmol/L NaCl, 100 mmol/L Tris-HCl, pH 9.5, 50 mmol/L MgCl2) buffer, and stained with BM purple (Roche).
Cell Cultures
Preparation of the SVF from WAT was performed as previously described (8). In brief, WAT was minced with scissors and digested with 2 mg/mL Collagenase I (Sigma-Aldrich) in DMEM at 37°C for 1 h. DMEM plus 10% FBS was added to double the volume, floating adipocytes were removed, and the digest was filtered through a 100-μm mesh that retained vessels of the stromal-particulate fraction. The filtrate was centrifuged at 800g for 5 min, and the SVF pellet was resuspended in DMEM containing 10% FBS and cultured for 2 days.Isolation of primary MEFs was carried out as previously described (35). 3T3-L1 cells and MEFs were cultured in growth medium (DMEM plus 10% FBS) at subconfluence. For adipocyte differentiation, cells were grown to confluence and switched into differentiation medium I (growth medium plus 0.5 μmol/L IBMX, 1 μg/μL insulin, 0.25 μmol/L dexamethazone, 2 μmol/L rosiglitazone; Sigma-Aldrich) for 2 days. The culture medium was then changed to differentiation medium II (growth medium plus 2 μmol/L rosiglitazone), and the medium was changed every 2 days. To activate SHH signaling, MEFs were treated with 250 ng/mL SHH (R&D Systems) or 5.2 μmol/L purmorphamine (Calbiochem) in differentiation media from differentiation day 2 onward.
Immunoblotting
Immunoblotting was performed as previously described (15). Antibodies used are listed in Table 1.
Table 1
The antibodies used in this study
CDO
R&D Systems
BOC
R&D Systems
Gli1
Santa Cruz Biotechnology
Gas1
Santa Cruz Biotechnology
Ptch1
Santa Cruz Biotechnology
C/EBPα
Santa Cruz Biotechnology
FAS
Abcam
PPARγ
Santa Cruz Biotechnology
SCD1
Santa Cruz Biotechnology
Acc
Cell Signaling Technology
aP2
Cayman
SREBP1c
Santa Cruz Biotechnology
β-Actin
Sigma-Aldrich
HSP90
Santa Cruz Biotechnology
The antibodies used in this study
PCR and Quantitative RT-PCR Analysis
Tissues were homogenized with FastPrep-24 (MP Biomedicals) and extracted with the RNA Extraction Kit (iNtRON). cDNA was generated with PrimeScript RT Reagent Kit (Takara) and amplified with nTaq polymerase (Enzynomics). Quantitative RT-PCR (qRT-PCR) was performed with SYBR Green (Takara) and analyzed with a TP8000 System (Takara). All data are normalized to the expression of ribosomal protein–encoding L32. Primers used in this study are listed in Table 2.
Table 2
The primer sequences used in this study
Boc
Forward
5′AGCAGCTGGTGAGTTGAGTC3′
Backward
5′GGAGCTTGCCCAGCAGC3′
Cdo
Forward
5′GCAACCAGAAAGGGAAGGGT3′
Backward
5′GAGCTCAGACTTGGCACCTT3′
Ptch1
Forward
5′GCCACAGCCCCTAACAAAA3′
Backward
5′CCCACAATCAACTCCTCCTG3′
Gli1
Forward
5′TCGACCTGCAAACCGTAATCC3′
Backward
5′TCCTAAAGAAGGGCTCATGGTA3′
Gas1
Forward
5′GGAACACTG ACCCACACTCT3′
Backward
5′AAAGACCCCCACCGTTCAG3′
Ccl5
Forward
5′TGCCCACGTCAAGGAGTATTT3′
Backward
5′TTCTCTGGGTTGGCACACACT3′
Cebpα
Forward
5′GAACAGCAACGAGTACCGGGT3′
Backward
5′CCATGGCCTTGACCAAGGAG3′
Fas1
Forward
5′GCTGCGGAAACTTCAGGAAAT3′
Backward
5′AGAGACGTGTCACTCCTGGACTT3′
Pparα
Forward
5′AGGGTTGAGCTCAGTCAGGA3′
Backward
5′GGTCACCTACGAGTGGCATT3′
Pparγ
Forward
5′TTCAGAAGTGCCTTGCTGTG3′
Backward
5′GCTGGTCGATATCACTGGAGA3′
Scd1
Forward
5′CCGGGCCCCTTAGATCGA3′
Backward
5′TAGCCTGTAAAAGATTTCTGCA3′
Acc
Forward
5′CGCGGAGGAGTTCCTAATTC3′
Backward
5′TGTCCCAGACGTAAGCCTTC3′
aP2
Forward
5′AAGGTGAAGAGCATCATAACCCT3′
Backward
5′TCACGCCTTTCATAACACATTCC3′
TNFα
Forward
5′AGCCCCCAGTCTGTATCCTT3′
Backward
5′CTCCCTTTGCAGAACTCAGG3′
β-Actin
Forward
5′GTCCCTGACCCTCCCAAAAG3′
Backward
5′GCTGCCTCAACACCTCAACCC3′
Ucp1
Forward
5′TGCCCACGTCAAGGAGTATTT3′
Backward
5′TTCTCTGGGTTGGCACACT
Ucp2
Forward
5′ACTGTCGAAGCCTACAAGAC3′
Backward
5′CACCAGCTCAGTACAGTTGA3′
Ucp3
Forward
5′GCCTGTGGAAAGGGACTTGG3′
Backward
5′GGAGCGTTCATGTATCGGGT3′
The primer sequences used in this study
Imaging
Microscopy was performed on a Nikon ECLIPSE TE2000-U with NIS-Elements F software (Nikon), Zeiss AxioPlan 2, and Zeiss AxioPlan 2 IE microscopes. Adipocytes were traced and their area measured using ImageJ software.
