Literature DB >> 25549355

miR-150-5p inhibits hepatoma cell migration and invasion by targeting MMP14.

Tao Li1, Junjie Xie1, Chuan Shen1, Dongfeng Cheng1, Yuan Shi1, Zhichong Wu1, Qian Zhan1, Xiaxing Deng1, Hao Chen1, Baiyong Shen1, Chenghong Peng1, Hongwei Li1, Zhecheng Zhu1.   

Abstract

Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related mortality worldwide. Despite progress in diagnostics and treatment of HCC, its prognosis remains poor because the molecular mechanisms underlying hepatocarcinogenesis are not well understood. In the study, we focused on identifying the role of miRNAs in HCC progression. miRNA microarray was used to analyze the differentially expressed miRNAs, and the results were validated by qPCR. We found that the miR-150-5p expression is down-regulated in HCC tissues compared with pair non-tumor tissues. miR-150-5p expression is also decreased in metastatic cancer tissues compared with pair primary tissues, indicating that miR-150-5p may be involved in HCC metastasis. Functionally, miR-150-5p inhibition significantly promotes hepatoma cell migration and invasion, whereas miR-150-5p overexpression suppresses cancer cell migration and invasion in vitro. The matrix metalloproteinase 14 (MMP14) is identified as a new target gene of miR-150-5p. miR-150-5p markedly inhibits MMP14 expression in hepatoma cells, and miR-150-5p expression is negative correlation with MMP14 expression in vivo. More important, re-expression of MMP14 in hepatoma cells partially reverses the effect of miR-150-5p in inhibiting cell invasion.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25549355      PMCID: PMC4280173          DOI: 10.1371/journal.pone.0115577

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Hepatocellular carcinoma (HCC) is the fifth most common malignancy worldwide and the incidence is increasing in the East Asia and in developed countries [1], [2]. Despite various therapeutic strategies for HCC that have improved in the last decades, such as surgical resection, radiofrequency and chemotherapy, HCC remains a highly fatal tumor because of a high rate of tumor recurrence and distant metastasis after surgery [3]. However, the molecular mechanisms underlying these processes are not well understood. MicroRNAs (miRNAs) are a recently discovered class of small noncoding RNAs that regulate gene expression at the post-transcription level. miRNAs have been highly conserved among phylogenetically close species during evolution and have emerged recently as potent regulators of cell growth, cell differentiation and carcinogenesis [4], [5], [6]. Wang et al. showed that miR-195 expression is frequently down-regulated in HCC. miR-195 down-regulation in HCC is significantly correlated with increased angiogenesis, metastasis, and worse recurrence-free survival [7]. They further demonstrated that miR-195 markedly decreases hepatoma cell migration and invasion by directly inhibiting the expression of the pro-angiogenic factor vascular endothelial growth factor (VEGF) and the pro-metastatic factors VAV2 and CDC42 [7]. Overexpression of these targets antagonizes the effect of miR-195 in regulating cell invasion. Yang et al. identified miR-140-5p as an HCC-related miRNA [8]. The expression of miR-140-5p is significantly down-regulated in HCC tissues and its expression levels are associated with multiple nodules, vein invasion, capsular formation, and differentiation, as well as overall and disease-free survival of HCC [8]. Several other miRNAs were also identified to be associated with hepatocarcinogenesis and disease progression such as miR-214, miR-182, miR-29b, miR-7, etc. [9], [10], [11], [12]. Recent studies showed that miR-150 is abnormally expressed in different type of cancer. Ma et al. found that miR-150 expression is down-regulated in colorectal cancer compared with paired non-cancerous tissue [13]. Low expression of miR-150 predicts a shorter survival and a worse response to adjuvant chemotherapy in colorectal cancer [13]. miR-150 suppresses colorectal cancer cell migration and invasion through directly targeting MUC4 [14]. The expression of miR-150 is also lower in esophageal squamous cell carcinoma (ESCC) compared with normal esophageal mucosa [15]. Low miR-150 expression in ESCC contributes to malignant potential, such as lymph node metastasis, venous invasion and poor prognosis [15]. miR-150 suppresses cancer cell invasion by targeting ZEB1 in ESCC or epithelial ovarian cancer [15], [16]. Inversely, other studies showed that miR-150 is up-regulated and functions as pro-metastatic gene. Cao et al. showed that miR-150 is significantly up-regulated in lung cancer and its overexpression promotes the proliferation and migration of lung cancer cells by targeting SRC kinase signalling inhibitor 1 [17]. However, the role of miR-150-5p in regulating HCC progression remains unknown. Based on these findings, we investigated whether miR-150-5p involves in HCC progression. We found that decreased expression of miR-150-5p relieves repression of MMP14, which results in an increase of cell migration and invasion.

