| Literature DB >> 25557809 |
Kyu-Sang Lim1, Jun-Mo Kim2, Eun-A Lee1, Jee-Hwan Choe1, Ki-Chang Hong1.
Abstract
Fatness qualities in pigs measured by the amount of fat deposition and composition of fatty acids (FAs) in pork have considerable effect on current breeding goals. The stearoyl-CoA desaturase (SCD) gene plays a crucial role in the conversion of saturated FAs into monounsaturated FAs (MUFAs), and hence, is among the candidate genes responsible for pig fatness traits. Here, we identified a single nucleotide polymorphism (SNP, c.*2041T>C) in the 3' untranslated region by direct sequencing focused on coding and regulatory regions of porcine SCD. According to the association analysis using a hundred of Berkshire pigs, the SNP was significantly associated with FA composition (MUFAs and polyunsaturated FAs [PUFAs]), polyunsaturated to saturated (P:S) FA ratio, n-6:n-3 FA ratio, and extent of fat deposition such as intramuscular fat and marbling (p<0.05). In addition, the SNP showed a significant effect on the SCD mRNA expression levels (p = 0.041). Based on our results, we suggest that the SCD c.*2041T>C SNP plays a role in the gene regulation and affects the fatness qualities in Berkshire pigs.Entities:
Keywords: Berkshire; Fatness Quality; Gene Expression; Polymorphism; Stearoyl-CoA Desaturase [SCD]
Year: 2015 PMID: 25557809 PMCID: PMC4283158 DOI: 10.5713/ajas.14.0529
Source DB: PubMed Journal: Asian-Australas J Anim Sci ISSN: 1011-2367 Impact factor: 2.509
Standard pig diet composition
| Constituent | % |
|---|---|
| Barley | 24.6 |
| Wheat | 24.3 |
| Soybean meal (48% crude protein) | 23.0 |
| Yellow maize | 15.0 |
| Wheat bran | 5.0 |
| Sugarcane molasses | 3.0 |
| Vegetable oil | 0.8 |
| Animal fat | 1.3 |
| Calcium carbonate | 1.2 |
| Dicalcium phosphate | 0.6 |
| Phosphorus | 0.5 |
| Salt | 0.5 |
| L-lysine | 0.1 |
| DL-methionine | 0.02 |
| L-theromine | 0.03 |
| Acid | 0.10 |
| Phytase | 0.20 |
Proximate analysis and fatty acid composition of the standard diet
| Constituent | |
|---|---|
| Proximate analysis | |
| Digestible energy (MJ/kg) | 13.7 |
| Dry matter (g/kg) | 872.0 |
| Crude protein (g/kg) | 177.0 |
| Fat (g/kg) | 42.0 |
| Linoleic acid (g/kg) | 16.0 |
| Fatty acid (% of total) | |
| C14:0 | 0.5 |
| C14:1 | 0.1 |
| C16:0 | 24.1 |
| C16:1 (n-7) | 0.4 |
| C18:0 | 3.7 |
| C18:1 (n-9) | 26.3 |
| C18:2 (n-6) | 41.2 |
| C18:3 (n-3) | 3.8 |
Sequences of primers used for polymerase chain reaction amplification and quantitative polymerase chain reaction
| Primer pair | Primer sequence (5′ to 3′) | Target | Annealing temperature (°C) | Product size (bp) |
|---|---|---|---|---|
| P1 | ACTTCCCTAGTGCCCATCCT | Promoter | 61 | 699 |
| AGACCGCACTGAGCGTAGA | ||||
| P2 | GTGTCTGCAGCATCCAGTTT | Exon 1 | 61 | 782 |
| GATGGAAGAGACGCAAGTCC | ||||
| P3 | AATTTCTCCGCACAGTTCCT | Exon 2 | 61 | 669 |
| CAGAATCGACACTCCTGCAT | ||||
| P4 | CTGCCCTTGTTTATGGGTCT | Exon 3 | 61 | 798 |
| TAATGAAGGGACCACAACGA | ||||
| P5 | CATATAACCCGCAAGAAGCA | Exon 4 | 61 | 758 |
| ATCCCCAACAGGCTATGAAC | ||||
| P6 | ACCTTGTGCTCACAGCGTAG | Exon 5 | 61 | 608 |
| GAAAAAGGACAAGCCAAAGC | ||||
| P7 | TCAGTCCTCTTCCCACAGAG | Exon 6 | 61 | 639 |
| CAAAGCCAAGAGAAGGACAA | ||||
| P8 | AGGGCTTCCACAACTACCAC | Exon 6 | 61 | 747 |
| TCCCTCCCCTGACAAGTTAC | 3′-UTR | |||
| P9 | AGCCCAGACTTTTGCTCAAT | Exon 6 | 61 | 747 |
| ACCCCCATTCTTCCTCTTCT | 3′-UTR | |||
| P10 | GGAACTGAGGTGTGTTGGTG | Exon 6 | 61 | 604 |
| TCACTGCCTTTGCATACTCC | 3′-UTR | |||
| P11 | TTTTTCCTGCCGGTTCTATC | Exon 6 | 61 | 703 |
| TTGTTTTCCAGCCCTCTTCT | 3′-UTR | |||
| P12 | TGGAGCTAGGGTGTACCACA | Exon 6 | 61 | 793 |
| CTCGGACGTAACACCGATTA | 3′-UTR | |||
| P13 | AACAGGCCTTGCTTTGTAGG | Exon 6 | 61 | 734 |
| ATCCAGGACACAGGGTTCAT | 3′-UTR | |||
| P14 | ATTTTGGGATCCTTCAGCAG | Exon 6 | 61 | 798 |
| GGGGCTACATTTCAGAGGAA | 3′-UTR | |||
| P15 | AGCTTCCTCTCCCACAGTCA | *2041T>C | 61 | 425 |
| GTCTTGGCCTCTTGTGCTTC | (PCR-RFLP) | |||
| P16 | TACACTTGGGAGCCCTGTAT | |||
| CCACAGCACTCAGCAGATAG | (Quantitative PCR) | |||
| P17 | ACTCACTCTTCTACCTTTGATGCT | |||
| TGTTGCTGTAGCCAAATTCA | (Quantitative PCR) |
UTR, untranslated region; PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism; SCD, stearoyl-CoA desaturase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Figure 1Genotypes of the c.*2041T>C SNP in the 3′ UTR of the SCD gene. (a) Sequence chromatograms showing c.*2041T>C SNP. (b) The electrophoresis image of PCR-RFLP for c.*2041T>C SNP. Digestion of PCR products (425 bp) by MspI, show genotypes TT, TC, and CC. The arrowheads show and the size of DNA ladder and fragments. SNP, single nucleotide polymorphism; UTR, untranslated region; SCD, stearoyl-CoA desaturase; PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism.