Statistical Analysis
Values are means ± SEM or SD as noted. Statistical significance was calculated by paired or unpaired two-tailed Student t test; differences were considered significant at P < 0.05.
Results
Age-Related Overweight in Mice Lacking BOC
Body weights of Boc and Bocmice fed normal chow were measured on a monthly basis from 4 to 32 weeks of age. Bocmice were significantly heavier than Bocmice by 16 weeks of age and weighed 16% more than control animals at 32 weeks of age (Fig. 1). Therefore, BOC-deficientmice displayed age-dependent overweight. To determine whether this phenotype was due to increased adiposity, the weight of WAT and other tissues from 32-week-old Boc and Bocmice was analyzed. Bocmice had significantly more subcutaneous WAT than Bocmice; mutants also had somewhat more epididymal (visceral) WAT, although this was not statistically significant (Fig. 1). Weights of other tissues, including liver, spleen, kidney, heart, lungs, and diaphragm, were not different from those of Bocmice (Fig. 1). Bocmice exhibited a greater amount of brown adipose tissue (BAT) (Fig. 1), which had a pale appearance with areas of obvious whitening (Fig. 1) and enlarged lipid droplets (Fig. 1). The mean area of WAT adipocytes was similar between Boc and Bocmice; the mutants had more adipocytes of the largest size, but this difference was not statistically significant (Fig. 1). Finally, Boc and Boc animals consumed similar amounts of food per day (Fig. 1). These data suggest that BOC-deficientmice became overweight from a modest but progressive increase in adiposity.
Figure 1
Age-related overweight in Boc mice. A: Time course of body weight in Boc (+/+) and Boc (−/−) mice. Values are means ± SEM; n = 31–42 for Boc mice and n = 25–43 for Boc mice at various time points. *P < 0.01. B and C: Weights of individual organs or tissues dissected from +/+ and −/− mice. Diaph., diaphragm; Ep., epididymal WAT; Kid., kidney; Liv., liver; Sc., subcutaneous WAT; Spl., spleen. Values are means ± SD; n = 12–14 for each tissue. *P < 0.05. D: Dissected BAT from Boc and Boc mice. Note that the Boc BAT is paler than that of the control and has areas of obvious whitening (arrows). E: H-E–stained sections of BAT from Boc and Boc mice. Bar, 50 μm. F: H-E–stained sections of WAT from Boc and Boc mice. Bar, 50 μm. G: Average area of adipocytes from sections of adult WAT from +/+ and −/− mice. Values are means ± SD; n = 3. H: Distribution of adipocyte areas from sections of adult WAT from +/+ and −/− mice. Values are means ± SD; n = 3. I: Food intake by 24-week-old +/+ and −/− mice. BW, body weight. Values are means ± SD; n = 7.
Age-related overweight in Bocmice. A: Time course of body weight in Boc (+/+) and Boc (−/−) mice. Values are means ± SEM; n = 31–42 for Bocmice and n = 25–43 for Bocmice at various time points. *P < 0.01. B and C: Weights of individual organs or tissues dissected from +/+ and −/− mice. Diaph., diaphragm; Ep., epididymal WAT; Kid., kidney; Liv., liver; Sc., subcutaneous WAT; Spl., spleen. Values are means ± SD; n = 12–14 for each tissue. *P < 0.05. D: Dissected BAT from Boc and Bocmice. Note that the Boc BAT is paler than that of the control and has areas of obvious whitening (arrows). E: H-E–stained sections of BAT from Boc and Bocmice. Bar, 50 μm. F: H-E–stained sections of WAT from Boc and Bocmice. Bar, 50 μm. G: Average area of adipocytes from sections of adult WAT from +/+ and −/− mice. Values are means ± SD; n = 3. H: Distribution of adipocyte areas from sections of adult WAT from +/+ and −/− mice. Values are means ± SD; n = 3. I: Food intake by 24-week-old +/+ and −/− mice. BW, body weight. Values are means ± SD; n = 7.Since Bocmice were not hyperphagic, we assessed whether decreased energy expenditure contributed to their increased adiposity. Normal chow-fed 5-month-old Boc and Bocmice (Fig. 2) were used to assess whole-body metabolic rate. Bocmice exhibited slightly lower body temperature than Bocmice (Fig. 2). Spontaneous locomotive activity in Bocmice averaged about half that in control mice but this difference was not statistically significant, and there was no difference in rearing activity (Fig. 2). Bocmice exhibited slightly decreased oxygen consumption and carbon dioxide production during the light phase (Fig. 2). Respiratory quotient was slightly lower in Bocmice in both dark and light phases but was within normal range (Fig. ). Energy expenditure by Bocmice was also slightly decreased during the light phase (Fig. 2), but total energy expenditure (dark plus light) was not different. These results suggest Bocmice have alterations of whole-body metabolism that may contribute to their overweight.Alterations in whole-body metabolism of Bocmice. A: Body weights. B: Body temperature. C: Rearing activity. D: Locomotion. E: O2 consumption (VO2). F: CO2 production (VCO2). G: Respiratory quotient (RQ). H: Energy expenditure (EE). Normal chow-fed, 5-month-old Boc and Bocmice were measured with metabolic cages (n = 6). Data in A–H represent means ± SEM. ***P < 0.001; *P < 0.05.