Materials and Methods

2.1 Clinical specimens and cell lines

Tumor tissues were obtained with written informed consent from the Ruijin Hospital affiliated to Shanghai Jiaotong University. The study was approved by the Ethics Committee of Shanghai Jiaotong University. Patients with HCC (n = 53) were enrolled in our study (Table 1), and cancer tissues and pair non-tumor tissues were collected. Hepatoma cells (Huh7 and HepG2) were purchased from the American Type Culture Collection (ATCC, Manassas, VA), and cultured in DMEM (Gibco, Carlsbad, CA,) with 10% fetal bovine serum (Gibco).
Table 1

The characteristics of patients with HCC.

Gender53
Male (%)35 (66%)
Female (%)18 (34%)
Age62 (43–79)
Serum AFP
≤2017
>2036
Tumor size
≤530
>523
TNM stage
I/II39
III14

Cell invasion assay of Huh7 cells (A) or HepG2 cells (B) after miR-150-5p overexpression or miR-150-5p plus MMP14 overexpression. Data are shown as the mean ± SD based on at least three independent experiments (C). *p<0.05.

Cell invasion assay of Huh7 cells (A) or HepG2 cells (B) after miR-150-5p overexpression or miR-150-5p plus MMP14 overexpression. Data are shown as the mean ± SD based on at least three independent experiments (C). *p<0.05.

2.2 Quantitative real-time PCR (qPCR)

Total RNA was extracted from tissues or cell lines using Trizol reagent (Invitrogen, Carlsbad, CA), and reverse transcription (RT) reactions were performed using miR-150-5p-special prime. The specific stem–loop RT primers for miR-150-5p were designed as previously described [18]. RT reactions for mRNA were carried out using the Oligo dT primer. qPCR was performed using a standard protocol from the SYBR Green PCR kit (Toyobo, Osaka, Japan) on Applied Biosystems 7300 real-time PCR system (Applied Biosystems, Foster City, CA). U6 and β-actin were used as references for miRNAs and mRNAs, respectively.

2.3 miR-150-5p transfection

Human miR-150-5p (UCUCCCAACCCUUGUACCAGUG) or 2′-O-methyl modified miR-150 inhibitor (CACUGGUACAAGGGUUGGGAGA) were transfected to hepatoma cells by using Lipofectamine 2000 (Invitrogen) according to the manufacturer.

2.4 Western blot analysis

Western blot analysis to assess MMP14 and β-actin expression was performed as previously described [19]. MMP14 and β-actin primary antibodies were purchased from Abcam and Sigma, respectively.

2.5 Wound filling assay

HCC cells (1–2×106 cells/well) were treated with indicated reagents, and wounds were made using a 1000 µl plastic pipette tip. The size of wound was measured after 48 h of wound formation and photographed.

2.6 Transwell invasion assay

Cell invasion assay was carried out using Transwell chambers with inserts of 8-µm pore size (Corning Costar) as described previously [20]. Briefly, hepatoma cell (Huh7 or HepG2) suspended in serum free medium was seeded onto Matrigel-coated Transwell filters in Biocoat Matrigel invasion chambers. The complete medium (DMEM with 10% FBS) was used as a chemoattractant in the lower chamber. The hepatoma cells were treated with indicated reagents for 72 h, and cells on the lower surface of the membrane were stained with Crystal violet. The cell numbers were determined by counting of the penetrating cells under a microscope at 200× magnification in random fields in each well.

