Literature DB >> 25545777

Demineralized bone matrix combined bone marrow mesenchymal stem cells, bone morphogenetic protein-2 and transforming growth factor-β3 gene promoted pig cartilage defect repair.

Xin Wang1, Yanlin Li1, Rui Han2, Chuan He1, Guoliang Wang1, Jianwei Wang1, Jiali Zheng1, Ming Pei3, Mei Pei, Lei Wei4.   

Abstract

OBJECTIVES: To investigate whether a combination of demineralized bone matrix (DBM) and bone marrow mesenchymal stem cells (BMSCs) infected with adenovirus-mediated- bone morphogenetic protein (Ad-BMP-2) and transforming growth factor-β3 (Ad-TGF-β3) promotes the repair of the full-thickness cartilage lesions in pig model.
METHODS: BMSCs isolated from pig were cultured and infected with Ad-BMP-2(B group), Ad-TGF-β3 (T group), Ad-BMP-2 + Ad-TGF-β3(BT group), cells infected with empty Ad served as a negative group(N group), the expression of the BMP-2 and TGF-β3 were confirmed by immunofluorescence, PCR, and ELISA, the expression of SOX-9, type II collagen(COL-2A), aggrecan (ACAN) in each group were evaluated by real-time PCR at 1w, 2w, 3w, respectively. The chondrogenic differentiation of BMSCs was evaluated by type II collagen at 21d with immunohistochemical staining. The third-passage BMSCs infected with Ad-BMP-2 and Ad-TGF-β3 were suspended and cultured with DBM for 6 days to construct a new type of tissue engineering scaffold to repair full-thickness cartilage lesions in the femur condyles of pig knee, the regenerated tissue was evaluated at 1,2 and 3 months after surgery by gross appearance, H&E, safranin O staining and O'driscoll score.
RESULTS: Ad-BMP-2 and Ad-TGF-β3 (BT group) infected cells acquired strong type II collagen staining compared with Ad-BMP-2 (B group) and Ad-TGF-β3 (T group) along. The Ad-BMP-2 and Ad-TGF-β3 infected BMSCs adhered and propagated well in DBM and the new type of tissue engineering scaffold produced hyaline cartilage morphology containing a stronger type II collagen and safranin O staining, the O'driscoll score was higher than other groups.
CONCLUSIONS: The DBM compound with Ad-BMP-2 and Ad-TGF-β3 infected BMSCs scaffold has a good biocompatibility and could well induce cartilage regeneration to repair the defects of joint cartilage. This technology may be efficiently employed for cartilage lesions repair in vivo.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25545777      PMCID: PMC4278773          DOI: 10.1371/journal.pone.0116061

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Injuries to articular cartilage can be difficult to effectively treat since self-repair of the tissue is limited by an inherent low-capacity for natural regeneration [1]–[3]. This difficulty has prompted the development of numerous therapeutics, including autologous cartilage transplantation [4] or treatment typical of abrasions and micro-fractures [5], but neither technique is entirely satisfactory [6], [7]. One novel approach to these deficits is tissue engineering therapy, which hinges enhancing the body's own natural capacity for self-repair by creating an environment for tissue development and regeneration with the appropriate cell populations, necessary cellular signals, and suitable scaffolds [8]. However, for tissues with naturally low-capacities for self repair, such as articular cartilage, suitable treatments require a method of regrowth of tissue. For these cases, Bone Mesenchymal Stem Cells (BMSCs) offer potentially revolutionary a fascinating cell source for regenerative medicine because they can be induced to different cell types under appropriate conditions [9], [10]. Previous studies demonstrated that several different growth factors, such as bone morphogenic proteins (BMPs) and transforming growth factors beta (TGF- beta), are capable of inducing the differentiation of mesenchymal cells into chondrocytes under certain culture conditions [11], [12]. While transforming growth factor beta3 (TGF-β3) is known to promote the chondrogenic differentiation of progenitor cells, bone morphogenetic protein 2 (BMP-2) has also recently emerged as a key regulator of stem cell commitment, playing an essential role in chondrogenic differentiation [13]. However, each acting alone does not seem to suitably enhance tissue growth and differentiation; in a recent study, BMP-2 was found to enhance TGF-β3 mediated chondrogenesis of human bone marrow or adipose tissue-derived mesenchymal stem cells [14], [15]. This result suggests that that a combination of BMP-2 and TGF-β3 may be superior to the standard differentiation method using either TGF-β3 or BMP-2 to promote BMSCs chondrogenesis. Though some of these initial studies on BMSCs chronogenesis aided by either TGF-β3 or BMP-2 have been promising, more wide-spread clinical utility of these approaches is limited by the short half-lives [16] of the proteins as well as prohibitive capital investment requirements [17]. To overcome these obstacles, in the present study we sought to used the adenovirus-mediated bone morphogenetic protein 2 (Ad-BMP-2) and transforming growth factor beta 3 (Ad-TGF-β3) that were constructed to infect BMSCs to construct a new type of tissue engineering scaffold in a Demineralized Bone Matrix(DBM). To assess the ability of these scaffolds, we tested their effectiveness in repairing full-thickness cartilage defects in the femoral condyles of dian-nan small ear pig. Gross observation, H&E and safranin O staining, O'driscoll score were used to assess the defected healing.