Exacerbated Response to HFD by BOC-Deficient Mice
As BOC deficiency predisposed mice to greater adiposity, we challenged 6-week-old mice with HFD for a total of 8 weeks. Beginning at the third week, Bocmice gained more body weight than Bocmice under both diets, but the difference between mutant and control mice was greater on HFD than normal chow (Fig. 3). To determine whether enhanced weight gain in Bocmice was accompanied by abnormal glucose homeostasis, we measured steady-state blood glucose levels and performed tolerance tests for glucose and insulin after 7 weeks of HFD. Prior to challenge, blood glucose levels were similar between control and mutant mice (Fig. 3). Under glucose challenge, a spike in blood glucose levels was observed at 15 min, followed by a slower further increase and progressive return to near baseline in both Boc and Bocmice. However, Bocmice had higher blood glucose levels at the 15- and 30-min time points than Bocmice (Fig. 3). In the ITT, prior to insulin injection, Bocmice had slightly, but not statistically significantly, lower blood insulin levels than Bocmice (Fig. 3). Serum glucose levels decreased sharply 15–45 min after insulin injection in both Boc and Bocmice, but Bocmice displayed significantly less sensitivity to insulin (Fig. 3). Therefore, Bocmice on HFD had perturbations in glucose homeostasis. Furthermore, when on HFD, mutant animals also showed elevated plasma levels of triglycerides and nonesterified fatty acids as compared with Bocmice (Fig. 3).
Figure 3
Exacerbated responses to HFD by Boc mice. Time course of body weight in Boc and Boc mice on normal chow (NC) (A) and HFD (B). Values are means ± SEM; n = 5–7 for each time point. *P < 0.05; **P < 0.005; ***P < 0.001. C: Blood glucose levels in Boc and Boc mice on HFD for 8 weeks and then fasted for 16 h. D: GTT in Boc and Boc mice on HFD for 8 weeks and then fasted for 16 h. Mice were administered glucose intraperitoneally, and blood glucose levels were measured every 15 min for 2 h. Values are means ± SEM; n = 5–7. ***P < 0.01; *P < 0.5. E: ITT in Boc and Boc mice on HFD for 8 weeks and then fasted for 6 h. Mice were administered insulin intraperitoneally, and blood glucose levels were measured every 15 min for 2 h. Values are means ± SEM; n = 5–7. ***P < 0.001; **P < 0.005; *P < 0.05. F: Plasma insulin levels in Boc and Boc mice on HFD for 8 weeks. G: Serum triglyceride (TG) levels in Boc and Boc mice on HFD for 8 weeks. *P < 0.05. H: Blood nonesterified fatty acid (NEFA) levels in Boc and Boc mice on HFD for 8 weeks. **P < 0.005.