2.7 Luciferase reporter assay

pGL3 plasmid encoding a luciferase reporter gene was purchased from Promega (Madison, WI). Recombinant plasmid of pGL3-MMP14-3′-UTR (wildtype) or pGL3-MMP14-3′-UTR-Mutation was constructed in our laboratory. HepG2 cells (1–2×105 cells/well) were plated in a 24-well plate and cotransfected with 40nM of either miR-150 or miRNA control, 20 ng of either pGL3-MMP14-3′-UTR or pGL3-MMP14-3′-UTR-Mutation, and 2 ng of pRL-TK (Promega, Madison, WI) by using Lipofectamine 2000. The pRL-TK vector was used as an internal control to correct the differences in both transfection and harvest efficiencies. HepG2 cells were collected 48 h after transfection and analyzed using the Dual-Luciferase Reporter Assay System (Promega).

2.8 In vivo experiments

The athymic BALB/C mice (4–6 weeks old) were purchased from the Chinese Academy of Sciences (Shanghai, China), and were bred in a specific pathogen-free facility. The protocol was approved by the Animal Ethics Committee of Shanghai Jiaotong University. All surgery was performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering. Huh7 cells overexpressed with miR-150-5p were subcutaneously injected into the flanks of nude mice, and Huh7 cells were used as mock control. After 6 weeks, the mice were killed and lung metastases were monitored after inducing deep anesthesia.

2.9 Statistical analysis

Data are expressed as mean ± standard deviation (SD) from at least three separate experiments. The differences between groups were analyzed using Student’s t test. Differences were deemed statistically significant at p<0.05.

Results

3.1 The expression levels of miR-150-5p are down-regulated in HCC

To study the roles of miRNAs in disease progression of HCC, we searched GEO database and a miRNA microarray datasets (GSE54751) was obtained to analyze differentially expressed miRNAs between HCC tissues and pair non-tumor tissues. miRNA microarray data revealed that miR-150-5p expression is lower in HCC tissues compared with adjacent normal tissues (S1 Fig.). To confirm the results of the miRNA microarray analysis, qRT-PCR analysis of 53 surgical HCC specimens was carried out. As shown in Fig. 1A, miR-150-5p is expressed at high levels in pair non-tumor tissues, whereas miR-150-5p level is markedly down-regulated in most HCC tissues. We further assayed miR-150-5p expression in 23 metastatic and pair primary HCC tissues. Fig. 1B shows a significantly lower miR-150-5p expression in metastases than primary HCC, indicating that miR-150-5p down-regulation is associated with HCC metastasis.
Figure 1

miR-150-5p expression is down-regulated in HCC tissues.

(A) Quantitative RT-PCR analysis of miR-150-5p expression level in 53 HCC tissues and pair non-tumor tissues. The results were expressed as Log2 (2–ΔΔCt). (B) Quantitative RT-PCR analysis of miR-150-5p expression level in 23 metastatic and pair primary HCC tissues.

miR-150-5p expression is down-regulated in HCC tissues.

(A) Quantitative RT-PCR analysis of miR-150-5p expression level in 53 HCC tissues and pair non-tumor tissues. The results were expressed as Log2 (2–ΔΔCt). (B) Quantitative RT-PCR analysis of miR-150-5p expression level in 23 metastatic and pair primary HCC tissues.

3.2 Knockdown of miR-150-5p promotes hepatoma cell migration and invasion

The frequent down-regulation of miR-150-5p in HCC tissues implies that miR-150-5p may play important roles in HCC progression. The biological consequences of miR-150-5p knockdown in regulating cancer cell migration and invasion were then examined using cell biology assays. miR-150-5p expression is significantly decreased in Huh7 or HepG2 cells after treatment with miR-150-5p inhibitor (Fig. 2A), and miR-150-5p inhibition promotes Huh7 and HepG2 cell migration (Fig. 2B, C). Furthermore, hepatoma cell invasion was analyzed after miR-150-5p inhibition. As shown in Fig. 2D and E, knockdown of miR-150-5p in hepatoma cells significantly increases cell invasion compared with control. The effect of miR-150-5p inhibition on pulmonary metastasis was further assayed in the nude mice. At the experimental endpoint, lungs were ablated and the overt surface metastases were observed. Fig. 2F showed that miR-150-5p inhibition markedly increases the number of visible lung metastases compared with control group. These data suggest that miR-150-5p down-regulation contributes to hepatoma cell migration and invasion.
Figure 2

miR-150-5p knockdown promotes hepatoma cell migration and invasion.