Materials and Methods

BMSCs Isolation, Culture, Proliferation, and Identify

BMSCs were isolated from 8-month-old diannan-small-ear pigs (n = 12). All experiments were authorized by the Animal Center for Medical Experimentation at the Kunming Medical University. Marrow aspirates of pigs from the iliac crest, as described by Pittenger et al, were washed in Dulbecco's modified Eagle's medium Ham's F-12(DMEM/F-12) (Gibco BRL, USA) with heparin (approx. 200units/ml final) and centrifuged for 5 min at 900 g. After the supernatant were removed, the washed cells were plated in culture flasks with DMEM/F-12 supplemented by 10% fetal bovine serum contained 100 IU/ml penicillin and 100 mg/ml streptomycin at 37°C with 5% CO2. The medium was replaced every 2 days to remove non-adherent cells and debris. Cells were harvested at 80–90% confluence with 0.25% trypsin, counted, and subcultured at 1∶2 dilutions in culture flasks. Multidirectional differentiation and flow cytometric analysis were used to identify the isolated cells. In brief, isolated cells were differentiated into adipocytes, osteocytes and chondrocytes, respectively [9], [10]. Third passage BMSCs were cultured in adipogenic or osteogenic induction medium. adipogenic medium consisting of basic culture medium supplemented with 10% FBS, 1 µM dexamethasone, 0.5 mM indomethacin, 10 µg/ml insulin and 100 mM 3-isobutyl-1-methylxanthine. Osteogenic medium consisting of basic culture medium supplemented with 100 nM dexamethasone, 10 mM sodium β-glycerophosphate, 0.05 mM ascorbic acid. For chondrocyte differentiation, a pellet culture system was used. BMSCs (passage 3) were trypsinized and seeded at 2×105cells/ml in 15 ml polypropylene tubes, and centrifuged to pellet, cultured at 37°C with 5% CO2 in 500 µl of chondrogenic medium which consisting of basic culture medium supplemented with 10% ITS (6.25 µg/ml insulin, 6.25 µg/ml transferrin, 6.25 µg/mL selenious acid), 1 mM pyruvate, 50 µg/ml ascorbate 2-phosphate, 0.1 µM dexamethasone, and 8 ng/ml TGF-β1. The medium was replaced every 2 days for 21 days, Oil red staining, Alizarin Red Staining and Toluidine blue staining were used to evaluate the adipogenic differentiation, osteogenic differentiation and chondronic differentiation respectively. Antibodies included CD29, CD44, CD45 (BD Biosciences Pharmingen, San Jose, CA) were analyzed in the cells of passage 0, 1, 2 on an FACS Calibur flow cytometer (BD Biosciences).

Preparation of recombinant adenoviral vectors encoding BMP-2 or/and TGF-β3

Ad-BMP-2 and Ad-TGF-β3 respectively containing human BMP-2 and TGF-β3 cDNA were constructed as described previously [18], [19]. In brief, BMP-2 cDNA and TGF-3 cDNA were amplified by PCR and then subcloned into a pEC3.1(+) plasmid (the pEC3.1(+) connected with BMP-2 cDNA was reconstructed to combine with IRES-EGFP)to respectively obtain pEC-GIE 3.1-BMP-2-EGFP and pEC-GIE 3.1-TGF-β3 plasmids. These were subcloned into pGSadeno vector via homologous recombination reaction to obtain both Ad-BMP-2 and Ad-TGF-β3. Ad-BMP-2 was constructed to express human BMP-2 and green fluorescent protein (GFP) tag, while Ad-TGF-β3 was constructed to not express any fluorescent tag. To generate high-titer preparations, the recombinant vectors were amplified in 293 cells and purified over three successive CsCl gradients.

Adenoviral infection and determine the optimal multiplicity of infection in vitro

Third-passage BMSCs were cultured in 6-well plates at a density of 2×105 cells/well. Solutions of Ad- BMP-2 or Ad-TGF-β3 virus particles at an multiplicity of infection(MOI) of 0, 10, 20, 50, 100, 200 were premixed with 2 ml DMEM/F12 containing 2% FBS, and 1% penicillin/streptomycin were added to the cell culture wells. Each day, cell morphology and pathological changes were observed under light microscopy. Transduction efficiency of Ad-BMP-2 was analyzed 48 hours post transduction by determining the population of cells with GFP expression within the total cell population. Since Ad-TGF-β3 had no fluorescent tag expression, its transfection efficiency was analyzed via flow cytometry. The optimal multiplicity of infection were determined by transfection efficiency and cell pathological changes. (Transfection efficiency and cell pathological changes were showed in Table 1). An MOI of 20 (Ad- BMP-2) and MOI of 50 (Ad-TGF-β3) were used for the subsequent experiments.
Table 1

Transduction efficiency and cell pathological changes and optimal multiplicity of infection.

MOI
0102050100200
Transduction efficiency
B group0%62.50%95%100%100%100%
T group0%23.60%68.60%95.10%99.70%100%
BT group0%58.50%95%100%100%100%
pathological changes
B group----+++
T group----+++
BT group----++++

- negative, + positive, ++, seriously.

- negative, + positive, ++, seriously. Third-passage BMSCs were cultured in 6-well plates at a density of 2×105 cells/well. To characterize the effects of the different growth factors, Ad-BMP-2 (n = 6), Ad-TGF-β3 (n = 6), Ad-BMP-2 + Ad-TGF-β3 (n = 6) were then added to each well with 2 ml of DMEM/F12 containing 2% FBS to create the test groups (hereafter B group, T group, and BT group) with cell cultures infected with empty Ad serving as a negative control (n = 6; hereafter N group). The medium was replaced every 2 to 3 days, and the culture supernatant were harvested at various time points were stored at −20°C until further analysis.

Ad-BMP-2 and Ad-TGF-β3 transgene expression in BMSCs

a. Immunofluorescence staining in vitro

The cells of B, T, BT, and N groups were harvested at 72 h and then each washed with PBS and fixed with 4% paraformaldehyde for 10 min, after which the slide was blocked with 1% BSA for 30 min and incubated with primary antibody (mouse anti–human BMP-2, 1∶500; rabbit anti- human TGF-β3 1∶40, Abcam, England) for 120 min at 37°C. After washing with PBS, the slide was incubated with corresponding second antibody (goat anti-mouse IgG; goat anti-rabbit IgG (Thermo Fisher, USA) diluted at a ratio of 1∶200 for 60 min. Cell nuclei were counterstained with DAPI (5 ng/ml) for 5 min. After washing with PBS the slide was analyzed by fluorescence microscopy.

b. ELISA investigations

ELISA assays were performed to investigate the expression of BMP-2 or TGF-β3 in the culture supernatant. For the assay, flat-bottomed 96-well plates wells were treated with 100 µl of cell culture supernatant and BMP-2 or TGF-β3 standards and incubated at room temperature for 2 h. After three rinses with the washing buffer, a biotin-conjugated BMP-2 or TGF-β3 monoclonal antibody was added to each well at a concentration of 1 µg/ml in 100 µl and then incubated at room temperature for 1 h. Following rinsing, avidin horse radish peroxidase (AV-HRP; eBioscience) at a 1∶500 dilution (100 µl/well) was added and the plates were further incubated at room temperature for 30 min. Wells were again rinsed three times with washing buffer and 100 µl of ABTS Substrate Solution (eBioscience) was added to each well and incubated at room temperature for 30 min, and optical densities were measured at 405 nm in a spectrophotometer (Molecular Devices, Sunnydale, CA, USA).