Exacerbated responses to HFD by Bocmice. Time course of body weight in Boc and Bocmice on normal chow (NC) (A) and HFD (B). Values are means ± SEM; n = 5–7 for each time point. *P < 0.05; **P < 0.005; ***P < 0.001. C: Blood glucose levels in Boc and Bocmice on HFD for 8 weeks and then fasted for 16 h. D: GTT in Boc and Bocmice on HFD for 8 weeks and then fasted for 16 h. Mice were administered glucose intraperitoneally, and blood glucose levels were measured every 15 min for 2 h. Values are means ± SEM; n = 5–7. ***P < 0.01; *P < 0.5. E: ITT in Boc and Bocmice on HFD for 8 weeks and then fasted for 6 h. Mice were administered insulin intraperitoneally, and blood glucose levels were measured every 15 min for 2 h. Values are means ± SEM; n = 5–7. ***P < 0.001; **P < 0.005; *P < 0.05. F: Plasma insulin levels in Boc and Bocmice on HFD for 8 weeks. G: Serum triglyceride (TG) levels in Boc and Bocmice on HFD for 8 weeks. *P < 0.05. H: Blood nonesterified fatty acid (NEFA) levels in Boc and Bocmice on HFD for 8 weeks. **P < 0.005.We next assessed livers and WAT of Boc and Bocmice after 8 weeks of HFD. Boc livers displayed more and larger lipid droplets than Boc livers upon Oil Red O staining (Fig. 4). Hepatic lipid accumulation is often associated with enhanced expression of genes involved in lipid metabolism (e.g., Acc, Fas, Scd1, and aP2) and that promote adipogenesis (e.g., Pgc1α, Cebpα, Srebp1c, and Pparγ) (6). We therefore assessed by qRT-PCR and Western blot analyses the expression of these genes in livers of Boc and Bocmice on HFD. Expression of all these genes was enhanced in Boc livers relative to controls (Fig. 4). H-E staining of WAT revealed that adipocytes from Bocmice on HFD were larger than those of Bocmice on this diet (Fig. 4). We then assessed the expression of lipid metabolism, adipogenic, and adipokine-encoding genes (Ccl5 and TNFα) in WAT from Boc and Bocmice on HFD. Expression of all these genes was significantly higher in Boc WAT than Boc WAT (Fig. 4). Finally, expression of uncoupling protein (Ucp) 1, 2, and 3 genes was assessed by qRT-PCR in BAT. Ucp1 and Ucp3 expression was significantly reduced in Boc BAT (Fig. 4). Taken together, it is concluded that Bocmice showed an exaggerated response when challenged with HFD.
Figure 4
Exacerbated liver and WAT phenotypes in Boc mice on HFD. A: Oil Red O–stained liver sections and H-E–stained WAT sections from Boc and Boc mice on HFD. Bar, 50 μm. B: Average area of adipocytes from sections of adult WAT from Boc and Boc mice. Values are means ± SD; n = 3. *P < 0.05. C: qRT-PCR analysis of expression of lipid metabolism genes in livers of Boc and Boc mice on HFD. Values are means of relative expression levels ± SD; n = 3. ***P < 0.001; **P < 0.005. D: qRT-PCR analysis of expression of adipogenic genes in livers of Boc and Boc mice on HFD. Values are means of relative expression levels ± SD; n = 3. ***P < 0.001; **P < 0.005; *P < 0.05. E: Western blot analysis of expression of lipid metabolism and adipogenic gene in livers of Boc and Boc mice on HFD. F: qRT-PCR analysis of expression of adipogenic, lipid metabolism, and adipokine genes in WAT of Boc and Boc mice on HFD. Values are means of relative expression levels ± SD; n = 3. ***P < 0.001; **P < 0.005; *P < 0.05. G: Western blot analysis of expression of lipid metabolism and adipogenic genes in WAT of Boc and Boc mice on HFD. H: qRT-PCR analysis of expression of uncoupling proteins in BAT of Boc and Boc mice on HFD. Values are means of relative expression levels ± SD; n = 3. *P < 0.05.
Exacerbated liver and WAT phenotypes in Bocmice on HFD. A: Oil Red O–stained liver sections and H-E–stained WAT sections from Boc and Bocmice on HFD. Bar, 50 μm. B: Average area of adipocytes from sections of adult WAT from Boc and Bocmice. Values are means ± SD; n = 3. *P < 0.05. C: qRT-PCR analysis of expression of lipid metabolism genes in livers of Boc and Bocmice on HFD. Values are means of relative expression levels ± SD; n = 3. ***P < 0.001; **P < 0.005. D: qRT-PCR analysis of expression of adipogenic genes in livers of Boc and Bocmice on HFD. Values are means of relative expression levels ± SD; n = 3. ***P < 0.001; **P < 0.005; *P < 0.05. E: Western blot analysis of expression of lipid metabolism and adipogenic gene in livers of Boc and Bocmice on HFD. F: qRT-PCR analysis of expression of adipogenic, lipid metabolism, and adipokine genes in WAT of Boc and Bocmice on HFD. Values are means of relative expression levels ± SD; n = 3. ***P < 0.001; **P < 0.005; *P < 0.05. G: Western blot analysis of expression of lipid metabolism and adipogenic genes in WAT of Boc and Bocmice on HFD. H: qRT-PCR analysis of expression of uncoupling proteins in BAT of Boc and Bocmice on HFD. Values are means of relative expression levels ± SD; n = 3. *P < 0.05.