(A) Quantitative RT-PCR analysis of miR-150-5p expression after miR-150-5p inhibitor treatment in Huh7 and SMMC 7721 cells. * p<0.05. (B and C) Cell migration assay of Huh7 cells (B) or HepG2 cell (C) after miR-150-5p knockdown for 48 h. (D and E) Cell invasion assay of Huh7 cells after miR-150-5p knockdown. Data are shown as the mean ± SD based on at least three independent experiments. *p<0.05. (F) Incidence and number of visible metastases per lung in each cohort following subcutaneous inoculation. *p<0.05.

miR-150-5p knockdown promotes hepatoma cell migration and invasion.

(A) Quantitative RT-PCR analysis of miR-150-5p expression after miR-150-5p inhibitor treatment in Huh7 and SMMC 7721 cells. * p<0.05. (B and C) Cell migration assay of Huh7 cells (B) or HepG2 cell (C) after miR-150-5p knockdown for 48 h. (D and E) Cell invasion assay of Huh7 cells after miR-150-5p knockdown. Data are shown as the mean ± SD based on at least three independent experiments. *p<0.05. (F) Incidence and number of visible metastases per lung in each cohort following subcutaneous inoculation. *p<0.05.

3.3 miR-150-5p directly targets matrix metalloproteinase 14 (MMP14) and inhibits its expression

Previous studies have shown that miR-150-5p suppresses several genes expression by targeting its 3′-UTR, such as SRC kinase signalling inhibitor 1, CCR6 and ZEB1 [16], [17], [21]. To identify new potential target genes of miR-150-5p, we searched for candidate genes using TargetScan6.2 and miRBase micoRNA databases. Bioinformatics analysis showed that miR-150-5p directly targets MMP14 gene, an important regulator involving in tumor progression (Fig. 3A). MMP14 plays an important role in tumor invasion by degrading extracellular matrix (ECM) and increasing the secretion of proMMP2 and proMMP9 [22]. We therefore constructed luciferase reporter vector containing 3′-UTR of MMP14. The reporter assay showed that miR-150-5p is able to markedly inhibit luciferase expression, whereas mutation of 4 nucleotides in 3′-UTR of MMP14 results in complete abrogation the suppressive effect (Fig. 3B). Forced expression of miR-150-5p significantly inhibits the MMP14 protein level (Fig. 3C, D), whereas miR-150-5p inhibition results in an increase of MMP14 protein level in Huh7 and HepG2 cells (Fig. 3E) A significant negative correlation was also observed between miR-150-5p and MMP14 expression in vivo (r 2 = 0.15389 p = 0.0019, Fig. 3F). These data demonstrated that miR-150-5p suppresses endogenous MMP14 expression in hepatoma cell.
Figure 3

miR-150-5p directly targets MMP14.

(A) Schematic representation of the miR-150-5p site in MMP14 3′-UTR. (B) The 3′UTR reporter assay was carried out in HepG2 cells overexpressed with miR-150-5p. pGL3-MMP14-3′-UTR-WT or pGL3-MMP14-3′-UTR-Mutation was co-transfected with pRL-TK. Luciferase assays were performed 48 h after transfection. Firefly luciferase activity was standardized to Renilla luciferase control. *p<0.05. (C and D) Western blot analysis for endogenous MMP14 protein level after miR-150-5p overexpression in hepatoma cells. (E) Western blot analysis for endogenous MMP14 protein level after miR-150-5p inhibition in hepatoma cells. miR-150-5p-inh, miR-150-5p inhibitor. (F) A significant negative correlation between miR-150-5p and MMP14 expression in vivo (r 2 = 0.15389 p = 0.0019).

miR-150-5p directly targets MMP14.