Effects of Ad-BMP-2 or/and Ad-TGF-β3 transgene expression on BMSCs

a. Quantitative RT-PCR Assay

Total ribonucleic acid (RNA) from the samples of BMSCs in the B, T, BT, and N group at 3 d, 7 d, 14 d and 21 d were extracted with RNeasy mini kit (Qiagen, Germany) following the manufacturer's instructions. Complementary DNA was prepared using SuperScript III first-strand synthesis system (Invitrogen, USA) and the specificity of the PCR products was confirmed by agarose gel electrophoresis (PCR primers are listed in Table 2). Expression of SOX9, COL-II and ACAN were analyzed via iQ SYBRR green super mix (BIO-RAD) on MyiQ single color Real Time polymerase chain reaction (RT-PCR) detection system (BIO-RAD). Relative expression levels were calculated as the ratio to the average value of housekeeping genes of β-Actin and relative gene expression was calculated according to the 2−ΔCTΔCT formula.
Table 2

Sequence of primers.

GeneUpstream primer sequence (5′-3′)downstream primer sequence (5′-3′)
BMP-2 ATCCTGAGCGAGTTCGAGTTG ACCTGAAGTTCTGCAGAGGTG
TGF-β3 ACTTGCACCACCTTGGACTTC GGTCATCACCGTTGGCTCA
β-actin GTGCGGGACATCAAGGAGAA ATGTCCACGTCGCACTTCAT
COL-2A GTGCTCCCGGACCTCAAG TCGCCAGATTTTCCAGGCTT
SOX9 GAGCAAGAATAAGCCGCACG TTGCCCAGAGTCTTGCTGAG
aggrecan CCCTCGTGGATACTACATTG TGTCAGGAGACCCAGATGC

b. Immunochemical staining of collagen II

After 21 d, the cells in B, T, BT and N group were washed with PBS and fixed with 4% paraformaldehyde for 10 min, then the slide was blocked with 3% hydrogen peroxide in methanol for 15 min and blocked with 5% BSA in PBS for 30 min. Next, the sections were incubated for 1 h at room temperature with mouse monoclonal anti-collagen type II primary antibodies at a dilution of 1∶100 in 1% BSA. After three PBS washes to remove unbound primary antibody, sections were incubated with Streptavidin peroxidase-conjugated anti-mouse IgG secondary antibody for 1 h at room temperature. Sections were then treated with diaminobenzidine (DAB) for 10 min and observed under a light microscope.

The preparation and characterization of DBM

The DBM scaffold was constructed from the spongy bone of pig, as done previously. In brief, the spongy bones were separated from the scapula and then cut into pieces 7 mm diameter and 3 mm thick (Fig. 1A,B) before being soaked in acetone for 48 h to remove fatty composition. Next, the samples were demineralized 2°C overnight incubation in a solution of 0.6 mol/L hydrochloric acid; followed by washing with ddH2O, and then sterilized by ethylene oxide and stored at 4°C until use. The surface of the DBM was observed by Scanning Electron Microscope (S-3400N, Hitachi, Japan). Diameters of the micropores and porosity of DBM scaffolds was then determined via SEM imaging.
Figure 1

Gross appearance of DBM.

The demineralized bone matrix scaffold looked like white sponge with natural porous structure (A,B).

Gross appearance of DBM.

The demineralized bone matrix scaffold looked like white sponge with natural porous structure (A,B).

DBM combined with double genes transfected BMSCs

Third-passage BMSCs infected with Ad-BMP-2 + Ad-TGF-β3 (MOI = 20,50, respectively) overnight were trypsinized and the density of cells was adjusted to 2×106 cells per milliliter with hyaluronic acid and DMEM/F-12 containing 10% FBS and 1% penicillin/streptomycin(the ratio of hyaluronic acid and DMEM/F-12 was 1∶4). 50 µl of cell suspension were added on every DBM(1×105cells/DBM) which was already prepared (soaked in PBS for 24 h) and then cultured in an atmosphere of 5% CO2 and 95% humidity. Cells were allowed to attach to the scaffolds for 4 h prior to the addition of fresh DMEM/F12 containing 10% FBS and 1% antibiotics solution. The scaffolds were then further incubated at 37°C and 5% CO2 for 6 days. Adhesion properties, morphological characteristics, and cellular distribution within each scaffold was analyzed via SEM (S-3400N, Hitachi, Japan).

Surgery

To test the efficiency of the DBM treated with different growth factors, adult diannan-small-ear pigs (n = 12, 8-month-old, weighing 12 kilograms on average) were given a full-thickness defect and different scaffolds were placed within the defect. In brief, the pigs were anethsitized by an intravenous injection of pentobarbital and the knee joint was exposed via a medial parapatellar incision and the patella was laterally displaced. With the knee maximally flexed, two full-thickness defects (7 mm in diameter and 3-4 mm in depth) were created in the central weight bearing surface of the femur condyle using a dental drill (Fig. 2A). The defects were washed with PBS to reduce bleeding prior to the different tissue scaffolds being inserted into the defects in such a way that the composite surface was flush with the articular surface (Fig. 2B). The patella was then repositioned, and the capsule and skin were closed with a continuous suture. To minimize postoperative infection, antibiotic penicillin was administered daily to each subject for 5 days. To simulate natural activity, the animal subjects were housed in conventional cages that allowed for unrestricted weight-bearing activity, while researchers observed each subject for visible signs of pain, infection, and general activity.
Figure 2

Implantation surgery.

An osteochondral defect (diameter  = 6 mm; depth  = 4 mm) generated in the central weight bearing surface of the femur condyle in knee(A). Prepared tissue-engineered scaffold were inserted into the defect(B).

Implantation surgery.

An osteochondral defect (diameter  = 6 mm; depth  = 4 mm) generated in the central weight bearing surface of the femur condyle in knee(A). Prepared tissue-engineered scaffold were inserted into the defect(B).

Grouping and evaluation methodology

The 12 pigs used in this study (totally 24 knee joints and 48 full-thickness cartilage defects) were randomly divided into 4 groups. The animals' lateral femoral condyle of right knee was repaired with DBM and BMSC infected with both Ad -BMP-2 and Ad-TGF-β3(I group); The medial femoral condyle of right knee was repaired with DBM and BMSCs without Ad-TGF-β3 and Ad-BMP-2(II group); The medial femoral condyle of left knee was repaired with DBM(III group); The medial femoral condyle was not repaired as blank control(IV group). The animals were sacrificed at 2, 4, 8, 12 weeks postoperation (3 animals at each time point). All procedures were approved by the appropriate institutional and governmental review boards. Gross observation, H&E and safranin O staining, O'driscoll score were used to assess the defect healing.