Enhanced Adipogenesis in Boc MEFs
To gain information on potential sites of action relevant to the phenotypes of overweight and HFD response, Boc expression was examined in adult tissues by qRT-PCR. Highest levels of Boc expression were seen in brain, lung, and WAT; expression in liver was barely detectable (Fig. 5). The mutant Boc allele contains a PLAP reporter gene, which faithfully reflects endogenous Boc expression (19,36). The PLAP reporter was expressed at high levels in WAT from Bocmice (Fig. 5). To investigate which cell types in WAT express Boc, mature adipocytes were separated from the SVF, which contains blood vessels and preadipocytes (7,8). The SVF was plated to separate nonadherent blood vessels from preadipocytes, which attached to the dish. PLAP activity was seen in floating adipocytes and strongly in mural-like cells that lined vessels and that resemble adipocyte precursors in their location, appearance, and frequency (8). Upon brief culture of the adherent SVF fraction, small PLAP-positive colonies formed with a frequency and morphology similar to that of previously described adipocyte progenitors (Fig. 5). Consistent with this, Boc was expressed in total WAT and the SVF but much less in mature adipocytes (Fig. 5). As expected, Pparγ expression was detected at the highest levels in WAT and adipocytes, whereas the SVF expressed lower levels (Fig. 5). These data suggest that Boc is expressed in adipocyte progenitors.
Figure 5
Analysis of Boc expression. A: qRT-PCR analysis of Boc expression in various adult tissues. Values are means of relative expression levels ± SD; n = 3. L32 expression is set as 1. B: Alkaline phosphatase staining of WAT from Boc and Boc mice (note the Boc allele drives expression of a PLAP reporter gene, designated here Boc; see text) (a). Alkaline phosphatase staining of isolated WAT adipocytes from Boc mice (b). Alkaline phosphatase staining of isolated vessels from the SVF from WAT of Boc mice, and stromal cells are marked by arrows (c). Alkaline phosphatase staining of adherent cells from the SVF from WAT of Boc mice (d). DAPI staining of the same culture shown in d (e). C: Semiquantitative RT-PCR analysis of Boc and Pparγ expression in WAT, SVF, and adipocytes (Adip.). Gapdh served as a loading control.
Analysis of Boc expression. A: qRT-PCR analysis of Boc expression in various adult tissues. Values are means of relative expression levels ± SD; n = 3. L32 expression is set as 1. B: Alkaline phosphatase staining of WAT from Boc and Bocmice (note the Boc allele drives expression of a PLAP reporter gene, designated here Boc; see text) (a). Alkaline phosphatase staining of isolated WAT adipocytes from Bocmice (b). Alkaline phosphatase staining of isolated vessels from the SVF from WAT of Bocmice, and stromal cells are marked by arrows (c). Alkaline phosphatase staining of adherent cells from the SVF from WAT of Bocmice (d). DAPI staining of the same culture shown in d (e). C: Semiquantitative RT-PCR analysis of Boc and Pparγ expression in WAT, SVF, and adipocytes (Adip.). Gapdh served as a loading control.BOC expression was next analyzed by Western blotting during differentiation of 3T3-L1 preadipocytes. BOC levels were relatively low during growth conditions and strongly induced when cells reached confluence, just prior to switching cultures to adipogenic induction medium (Fig. 6). BOC levels were partially diminished when the cells were induced to differentiate, prior even to expression of the adipogenic regulators PPARγ and C/EBPα, but were restored to their peak during the later stages of differentiation (Fig. 6). GAS1, another SHH coreceptor, was expressed with a pattern similar to that of BOC, although the effect of cell confluence was not observed (Fig. 6). In contrast to BOC and GAS1, the BOC paralog CDO was barely detected in 3T3-L1 cells. CDO was expressed robustly by C2C12 myoblasts, whereas BOC levels were low in this cell line, relative to 3T3-L1 cells (Fig. 6).
Figure 6
Boc MEFs show enhanced adipogenesis. A: Western blot analysis of various proteins during a time course of adipogenic differentiation of 3T3-L1 cells. Lysates of 3T3-L1 cell cultures in growth medium (G) at 60 and 100% confluence (Cnfl.) or for the indicated number of days in differentiation medium (DM) were blotted with the indicated antibodies. β-Actin served as a loading control. B: Enhanced adipogenesis of Boc MEFs relative to Boc MEFs. Cultures were stained with Oil Red O after 15 days in differentiation medium. C: Quantification of Oil Red O staining by spectrophotometry at a wavelength of 520 nm relative to control sample. Values are means ± SD; n = 3. *P < 0.05. D: Semiquantitative RT-PCR analysis of expression of various genes induced during a time course of adipogenesis by Boc and Boc MEFs. L32 served as a loading control. E: Western blot analysis of various adipogenic proteins in Boc and Boc MEFs at D3 and D6.