Genotype and gene frequencies of the c.*2041T>C single nucleotide polymorphism in the 3′ untranslated region of the stearoyl-CoA desaturase gene in Berkshire pigs
| N | Genotype | Gene | ||||
|---|---|---|---|---|---|---|
|
|
| |||||
| CC | CT | TT | C | T | ||
| 100 | 0.41 (41) | 0.44 (44) | 0.15 (15) | 0.63 | 0.37 | 0.574 |
N, number of experimental pigs; HWE, Hardy-Weinberg equilibrium.
x (HWE), Hardy-Weinberg equilibrium by the x-test, df = 1, x = 3.841. Its p-value was above 0.05.
Numbers in bracket indicate the numbers of experimental animals.
The least squares analysis of different genotypes of c.*2041T>C SNP in the 3′ untranslated region of the stearoyl-CoA desaturase gene with fatness quality traits in Berkshire pigs
| Trait | Genotypes | p-value | ||
|---|---|---|---|---|
|
| ||||
| CC (n = 41) | CT (n = 44) | TT (n = 15) | ||
| Fatty acid composition | ||||
| C12:0 | 0.13a ±0.01 | 0.11b ±0.01 | 0.12ab ±0.01 | 0.033 |
| C14:0 | 1.88 ±0.08 | 1.72 ±0.09 | 1.65 ±0.14 | 0.251 |
| C16:0 | 23.25a ±0.16 | 22.54b ±0.16 | 22.49b ±0.27 | 0.003 |
| C18:0 | 10.79 ±0.25 | 11.24 ±0.25 | 10.65 ±0.42 | 0.301 |
| C16:1 | 5.06 ±0.12 | 4.73 ±0.12 | 4.71 ±0.20 | 0.089 |
| C18:1 n-9 | 42.45a ±0.36 | 41.98ab ±0.37 | 40.65b ±0.61 | 0.039 |
| C18:2 n-6 | 11.89b ±0.40 | 12.64b ±0.41 | 14.20a ±0.67 | 0.012 |
| C20:4 n-6 | 2.21b ±0.14 | 2.53b ±0.14 | 3.08a ±0.23 | 0.005 |
| C18:3 n-3 | 0.36 ±0.01 | 0.36 ±0.01 | 0.37 ±0.02 | 0.773 |
| C20:5 n-3 | 0.21b ±0.01 | 0.24ab ±0.01 | 0.28a ±0.02 | 0.027 |
| C20:6 n-3 | 0.10 ±0.01 | 0.10 ±0.01 | 0.10 ±0.01 | 0.938 |
| SFA | 36.27 ±0.29 | 35.85 ±0.30 | 35.14 ±0.49 | 0.118 |
| MUFA | 48.34a ±0.38 | 47.58ab ±0.39 | 46.12b ±0.63 | 0.011 |
| PUFA | 15.40b ±0.55 | 16.56b ±0.56 | 18.74a ±0.92 | 0.007 |
| P:S ratio | 0.43b ±0.02 | 0.46ab ±0.02 | 0.53a ±0.03 | 0.018 |
| n-6/n-3 ratio | 16.44b ±0.36 | 16.28b ±0.37 | 17.99a ±0.61 | 0.048 |
| Fat deposition | ||||
| Marbling score | 2.36a ±0.10 | 2.16ab ±0.10 | 1.90b ±0.16 | 0.045 |
| Intramuscular fat (%) | 3.41a ±0.20 | 2.90ab ±0.21 | 2.24b ±0.33 | 0.008 |
| Backfat thickness (mm) | 23.92 ±0.81 | 22.93 ±0.61 | 25.53 ±0.98 | 0.071 |
SNP, single nucleotide polymorphism; SFA, saturated fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; P:S ratio, the ratio of PUFA to SFA; n-6/n-3 ratio, the ratio of n-6 to n-3.
Significant differences between genotypes are indicated using different superscript letters (p<0.05).
Fatty acid (FA) values are % of total FA.
Values are expressed as least squares means±standard error.
Figure 2Relative mRNA levels of porcine SCD in the longissimus dorsi muscle of Berkshire pigs according to genotypes of c.*2041T>C SNP. The SCD mRNA levels were normalised to those of GAPDH. All values are expressed as mean ±standard error of three independent experiments. A and B indicate significantly different groups, as determined by ANOVA (p = 0.041). SCD, stearoyl-CoA desaturase; SNP, single nucleotide polymorphism; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ANOVA, analysis of variance.