Statistical analysis

All data were analyzed via SPSS 11.5 (SPSS, inc., Chicago, USA). All values were reported as mean ±SD, with statistical significance determined via the Wilcoxon–Mann Whitney test at a confidence interval level of 95% (P<0.05).

Results

Cell culture

BMSCs isolated from pigs were polygon and star shaped at passage 0 (Fig. 3A). After passage 3, a relative homogeneous populations of fibroblast-like cells were observed and displayed with a spindle structure consistent with previous reports [9], [14] (Fig. 3B).
Figure 3

Characteristics of BMSCs.

The trilateral and fibroblast-like cells were observed in primary cells 8 days after culture (A, Inverted phase contrast microscope×100). The primary BMSCs showed whirlpool growth 14 days after cultured (B, Inverted phase contrast microscope ×40).

Characteristics of BMSCs.

The trilateral and fibroblast-like cells were observed in primary cells 8 days after culture (A, Inverted phase contrast microscope×100). The primary BMSCs showed whirlpool growth 14 days after cultured (B, Inverted phase contrast microscope ×40).

Multidirectional differentiation and flow cytometric analysis

There was lipid droplet in the cytoplasm of BMSCs which were positive for oil red O staining (Fig. 4A). Osteogenic differentiation of BMSC was induced via an osteogenic medium for 3 weeks. The induced cells formed Calcium nodules and stained positively with Alizarin red (Fig. 4B). After chondrogenesis induction for 21 d, the BMSCs produced a cartilaginous matrix, which stained positively with Alcian blue (Fig. 4C,D). Flow cytometric analysis demonstrated that the isolated cells expressing the stem cell markers CD29, CD44 and negative for CD45. With the increase of subculture, positive rate of CD29, CD44 increased accordingly. There was no evident difference on CD45 between the P0, P1 and P2 BMSCs(Table 3).
Figure 4

Multidirectional differentiation of BMSCs.

Culture of BMSC under adipogenic conditions induced drastic morphology changes including formation of cell aggregates and accumulation of lipid vacuoles in the cytoplasm which positive for oil red O staining. (A, ×200). BMSCs were induced into osteogenetic cells 14 days after osteogenetic induction. Alizarin red staining showed there was calcium nodules formation (B, ×40). There was pellet formation at the bottom of centrifuge tube after centrifugal. Glycosaminoglycan was detected using alcian blue staining in cartilage pellets at Day 21 of culture(C, white arrow points to the pellet). Presence of glycosaminoglycans was confirmed in histological sections of the pellet by alcian blue staining(D).

Table 3

The flow cytometry results of surface markers from BMSCs in different generation.

generationCD29(+)CD44(+)CD45(−)
P0 73.10%69.74%99.68%
P1 99.44% 99.96 95.81%
P2 99.49% 99.52 99.93%

there were significant difference in the positive rate of CD29 compared with p0 group.

there were significant difference in the positive rate of CD44 compared with p0 group. There was no significant difference of the negative rate of CD45 among p0, p1, p2 groups.

Multidirectional differentiation of BMSCs.

Culture of BMSC under adipogenic conditions induced drastic morphology changes including formation of cell aggregates and accumulation of lipid vacuoles in the cytoplasm which positive for oil red O staining. (A, ×200). BMSCs were induced into osteogenetic cells 14 days after osteogenetic induction. Alizarin red staining showed there was calcium nodules formation (B, ×40). There was pellet formation at the bottom of centrifuge tube after centrifugal. Glycosaminoglycan was detected using alcian blue staining in cartilage pellets at Day 21 of culture(C, white arrow points to the pellet). Presence of glycosaminoglycans was confirmed in histological sections of the pellet by alcian blue staining(D). there were significant difference in the positive rate of CD29 compared with p0 group. there were significant difference in the positive rate of CD44 compared with p0 group. There was no significant difference of the negative rate of CD45 among p0, p1, p2 groups.

Transfection efficiency

There were fluorescence expression in B and BT group 24 h to 48 h post transduction. The fluorescence expression gradually strong with the increase of MOI accordingly(Fig. 5A,B,C,D). Transduction efficiency of Ad-BMP-2 was analyzed 48 h post transduction by determining the population of cells with GFP expression within the total cell population(Fig. 5E,F). Almost all the BMSCs express green fluorescence after transduced with Ad- BMP-2 48 h in MOI = 20(Fig. 5G). Transduction efficiency of Ad-TGF-β3 was conformed by flow cytometry(Fig. 5H). With the increase of MOI, there was cell pathological changes in every group. The optimal multiplicity of infection was conformed to MOI = 20 (B group), 50(T group), 20 and 50 (BT group). The Transfection efficiency in B, T, BT group was 95%,95.1%, 95%, respectively (MOI = 20,50,20 and 50) at 48 h post transduction. There were no obviously cell pathological changes in B, T, BT group with the MOI mentioned above.
Figure 5

Adenoviral infection and the optimal multiplicity of infection.

The fluorescence expression of BMSCs after transduced with Ad- BMP-2 48h in MOI 10, 20, 50, 100 at 48 h(A,B,C,D),the fluorescence expression gradually strong with the increase of MOI. Transduction efficiency of Ad-BMP-2 was analyzed 48 hours post transduction by determining the population of cells with GFP expression within the total cell population(E,F). almost all the BMSCs express green fluorescence after transduced with Ad- BMP-2 48 h in MOI = 20(G). Transduction efficiency of Ad-TGF-β3 was conformed by flow cytometry, the Transduction efficiency was 95.1% 48 h post transduction in MOI = 50(H).

Adenoviral infection and the optimal multiplicity of infection.

The fluorescence expression of BMSCs after transduced with Ad- BMP-2 48h in MOI 10, 20, 50, 100 at 48 h(A,B,C,D),the fluorescence expression gradually strong with the increase of MOI. Transduction efficiency of Ad-BMP-2 was analyzed 48 hours post transduction by determining the population of cells with GFP expression within the total cell population(E,F). almost all the BMSCs express green fluorescence after transduced with Ad- BMP-2 48 h in MOI = 20(G). Transduction efficiency of Ad-TGF-β3 was conformed by flow cytometry, the Transduction efficiency was 95.1% 48 h post transduction in MOI = 50(H).