(A) Schematic representation of the miR-150-5p site in MMP14 3′-UTR. (B) The 3′UTR reporter assay was carried out in HepG2 cells overexpressed with miR-150-5p. pGL3-MMP14-3′-UTR-WT or pGL3-MMP14-3′-UTR-Mutation was co-transfected with pRL-TK. Luciferase assays were performed 48 h after transfection. Firefly luciferase activity was standardized to Renilla luciferase control. *p<0.05. (C and D) Western blot analysis for endogenous MMP14 protein level after miR-150-5p overexpression in hepatoma cells. (E) Western blot analysis for endogenous MMP14 protein level after miR-150-5p inhibition in hepatoma cells. miR-150-5p-inh, miR-150-5p inhibitor. (F) A significant negative correlation between miR-150-5p and MMP14 expression in vivo (r 2 = 0.15389 p = 0.0019).

3.4 miR-150-5p inhibits hepatoma cell invasion by targeting MMP14

miR-150-5p inhibits endogenous MMP14 expression, and MMP14 regulates tumor invasion by degrading ECM and increasing the expression of MMP2 and MMP9. Therefore, we then investigated whether miR-150-5p controls cancer cell invasion by targeting MMP14. As shown in Fig. 4A and C, miR-150-5p inhibits Huh7 cell invasion, whereas re-expression of MMP14 in Huh7 cells partially reverses the effect of miR-150-5p in inhibiting cell invasion. Similarly, miR-150-5p suppresses HepG2 cell invasion by regulating MMP14 expression (Fig. 4B, C). These results confirmed that miR-150-5p inhibits hepatoma cell invasion and cancer metastasis, at least in part, by inhibiting MMP14 expression.
Figure 4

miR-150-5p inhibits hepatoma cell invasion by targeting MMP14.

Discussion

miRNAs are class of small noncoding RNAs of 19–24 nucleotides in length, which negatively regulate protein-coding genes expression at the post-transcriptional level [23]. miRNAs have recently emerged as potent regulators of cell development, differentiation and proliferation. Recently, the role of miRNAs in tumorigenesis has been widely investigated and their important regulatory function in several biological processes associated with tumor has been described [24]. In the present study, we showed that miR-150-5p expression is significantly down-regulated in most HCC specimens compared with adjacent normal tissue. We also examined miR-150-5p expression in metastatic and pair primary HCC tissues and found that miR-150-5p expression is decreased in metastases compared to primary HCC, which indicate that miR-150-5p down-regulation is associated with HCC metastasis. The biological function of miR-150-5p in regulating cancer cell invasion was then examined. miR-150-5p knockdown increases Huh7 and HepG2 cell migration and invasion, whereas miR-150-5p overexpression suppresses hepatoma cell invasion. These data suggest that miR-150-5p down-regulation contributes to hepatoma cell migration and invasion. Matrix metalloproteinases (MMPs) are zinc-dependent endopeptidases that degrade extracellular macromolecules (e.g., collagens, fibronectin, laminins, and proteoglycans) and are known to play important roles in angiogenesis, cancer cell invasion, and cancer metastasis [22], [25]. There are two types of MMPs, membrane-anchored MMPs (MMP14, MMP15, MMP16, etc.) and secreted-type MMPs (MMP2, MMP9, MMP7, MMP26, etc.) [22]. MMP14 plays an important role in cancer metastasis by degrading the ECM and increasing the secretion of proMMP2 and proMMP9 [26]. Taras et al. showed that pravastatin inhibits lung metastasis of rat hepatocellular carcinoma by decreasing the expression of MMP14 [27]. Miyoshi et al. demonstrated that transcription factor Snail promotes cancer cell invasion by up-regulating the expression of MMP14, MMP1 and MMP2 [28]. Moreover, MMP14 expression is significantly associated with portal vein invasion and intrahepatic metastasis in HCC [29]. Here we identified that MMP14 is a novel target gene of miR-150-5p. Bioinformatics analysis showed that miR-150-5p targets 3′UTR of MMP14. The reporter assay showed that miR-150-5p markedly suppresses luciferase expression, whereas mutation of 4 nucleotides in 3′-UTR of MMP14 results in complete abrogation the suppressive effect. Overexpression of miR-150-5p decreases the MMP14 protein level in Huh7 and HepG2 cells. In vivo, a significant negative correlation is also observed between miR-150-5p and MMP14 expression. Functionally, miR-150-5p inhibits hepatoma cell invasion, whereas re-expression of MMP14 partially reverses the effect of miR-150-5p in inhibiting cell invasion.