Boc MEFs show enhanced adipogenesis. A: Western blot analysis of various proteins during a time course of adipogenic differentiation of 3T3-L1 cells. Lysates of 3T3-L1 cell cultures in growth medium (G) at 60 and 100% confluence (Cnfl.) or for the indicated number of days in differentiation medium (DM) were blotted with the indicated antibodies. β-Actin served as a loading control. B: Enhanced adipogenesis of Boc MEFs relative to Boc MEFs. Cultures were stained with Oil Red O after 15 days in differentiation medium. C: Quantification of Oil Red O staining by spectrophotometry at a wavelength of 520 nm relative to control sample. Values are means ± SD; n = 3. *P < 0.05. D: Semiquantitative RT-PCR analysis of expression of various genes induced during a time course of adipogenesis by Boc and Boc MEFs. L32 served as a loading control. E: Western blot analysis of various adipogenic proteins in Boc and Boc MEFs at D3 and D6.To investigate BOC’s role in adipogenesis, we isolated MEFs from E13.5 Boc and Boc embryos and cultured them in adipogenic induction medium for 15 days (D15). Boc MEFs had more Oil Red O–positive colonies at D15 than did Boc MEFs (Fig. 6). The timing of induction of lipogenic genes was similar between Boc and Boc MEFs, but expression of each was higher in the Boc MEFs, as analyzed by semiquantitative RT-PCR (Fig. 6). Additionally, levels of aP2, FAS, and C/EBPα proteins were elevated in Boc MEFs at D3 and D6, relative to control MEFs (Fig. 6). Therefore, similar to results in Bocmice, Boc deficiency resulted in enhanced adipogenesis of MEFs in vitro.SHH signaling suppresses adipogenesis, and BOC promotes SHH signaling as a coreceptor (16,18,20). The effects of BOC deficiency on adipogenesis may therefore be related to effects on SHH signaling. We initially addressed this question by analyzing adult Boc and Boc WAT for mRNA levels of various SHH signaling components by qRT-PCR. We examined expression of Cdo, Gas1, Ptch1, and Gli1; these genes not only encode components of the SHH pathway but their expression is also regulated by SHH pathway activity (Ptch1 and Gli1 expression is induced; expression of Cdo and Gas1 is repressed, at least in early mouse embryos [11,18]). Expression of Cdo, Gas1, and Ptch1 was significantly lower in Boc WAT, compared with the Boc WAT, whereas Gli1 expression was similar (Fig. 7). These results do not immediately suggest a major alteration of SHH signaling in Boc WAT, but it may be simplistic to assume that expression of these genes is only regulated by SHH activity in a complex tissue that is also perturbed by loss of BOC.
Figure 7
HH target gene expression is reduced in Boc MEFs, and exogenous stimulation of HH pathway activity represses their adipogenic differentiation. A: qRT-PCR analysis of HH pathway component genes in WAT from Boc and Boc mice. Values are means of relative expression levels ± SD; n = 3. **P < 0.005; *P < 0.05. B: Semiquantitative RT-PCR analysis of HH pathway component genes during a time course of adipogenesis by Boc (+/+) and Boc (−/−) MEFs. L32 served as a loading control. C: Western blot analysis of expression of HH pathway components in Boc and Boc MEFs at D3 and D6. D: The SMO agonist purmorphamine (Pur) inhibited adipogenic differentiation of both Boc and Boc MEFs. Cultures were stained with Oil Red O after 15 days in differentiation medium. E: Quantification of Oil Red O staining by spectrophotometry at a wavelength of 520 nm relative to the control sample. Values are means ± SD; n = 3. **P < 0.005; ***P < 0.001. F: qRT-PCR analysis of expression of aP2, Fas, and Scd1 in cultures of +/+ and −/− MEFs cultured in differentiation medium for 6 days plus or minus Pur. Values are means of relative expression levels ± SD; n = 3. ***P < 0.001; **P < 0.005; *P < 0.05. G: Western blot analysis of adipogenic proteins in cultures of +/+ and −/− MEFs cultured in differentiation medium for 3 or 6 days plus or minus Pur. H: SHH inhibited adipogenic differentiation of both Boc and Boc MEFs. Cultures were stained with Oil Red O after 15 days in differentiation medium. I: Quantification of Oil Red O staining by spectrophotometry at a wavelength of 520 nm relative to the control sample. Values are means ± SD; n = 3. **P < 0.005; *P < 0.05. J: qRT-PCR analysis of expression of aP2, Fas, and Scd1 in cultures of +/+ and −/− MEFs cultured in differentiation medium for 6 days plus or minus SHH. Values are means of relative expression levels ± SD; n = 3. ***P < 0.001; **P < 0.005; *P < 0.05.