Gene expression

There was a positive red or green fluorescence staining in the BMSCs infected with Ad-BMP-2 (red; B group) or Ad-TGF-β3 (green; T group) 72 h after transfection (Fig. 6A, B). Both the red and the green fluorescence were detected in the BMSCs infected with Ad-BMP-2 and Ad-TGF-β3 (BT group) (Fig. 6C). No positive red or green fluorescence was detected in the cells infected with empty Ad (N group) (Fig. 6D). PCR results showed that a band of Ad-BMP-2 at 310 bp (B group) and Ad-TGF-β3 at 114 bp (T group). In the BT group, both 310 bp and 114 bp bands were detected, and no band was detected in the control N group (Fig. 6E). ELISA assay showed that the expression of BMP-2 and TGF-β3 increased gradually and then peaked at 7 days following initial infection, and expression could still be detected till 21 days post-transfection (Fig. 6F).
Figure 6

Image of immunofluorescence, PCR electrophoresis and ELISA detection after transfection.

Image of immunofluorescence performed 72 hours after transfection of BMSCs. There was a positive red(A) or green(B) fluorescence staining in the BMSCs in B group or T group 72 h after transfection. Both the red and the green fluorescence were detected in the BT group (C). No positive red or green fluorescence was detected in the N group (D). PCR results showed a band at 310 bp (B group) and at 114 bp was detected in B and T group, respectively. In the BT group, both 310 bp and 114 bp bands were detected, and no band was detected in the control N group (E). ELISA assay showed that the expression of BMP-2 or TGF-β3 increased gradually and then peaked at 7 days following initial infection, and expression could still be detected till 21 days post-transfection (F,G).

Image of immunofluorescence, PCR electrophoresis and ELISA detection after transfection.

Image of immunofluorescence performed 72 hours after transfection of BMSCs. There was a positive red(A) or green(B) fluorescence staining in the BMSCs in B group or T group 72 h after transfection. Both the red and the green fluorescence were detected in the BT group (C). No positive red or green fluorescence was detected in the N group (D). PCR results showed a band at 310 bp (B group) and at 114 bp was detected in B and T group, respectively. In the BT group, both 310 bp and 114 bp bands were detected, and no band was detected in the control N group (E). ELISA assay showed that the expression of BMP-2 or TGF-β3 increased gradually and then peaked at 7 days following initial infection, and expression could still be detected till 21 days post-transfection (F,G).

Effect of Ad-BMP-2 or/and Ad-TGF-β3-induced BMSCs chondrogenesis

a. Specific gene expression in chondrogenic differentiation

ELISA assays showed that the expression of both BMP-2 and TGF-β3 decreased respectively at 14 d and 21 d, as compared with the levels 7 d post-transfection in the three treated group. The expression of SOX-9, COL-2A, and ACAN were up-regulated with the increased of culture time in each of the three treated groups. Notably, the expression of SOX-9, COL-2A and ACAN were significantly increased in BT group as compared with either of the individual treated groups (Fig. 7A–C). Similarly, the BT group exhibited markedly more potent induction of chondrocytic gene expression than either the treated BMP-2 or TGF-β3 groups alone, while the negative control group showed either negligible or no expression at any detectable level.
Figure 7

The expression of SOX-9, COL-2A, ACAN in B, T, BT group at 1W,2W,3W after transfection.

Total RNA from the samples of BMSCs in the B, T, BT, and N group at 7 d, 14 d and 21 d were extracted with RNeasy mini kit. Complementary DNA was prepared using SuperScript III first-strand synthesis system. Expression of SOX9, COL-II and ACAN were analyzed via iQ SYBRR green super mix on MyiQ single color Real Time polymerase chain reaction (RT-PCR) detection system. The relative expression expression of SOX-9, COL-2A and ACAN were significantly increased in BT group as compared with either of the individual treated groups (*P<0.05, * *P<0.01).

The expression of SOX-9, COL-2A, ACAN in B, T, BT group at 1W,2W,3W after transfection.

Total RNA from the samples of BMSCs in the B, T, BT, and N group at 7 d, 14 d and 21 d were extracted with RNeasy mini kit. Complementary DNA was prepared using SuperScript III first-strand synthesis system. Expression of SOX9, COL-II and ACAN were analyzed via iQ SYBRR green super mix on MyiQ single color Real Time polymerase chain reaction (RT-PCR) detection system. The relative expression expression of SOX-9, COL-2A and ACAN were significantly increased in BT group as compared with either of the individual treated groups (*P<0.05, * *P<0.01).

b. Immunohistochemical staining of type II collagen

Immunohistochemical staining indicated that the cells were positive for type II collagen in B, T, and BT groups at 21 d after culture. The cell of BT group appeared to have acquired a strong type II collagen staining as compared either the those infected cells in the B or T groups. The uninfected cells (N group) remainined negative for type II collagen staining throughout the experiment (Fig. 8A–D).
Figure 8

Immunohistochemical image of COL-II 21 days after transfection.

Type II collagen expression was detected using a mouse monoclonal antibody (1∶200; Abcam, England) and a horseradish peroxidase-conjugated anti-mouse antibody (1∶50; Dako, Denmark), followed by colour development with diaminobenzidine tetrahydrochloride (DAB, Dako). The cell of BT group(C) acquired a strong type II collagen staining compared with B group (A) and T group (B). The N group (D) were negative for type II collagen staining.

Immunohistochemical image of COL-II 21 days after transfection.

Type II collagen expression was detected using a mouse monoclonal antibody (1∶200; Abcam, England) and a horseradish peroxidase-conjugated anti-mouse antibody (1∶50; Dako, Denmark), followed by colour development with diaminobenzidine tetrahydrochloride (DAB, Dako). The cell of BT group(C) acquired a strong type II collagen staining compared with B group (A) and T group (B). The N group (D) were negative for type II collagen staining.