Conclusions

miR-150-5p is an important mediator of HCC metastasis, thus offering a new target for the development of therapeutic agents against HCC. miR-150-5p expression is down-regulated in HCC tissues. miR-150-5p expression analysis showed in miRNA microarray datasets (GSE54751). (TIF) Click here for additional data file.
  29 in total

1.  Global cancer statistics.

Authors:  D M Parkin; P Pisani; J Ferlay
Journal:  CA Cancer J Clin       Date:  1999 Jan-Feb       Impact factor: 508.702

Review 2.  MicroRNAs: genomics, biogenesis, mechanism, and function.

Authors:  David P Bartel
Journal:  Cell       Date:  2004-01-23       Impact factor: 41.582

3.  MiR-150-5p suppresses colorectal cancer cell migration and invasion through targeting MUC4.

Authors:  Wei-Hua Wang; Jie Chen; Feng Zhao; Bu-Rong Zhang; Hong-Sheng Yu; Hai-Ying Jin; Jin-Hua Dai
Journal:  Asian Pac J Cancer Prev       Date:  2014

4.  Membrane type 1 matrix metalloproteinase (MT1-MMP/MMP-14) cleaves and releases a 22-kDa extracellular matrix metalloproteinase inducer (EMMPRIN) fragment from tumor cells.

Authors:  Nagayasu Egawa; Naohiko Koshikawa; Taizo Tomari; Kazuki Nabeshima; Toshiaki Isobe; Motoharu Seiki
Journal:  J Biol Chem       Date:  2006-10-18       Impact factor: 5.157

5.  MicroRNA-150 inhibits tumor invasion and metastasis by targeting the chemokine receptor CCR6, in advanced cutaneous T-cell lymphoma.

Authors:  Mitsugu Ito; Kazuaki Teshima; Sho Ikeda; Akihiro Kitadate; Atsushi Watanabe; Miho Nara; Junsuke Yamashita; Koichi Ohshima; Kenichi Sawada; Hiroyuki Tagawa
Journal:  Blood       Date:  2014-01-02       Impact factor: 22.113

6.  Rising incidence of hepatocellular carcinoma in the United States.

Authors:  H B El-Serag; A C Mason
Journal:  N Engl J Med       Date:  1999-03-11       Impact factor: 91.245

Review 7.  MicroRNAs in liver cancer: a model for investigating pathogenesis and novel therapeutic approaches.

Authors:  E Callegari; L Gramantieri; M Domenicali; L D'Abundo; S Sabbioni; M Negrini
Journal:  Cell Death Differ       Date:  2014-09-05       Impact factor: 15.828

8.  Snail accelerates cancer invasion by upregulating MMP expression and is associated with poor prognosis of hepatocellular carcinoma.

Authors:  A Miyoshi; Y Kitajima; S Kido; T Shimonishi; S Matsuyama; K Kitahara; K Miyazaki
Journal:  Br J Cancer       Date:  2005-01-31       Impact factor: 7.640

9.  Snail and SIP1 increase cancer invasion by upregulating MMP family in hepatocellular carcinoma cells.

Authors:  A Miyoshi; Y Kitajima; K Sumi; K Sato; A Hagiwara; Y Koga; K Miyazaki
Journal:  Br J Cancer       Date:  2004-03-22       Impact factor: 7.640

10.  MicroRNA-150 predicts a favorable prognosis in patients with epithelial ovarian cancer, and inhibits cell invasion and metastasis by suppressing transcriptional repressor ZEB1.