HH target gene expression is reduced in Boc MEFs, and exogenous stimulation of HH pathway activity represses their adipogenic differentiation. A: qRT-PCR analysis of HH pathway component genes in WAT from Boc and Bocmice. Values are means of relative expression levels ± SD; n = 3. **P < 0.005; *P < 0.05. B: Semiquantitative RT-PCR analysis of HH pathway component genes during a time course of adipogenesis by Boc (+/+) and Boc (−/−) MEFs. L32 served as a loading control. C: Western blot analysis of expression of HH pathway components in Boc and Boc MEFs at D3 and D6. D: The SMO agonist purmorphamine (Pur) inhibited adipogenic differentiation of both Boc and Boc MEFs. Cultures were stained with Oil Red O after 15 days in differentiation medium. E: Quantification of Oil Red O staining by spectrophotometry at a wavelength of 520 nm relative to the control sample. Values are means ± SD; n = 3. **P < 0.005; ***P < 0.001. F: qRT-PCR analysis of expression of aP2, Fas, and Scd1 in cultures of +/+ and −/− MEFs cultured in differentiation medium for 6 days plus or minus Pur. Values are means of relative expression levels ± SD; n = 3. ***P < 0.001; **P < 0.005; *P < 0.05. G: Western blot analysis of adipogenic proteins in cultures of +/+ and −/− MEFs cultured in differentiation medium for 3 or 6 days plus or minus Pur. H: SHH inhibited adipogenic differentiation of both Boc and Boc MEFs. Cultures were stained with Oil Red O after 15 days in differentiation medium. I: Quantification of Oil Red O staining by spectrophotometry at a wavelength of 520 nm relative to the control sample. Values are means ± SD; n = 3. **P < 0.005; *P < 0.05. J: qRT-PCR analysis of expression of aP2, Fas, and Scd1 in cultures of +/+ and −/− MEFs cultured in differentiation medium for 6 days plus or minus SHH. Values are means of relative expression levels ± SD; n = 3. ***P < 0.001; **P < 0.005; *P < 0.05.To address this question further, expression of these genes in Boc and Boc MEFs during adipogenic differentiation was analyzed by semiquantitative RT-PCR. Expression of Gli1, Ptch1, and Boc was enhanced at day 2 of adipogenic differentiation in Boc cells (Fig. 7). Induction of Gli1 and Ptch1 was diminished in Boc MEFs and remained lower than in control cells throughout the differentiation time course (Fig. 7). Western blot analyses revealed a similar pattern for GLI1 and PTCH1 protein levels (Fig. 7). As Gli1 and Ptch1 are both direct SHH pathway target genes, these data suggest that BOC deficiency impairs SHH signaling activation during adipogenesis. Interestingly, Cdo was not expressed in Boc cells but was abnormally induced in Boc MEFs at D6 (Fig. 7); however, CDO protein levels were too low for detection by Western blot (not shown). Gas1 expression was not altered through the adipogenic differentiation time course and was similar in Boc and Boc MEFs (Fig. 7).BOC’s major function in SHH signaling is as a coreceptor with PTCH1 (16). It would therefore be predicted that Boc MEFs would remain sensitive to inhibition of adipogenic differentiation by activation of the SHH pathway at a point downstream of ligand reception. To test this notion, Boc and Boc MEFs were induced to differentiate in the presence of the SMO agonist purmorphamine, followed by Oil Red O staining at D12. Purmorphamine treatment resulted in strong reduction of adipocyte differentiation in both Boc and Boc MEFs (Fig. 7). Expression of aP2, Fas, and Scd1 was also analyzed in purmorphamine-treated Boc and Boc MEFs at D6 by qRT-PCR. In agreement with the Oil Red O staining results in Fig. 7, aP2, Fas, and Scd1 expression was higher in vehicle-treated Boc MEFs than vehicle-treated Boc MEFs but was decreased by purmorphamine treatment in both Boc and Boc MEFs (Fig. 7). Western blot analyses revealed a similar pattern of aP2, FAS, and C/EBPα protein levels (Fig. 7). These data indicate that activation of HH signaling downstream of BOC coreceptor function is still sufficient to inhibit adipogenesis. BOC plays redundant roles with CDO and GAS1 as SHH coreceptors (13,16,19). Our findings here suggest that BOC plays a partially rate-limiting role in SHH signaling during adipogenic differentiation of MEFs. To assess whether Boc MEFs were still responsive to the SHH ligand itself, Boc and Boc MEFs were induced to differentiate into adipocytes in the presence of exogenous, recombinant SHH for 12 days and analyzed by Oil Red O staining and qRT-PCR for adipogenic markers. Adipogenic differentiation of both Boc and Boc MEFs was inhibited to a similar degree (Fig. 7). These results suggest that although loss of BOC may diminish endogenous SHH signaling during adipogenesis, expression of other coreceptors is likely sufficient to override the lack of BOC in Boc MEFs and confer responsiveness to exogenous SHH.