The electron microscope micrograph of DBM

SEM revealed a highly fibrous and porous structure of the DBM, with an average pore size of 119.42±6.46 µm, which should theoretically permit BMSCs migration and growth, and facilitate the diffusion of nutrients into the matrix (Fig. 9A). SEM was also performed on the DBMs after culturing with BMSCs in order to observe cell attachment, growth and spatial distribution of BMSCs on the DBM scaffolds. Images showed that BMSCs infected with Ad-BMP-2 and Ad-TGF-β3 begin to attach to DBM scaffolds 2 day after seeding (Fig. 9B). BMSCs were densely packed and formed connections between the DBM and were well dispersed throughout the porous surface 6 days after cell seeding (Fig. 9C). By day 7, most of the DBM pores were deposited with abundant cells (Fig. 9D).
Figure 9

SEM image of DBM and the adhesion and morphology of induced BMSCs cultured on DBM.

SEM showed DBM had natural netlike structure with pores interconnected(A). A large number of cells was growing and covering the surface of DBM 2days after incubation(B). SEM showed the number of cells significantly increased(blue arrow), the spindled cell growing on the surface and the interior of DBM(red arrow)(C,D).

SEM image of DBM and the adhesion and morphology of induced BMSCs cultured on DBM.

SEM showed DBM had natural netlike structure with pores interconnected(A). A large number of cells was growing and covering the surface of DBM 2days after incubation(B). SEM showed the number of cells significantly increased(blue arrow), the spindled cell growing on the surface and the interior of DBM(red arrow)(C,D).

Evaluations of cartilage defect repaired

a. Gross Evaluations

In terms of the gross appearance of filling amounts in defective areas, the I group seemed to be superior to other tested groups, followed by the II group and then the III group, with the negative control IV group faring the worst. At 12 weeks post-operation, the full-thickness cartilage lesions had healed in all cases among the I group, with the contour of the femur being nearly entirely repaired and both the color and quality of repaired tissue being similar to the surrounding healthy cartilage. In both the II and III groups, the defects did not appear to fully heal and remained irregular, with the contour of the femur surrounding the defects remaining visibly discernible. By contrast, the negative control group were failed to heal and repair, and were filled with fibrous tissue or granular tissues(Fig.10). Taken collectively, these visual inspect result showed that the DBM combining BMSCs cell infected with Ad-BMP-2 and Ad-TGF-β3 more successfully repaired the full-thickness cartilage defects we administered to the animal models as compared with the other tested groups, with the negative control group showing no signs of effective repair.
Figure 10

The gross observation of group I, II, III, IV at operation, 4W, 8W and 12W after operation.

At 12 weeks post-operation, the full-thickness cartilage lesions had healed in I group, with the contour of the femur being nearly entirely repaired and both the color and quality of repaired tissue being similar to the surrounding healthy cartilage. In both the II and III groups, the defects did not appear to fully heal and remained irregular, with the contour of the femur surrounding the defects remaining visibly discernible. There was retained a severe degeneration, in IV group.

The gross observation of group I, II, III, IV at operation, 4W, 8W and 12W after operation.

At 12 weeks post-operation, the full-thickness cartilage lesions had healed in I group, with the contour of the femur being nearly entirely repaired and both the color and quality of repaired tissue being similar to the surrounding healthy cartilage. In both the II and III groups, the defects did not appear to fully heal and remained irregular, with the contour of the femur surrounding the defects remaining visibly discernible. There was retained a severe degeneration, in IV group.

b. Histological evaluation

Results of the H&E and safranin O staining showed that the defects were mainly composed of DBM, and the boundaries to adjacent cartilage were clear in each group at 2 weeks after operation (data not shown). It appears that the DBM scaffolds were gradually absorbed over time, and by 8 weeks post-operation they were completely absorbed in all groups. In the defect area, chondrocytes and cartilage lacunas were largely increased, and the repaired tissue were main hyaline cartilage with safranin O positive stain in I group. At 12 weeks post-operation, the repaired tissue was largely hyaline cartilage that stained positively with safranin O staining, as compared with other three groups (Fig. 11).
Figure 11

The imagine of H&E and safranin O staining in group I, II, III, IV at 8W and 12W after operation.

It appears that the DBM scaffolds were gradually absorbed over time, and by 8 weeks post-operation they were completely absorbed in all groups. In the defect area, chondrocytes and cartilage lacunas were largely increased, and the repaired tissue were main hyaline cartilage with safranin O positive stain in I group. At 12 weeks post-operation, the repaired tissue was largely hyaline cartilage that stained positively with safranin O staining, as compared with other three groups.

The imagine of H&E and safranin O staining in group I, II, III, IV at 8W and 12W after operation.

It appears that the DBM scaffolds were gradually absorbed over time, and by 8 weeks post-operation they were completely absorbed in all groups. In the defect area, chondrocytes and cartilage lacunas were largely increased, and the repaired tissue were main hyaline cartilage with safranin O positive stain in I group. At 12 weeks post-operation, the repaired tissue was largely hyaline cartilage that stained positively with safranin O staining, as compared with other three groups.

c. O'driscoll score

The repair effectiveness of the defect cartilage in all four groups was also evaluated using the O'driscoll score. Results of the O'driscoll scores at 12W postoperation were as follows: 15.65±0.61 (BT group), 11.33±1.08 (T group), 9.13±0.85 (B group) and4.38±1.35 (N group) (Fig. 12). The scores of BT group were significantly higher than both control and non-treatment group scores, there was significant difference among the groups (*P<0.05, * *P<0.01).
Figure 12

The The O'driscoll score of group I, II, III, IV at 8W and 12W after operation.

At 12W after implantation, I group scores were significantly higher than both control and non-treatment group scores (*P<0.05, * *P<0.01).

The The O'driscoll score of group I, II, III, IV at 8W and 12W after operation.

At 12W after implantation, I group scores were significantly higher than both control and non-treatment group scores (*P<0.05, * *P<0.01).