Authors:  Minfei Jin; Zujing Yang; Weiping Ye; Hongling Xu; Xiaolin Hua
Journal:  PLoS One       Date:  2014-08-04       Impact factor: 3.240

View more
  27 in total

1.  Identification of genetic variation in the lncRNA HOTAIR associated with HPV16-related cervical cancer pathogenesis.

Authors:  Sweta Sharma Saha; Rahul Roy Chowdhury; Nidhu Ranjan Mondal; Biman Chakravarty; Tanmay Chatterjee; Sudipta Roy; Sharmila Sengupta
Journal:  Cell Oncol (Dordr)       Date:  2016-09-28       Impact factor: 6.730

Review 2.  The roles of microRNAs related with progression and metastasis in human cancers.

Authors:  Hai-Ting Liu; Peng Gao
Journal:  Tumour Biol       Date:  2016-10-06

3.  Extracellular vesicles derived from bone marrow mesenchymal stem cells loaded on magnetic nanoparticles delay the progression of diabetic osteoporosis via delivery of miR-150-5p.

Authors:  Chen Xu; Zhaodong Wang; Yajun Liu; Bangguo Wei; Xiangyu Liu; Keyou Duan; Pinghui Zhou; Zhao Xie; Min Wu; Jianzhong Guan
Journal:  Cell Biol Toxicol       Date:  2022-09-16       Impact factor: 6.819

4.  Ultrasound-targeted microbubble destruction (UTMD)-mediated miR-150-5p attenuates oxygen and glucose deprivation-induced cardiomyocyte injury by inhibiting TTC5 expression.

Authors:  Xin Zhong; Yu Chen; Xiangdang Long; Hongtian Chen; Zhaofen Zheng; Hongwei Pan; Jianqiang Peng; Yanfu Liu; Haijun Wang; Yongjun Hu
Journal:  Mol Biol Rep       Date:  2022-03-31       Impact factor: 2.742

5.  FAM83A-AS1 promotes lung adenocarcinoma cell migration and invasion by targeting miR-150-5p and modifying MMP14.

Authors:  Guodong Xiao; Peili Wang; Xiaoqiang Zheng; Dapeng Liu; Xin Sun
Journal:  Cell Cycle       Date:  2019-09-16       Impact factor: 4.534

Review 6.  MiRNA-based therapeutic intervention of cancer.

Authors:  Srivatsava Naidu; Peter Magee; Michela Garofalo
Journal:  J Hematol Oncol       Date:  2015-06-11       Impact factor: 17.388

7.  Ciliary Neurotrophic Factor Promotes the Migration of Corneal Epithelial Stem/progenitor Cells by Up-regulation of MMPs through the Phosphorylation of Akt.

Authors:  Jialin Chen; Peng Chen; Ludvig J Backman; Qingjun Zhou; Patrik Danielson
Journal:  Sci Rep       Date:  2016-05-13       Impact factor: 4.379

8.  MicroRNA-150 functions as a tumor suppressor in osteosarcoma by targeting IGF2BP1.

Authors:  Yang Qu; Su Pan; Mingyang Kang; Rongpeng Dong; Jianwu Zhao
Journal:  Tumour Biol       Date:  2015-11-11

Review 9.  The Landscape of lncRNAs in Hepatocellular Carcinoma: A Translational Perspective.

Authors:  Juan Pablo Unfried; Paloma Sangro; Laura Prats-Mari; Bruno Sangro; Puri Fortes
Journal:  Cancers (Basel)       Date:  2021-05-28       Impact factor: 6.639

10.  High-Throughput miRNA Sequencing Reveals a Field Effect in Gastric Cancer and Suggests an Epigenetic Network Mechanism.

Authors:  Monica B Assumpção; Fabiano C Moreira; Igor G Hamoy; Leandro Magalhães; Amanda Vidal; Adenilson Pereira; Rommel Burbano; André Khayat; Artur Silva; Sidney Santos; Samia Demachki; Ândrea Ribeiro-Dos-Santos; Paulo Assumpção
Journal:  Bioinform Biol Insights       Date:  2015-07-06
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.