Discussion
Genetic factors that contribute to obesity-related WAT accumulation are poorly understood. The HH pathway plays a conserved role in adipogenesis, inhibiting fat formation (29–32). Mice with elevated HH signaling globally due to a hypomorphic Ptch1 mutation, or in the adipocyte lineage via conditional targeted mutagenesis of Sufu, have sharply diminished WAT (33,34). Although these studies indicate that a genetic gain of function in HH pathway activity blocks adipogenesis, the converse has not been shown, i.e., that reduced HH pathway function results in WAT accumulation.We report that mice lacking the HH coreceptor BOC displayed age-related overweight, with an increase in WAT, but not in the weight of internal organs. Furthermore, they had an exacerbated response to HFD, including enhanced weight gain and adipocyte hypertrophy, livers with greater fat accumulation, and elevated expression of genes related to adipogenesis, lipid metabolism, and adipokine production. Boc MEFs showed enhanced adipogenesis and had reduced expression of the direct HH pathway target genes, Gli1 and Ptch1, during adipogenic differentiation. Therefore, loss of BOC, and an associated decrease in HH signaling, in WAT precursor cells may underlie the age-related overweight and enhanced response to HFD seen in Bocmice. Consistent with this possibility, Boc is prominently expressed in WAT, particularly in cells of the SVF that may function as adipocyte precursors. However, adipogenesis per se is not thought to be the prime driver of obesity (4,5), so it is not clear that moderate loss of HH function would be sufficient to override regulatory mechanisms of energy balance to drive enhanced adiposity. In fact, a role for loss of BOC outside the adipose lineage may be a major contributor to the enhanced adiposity of Bocmice, as these animals had alterations in some metabolic parameters, including decreased body temperature and locomotive activity. Boc is expressed in the developing and adult central nervous system, albeit at low levels in the hypothalamus, a key structure for energy balance regulation (36). Construction of a Boc conditional mutant mouse line will be required to address this point. It is worth noting that the global Ptch1 and adipose-specific Sufu mutants did not display substantial alterations in metabolic parameters or in the GTT (33,34); however, these animals had reduced WAT, rather than overweight or obesity.The effects of Boc mutation are relatively modest. Bocmice became overweight by 4 months of age but were not obese. They showed elevated levels of serum triglycerides and nonesterified fatty acids, and defects in GTT and ITT, when on the HFD, but their fasted blood glucose and insulin levels were similar to those of control mice. This may reflect redundancy of BOC with GAS1 and CDO, additional HH coreceptors. These coreceptors have overlapping functions and are collectively required for HH signaling in the mouse embryo (13,16,19). Gas1 was expressed in 3T3-L1 cells and MEFs, whereas Cdo was expressed at low levels in these cells. Furthermore, Cdo mutant mice do not have an overweight phenotype (unpublished data). GAS1 may therefore function in the absence of BOC to provide a level of HH coreceptor activity that limits the effects of loss of BOC to overweight rather than full-blown obesity. As expected, activation of the HH pathway downstream of BOC with the SMO agonist purmorphamine inhibited adipogenesis of both Boc and Boc MEFs. However, adipogenesis of both cell types was also inhibited by recombinant SHH. We hypothesize that the presence of GAS1, and perhaps CDO, was sufficient to allow a strong response to exogenous SHH, but that loss of BOC was enough to cause a diminished response to endogenously produced HH ligand. It seems likely, therefore, that genetic removal of Gas1, and perhaps Cdo, from Bocmice would result in further loss of HH coreceptor activity and worsen the overweight phenotype; this is what is seen in neural tube patterning (13). Testing this notion will also require a conditional mutagenesis approach, as double mutants for any of these three factors have severe phenotypes and are not viable (13,19).Genetic variants in the HH pathway may play a role in WAT accumulation in humanobesity. Loss-of-function mutations in human genes encoding several HH pathway components, including CDO and GAS1, are associated with holoprosencephaly, a common and often devastating developmental defect of the forebrain (15,37,38). Mice with mutations in these genes are good models for holoprosencephaly (39). However, Bocmice do not have holoprosencephaly and are viable (19). Therefore, it is possible that “weak” BOC alleles may exist in the human population and contribute to WAT accumulation in individuals with additional genetic or lifestyle-based predisposition to obesity. It is interesting that the effects of Boc mutation were seen with age and diet, two variables involved with weight gain. Genome-wide association studies have not linked BOC to obesity, although that is not surprising given that Bocmice are overweight, not obese. Many variant BOC alleles have been documented in the 1000 Genomes data, including many with likely deleterious changes. Some of these could act as modifier genes in individuals with obesity or metabolic disorders. In summary, the HH pathway is a conserved inhibitor of fat formation, and we report for the first time a loss-of-function mutation in the HH pathway associated with WAT accumulation and overweight.
Authors: Myong-Ho Jeong; Hyun-Ji Kim; Jung-Hoon Pyun; Kyu-Sil Choi; Dong I Lee; Soroosh Solhjoo; Brian O'Rourke; Gordon F Tomaselli; Dong Seop Jeong; Hana Cho; Jong-Sun Kang Journal: Proc Natl Acad Sci U S A Date: 2017-02-02 Impact factor: 11.205
Authors: Maria J Guillen-Sacoto; Ariel F Martinez; Yu Abe; Paul Kruszka; Karin Weiss; Joshua L Everson; Ramon Bataller; David E Kleiner; Jerrold M Ward; Kathleen K Sulik; Robert J Lipinski; Benjamin D Solomon; Maximilian Muenke Journal: J Hepatol Date: 2017-06-21 Impact factor: 25.083