Discussion

Given the difficulty in repairing tissues that have naturally low capacities for self-regeneration, tissue engineering has emerged as a new method in which a combination of cells, scaffold, and bioactive agents are used to fabricate functional new tissues that can repair damaged cartilage that has traditionally resisted effective treatment [20]–[22]. In this study, we generated a new type of tissue engineering cartilage using a genetic enhancement technique in which a DBM was cultured with BMSCs infected with Ad-BMP-2 and Ad-TGF-β3. In vitro, BMSCs treated with Ad-BMP-2 and Ad- TGF-β3 (BT group) acquired strong type II collagen staining as compared with both the groups infected with either Ad-BMP-2 (B group) or Ad-TGF-β3 (T group) alone (Fig. 8). Similarly, the respective expression of COL-2A, ACAN, SOX9 in the BT group was markedly higher than either the B group or T group (Fig. 7). In vivo, we found that the defected cartilage in our pig models was repaired by hyaline cartilage that stained positively with Safranin O in the I group (Fig. 10); A finding matched by gross observation and histology that showed in I group it was difficult to identify the border between the repaired cartilage in the defected areas and the adjacent normal, healthy cartilage (Fig. 9, Fig. 10). Compared with this I group, the II, III groups and the negative control group either failed to adequately fill the defected cavities or formed fibrous tissue mainly composed of fibrous cartilage. In tissue engineering therapeutics, BMSCs are commonly employed for cartilage regeneration since they are multi-potent cells that can differentiate into many different cell types when cultured in particular environment. A growing number of studies have demonstrated that growth factors have specific effects on chondrogenesis. BMP-2 has been proven to enhance the expression of chondrogenic matrix components, such as type II collagen and aggrecan in vitro [23]–[25]. The precartilaginous cells in condensations do not differentiate into chondrocytes in the absence of BMP signaling [26], [27]. TGF-β3 as key cell adjustment control factor involved in the cell aggregates of appreciation, differentiation and maturation of each order section [28], [29], it has been treated as an effective induced factor, prompting seed cells to the cartilage differentiation in the cartilage tissue engineering. Recent studies have further demonstrated that both growth factors in combination induced significantly higher expression of cartilage-specific genes and elevated release of cartilage-specific extracellular matrix proteins [30], [31]. As evidenced in our experiments, there were acquired strong type II collagen staining in cells infected with Ad-BMP-2 and Ad-TGF-β3 (BT group) compared with B group and T group, indicating that the combination of Ad-BMP-2 and Ad-TGF-β3 is likely to be superior to the standard differentiation method using either Ad-TGF-β3 or Ad-BMP-2 alone for BMSC chondrogenesis(Fig. 8). In tissue engineering therapeutics, scaffolds play a pivotal role because they supported cell attachment, proliferation, and differentiation; To date, numerous types of scaffolds—both natural and synthetic—have been proposed for use in cartilage tissue engineering [21], [32]. The natural tissues scaffolds are not always able to used successfully as often they can be damaged or must be removed. As to synthetic polymers scaffold, although they have been used successfully, the fact that they could only provide a scaffold for cartilage in-growth rather than possessing tissue-derived substances such as growth factors or cells precludes them from being ideal bone substitutes [33]. An alternative that overcomes this limitation is the use of DBM. As an allogrous tissue derived from native osseous tissue, its close relation in structure and function with autologous bone allows it to contain bone morphogenic proteins (BMPs) and matrix proteins [34]. BMPs are potent cartilage-inducing factor, which in vitro have been found capable of generating cartilage by inducing differentiation of mesenchymal cells into chondrocytes [35]. Moreover, while matrix proteins, such as different collagens, provide a cartilage induced matrix that can enable BMSCs cell adhesion. In our experiment, we also demonstrated that DBM has highly fibrous and porous structure, with an average pore size of 119.42±6.46 µm and average porosity of 60.19±6.10%, which should theoretically be a suitable size for allowing both cell adhesion and growth, this porous structure should assist in the penetration of nutrients into the matrix, which affects cells proliferation. In our experiment in vitro, SEM images showed that the Ad-BMP-2 and Ad-TGF-β3 infected BMSCs adhered and propagated well in DBM, the cells formed connections between the DBM and were well dispersed throughout the porous surface and inner 6 days after cell seeding. In our animal models, the macroscopical and histological evidence shows that when these DBM scaffolds combined with BMSCs were implanted into a defect in the femoral condyle, the cartilage repair worked most effectively when the BMSCs were infected with Ad-BMP-2 and Ad-TGF-β3. This is not an unsurprising finding given that in cartilage tissue engineering, growth factors are important for regulating cell proliferation, differentiation, maturation. The success of cartilage formation depends largely on the means to achieve stable, sustained and effective growth factor expression, but the clinical utility of those protein is limited due to their short half-lives and instability in vivo. Gene therapy may be viewed as a drug delivery system that is able to deliver an essentially pure agent to a specific location in a delayed-release fashion [36], it was a good alternative to direct protein delivery. Adenoviruses are the most widely used gene therapy vector due to these viruses are able to infect both dividing and non-dividing cells and can be produced at high titers, as well as to propagate without integrating into the host genome [37]. The present study involved the use of gene transfer as a means to provide sustained delivery of chondrogenic proteins to primary BMSCs. Gene-induced chondrogenesis of BMSCs using multiple genes that act synergistically may enable the administration of reduced viral doses in vivo and could be of considerable benefit for the development of cell-based therapies for cartilage repair. In our experiment, the cells infected with Ad-BMP-2 and Ad-TGF-β3 at MOI = 20, MOI = 50 respectively have no obvious pathological change at 24 hours and 48 hours under optical microscope, adenoviruses vector had no obvious effect on cell growth and proliferation infected with suitable MOI. The Immunofluorescence staining, PCR and ELISA showed that the Ad-BMP-2 and Ad-TGF-β3 could be transfected and expressed effectively in BMSCs, real-time PCR showed that the expression of TGF-β3 and BMP-2 genes sustainable for 3 weeks, which is long enough to induce BMSCs to chondrocytes. Taken together, these results strongly suggest that a combination of Ad-BMP-2 and Ad-TGF-β3 gene transfer can more effectively induce BMSCs differentiation into cartilage in vitro; The DBM scaffolds derived from spongy bone tissue combined with BMSCs can repair cartilage defects in vivo, but works most effectively when both Ad-BMP-2 and Ad-TGF-β3 are present. The above results suggest this combination is far more suitable for clinical treatments of articular cartilage damage.
  37 in total

Review 1.  Preclinical cartilage repair: current status and future perspectives.

Authors:  S W O'Driscoll
Journal:  Clin Orthop Relat Res       Date:  2001-10       Impact factor: 4.176

2.  TGF-β3 immobilized PLGA-gelatin/chondroitin sulfate/hyaluronic acid hybrid scaffold for cartilage regeneration.

Authors:  Hongbin Fan; Huiren Tao; Yingnan Wu; Yunyu Hu; Yongnian Yan; Zhuojin Luo
Journal:  J Biomed Mater Res A       Date:  2010-09-24       Impact factor: 4.396

3.  Designer nodal/BMP2 chimeras mimic nodal signaling, promote chondrogenesis, and reveal a BMP2-like structure.

Authors:  Luis Esquivies; Alissa Blackler; Macarena Peran; Concepcion Rodriguez-Esteban; Juan Carlos Izpisua Belmonte; Evan Booker; Peter C Gray; Chihoon Ahn; Witek Kwiatkowski; Senyon Choe
Journal:  J Biol Chem       Date:  2013-12-05       Impact factor: 5.157

4.  Granulin epithelin precursor: a bone morphogenic protein 2-inducible growth factor that activates Erk1/2 signaling and JunB transcription factor in chondrogenesis.

Authors:  Jian Q Feng; Feng-Jin Guo; Bai-Chun Jiang; Yan Zhang; Sally Frenkel; Da-Wei Wang; Wei Tang; Yixia Xie; Chuan-Ju Liu
Journal:  FASEB J       Date:  2010-02-02       Impact factor: 5.191

Review 5.  Current strategies for articular cartilage repair.

Authors:  S N Redman; S F Oldfield; C W Archer
Journal:  Eur Cell Mater       Date:  2005-04-14       Impact factor: 3.942

6.  Microfracture for chondral defects of the talus: maintenance of early results at midterm follow-up.

Authors:  Christoph Becher; Arne Driessen; Thomas Hess; Umile Giuseppe Longo; Nicola Maffulli; Hajo Thermann
Journal:  Knee Surg Sports Traumatol Arthrosc       Date:  2010-02-04       Impact factor: 4.342

Review 7.  Human mesenchymal stem cells: from basic biology to clinical applications.

Authors:  B M Abdallah; M Kassem
Journal:  Gene Ther       Date:  2007-11-08       Impact factor: 5.250

Review 8.  Genetically engineered stem cell-based strategies for articular cartilage regeneration.

Authors:  Aruna Santhagunam; Catarina Madeira; Joaquim M S Cabral
Journal:  Biotechnol Appl Biochem       Date:  2012 Mar-Apr       Impact factor: 2.431

9.  Hypertrophic differentiation during chondrogenic differentiation of progenitor cells is stimulated by BMP-2 but suppressed by BMP-7.

Authors:  M M J Caron; P J Emans; A Cremers; D A M Surtel; M M E Coolsen; L W van Rhijn; T J M Welting
Journal:  Osteoarthritis Cartilage       Date:  2013-01-24       Impact factor: 6.576

10.  TGF-ß1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy.

Authors:  Nahoko Shintani; Klaus A Siebenrock; Ernst B Hunziker
Journal:  PLoS One       Date:  2013-01-03       Impact factor: 3.240

View more
  10 in total

1.  Near infrared spectroscopic assessment of developing engineered tissues: correlations with compositional and mechanical properties.

Authors:  Arash Hanifi; Uday Palukuru; Cushla McGoverin; Michael Shockley; Eliot Frank; Alan Grodzinsky; Richard G Spencer; Nancy Pleshko
Journal:  Analyst       Date:  2017-04-10       Impact factor: 4.616

2.  Effects of culture conditions on the mechanical and biological properties of engineered cartilage constructed with collagen hybrid scaffold and human mesenchymal stem cells.

Authors:  Yusuke Nakamuta; Takaaki Arahira; Mitsugu Todo
Journal:  J Mater Sci Mater Med       Date:  2019-10-19       Impact factor: 3.896

3.  BMP7-overexpressing bone marrow-derived mesenchymal stem cells (BMSCs) are more effective than wild-type BMSCs in healing fractures.

Authors:  Xu Yan; Zhenhua Zhou; Lixin Guo; Zhaochi Zeng; Zhongkai Guo; Qingdong Shao; Weidong Xu
Journal:  Exp Ther Med       Date:  2018-06-21       Impact factor: 2.447

Review 4.  Gene therapy for chondral and osteochondral regeneration: is the future now?

Authors:  Daniele Bellavia; F Veronesi; V Carina; V Costa; L Raimondi; A De Luca; R Alessandro; M Fini; G Giavaresi
Journal:  Cell Mol Life Sci       Date:  2017-09-01       Impact factor: 9.261

5.  A novel culture platform for fast proliferation of human annulus fibrosus cells.

Authors:  Li Xiao; Mengmeng Ding; Osama Saadoon; Eric Vess; Andrew Fernandez; Ping Zhao; Li Jin; Xudong Li
Journal:  Cell Tissue Res       Date:  2016-09-13       Impact factor: 5.249

6.  Correction: Demineralized Bone Matrix Combined Bone Marrow Mesenchymal Stem Cells, Bone Morphogenetic Protein-2 and Transforming Growth Factor-β3 Gene Promoted Pig Cartilage Defect Repair.

Authors:  Xin Wang; Yanlin Li; Rui Han; Chuan He; Guoliang Wang; Jianwei Wang; Jiali Zheng; Ming Pei; Lei Wei
Journal:  PLoS One       Date:  2015-05-13       Impact factor: 3.240

7.  Demineralized Bone Matrix to Augment Tendon-Bone Healing: A Systematic Review.

Authors:  Adam T Hexter; Catherine Pendegrass; Fares Haddad; Gordon Blunn
Journal:  Orthop J Sports Med       Date:  2017-10-25

Review 8.  Reconstructing Bone with Natural Bone Graft: A Review of In Vivo Studies in Bone Defect Animal Model.

Authors:  Mengying Liu; Yonggang Lv
Journal:  Nanomaterials (Basel)       Date:  2018-12-03       Impact factor: 5.076

9.  Comparative effectiveness of two methods for inducing osteoarthritis in a novel animal model, the Diannan small-ear pig.

Authors:  Di Jia; Ruixian Zhang; Yinghong He; Guofeng Cai; Jiali Zheng; Yuye Yang; Yanlin Li
Journal:  J Orthop Surg Res       Date:  2021-10-14       Impact factor: 2.359

10.  Chondrogenic Potential of Peripheral Blood Derived Mesenchymal Stem Cells Seeded on Demineralized Cancellous Bone Scaffolds.

Authors:  Shao-Jie Wang; Dong Jiang; Zheng-Zheng Zhang; Ai-Bing Huang; Yan-Song Qi; Hai-Jun Wang; Ji-Ying Zhang; Jia-Kuo Yu
Journal:  Sci Rep       Date:  2016-11-08       Impact factor: 4.379

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.