Micro RNAs (miRNAs) are important regulators involved in various physical and pathological processes, including cancer. The miRNA-302 family has been documented as playing a critical role in carcinogenesis. In this study, we investigated the role of miRNA-302a in colon cancer. MiRNA-302a expression was detected in 44 colon cancer tissues and 10 normal colon tissues, and their clinicopathological significance was analyzed. Cell proliferation and cell cycle analysis were performed on colon cancer cells that stably expressed miRNA-302a. The target gene of miRNA-302a and the downstream pathway were further investigated. Compared with normal colon tissues, miRNA-302a expression was downregulated in colon cancer tissues. Overexpression of miRNA-302a induced G1/S cell cycle arrest in colon cancer cells, and suppressed colon cancer cell proliferation both in vitro and in vivo. Furthermore, miRNA-302a inhibited AKT expression by directly binding to its 3' untranslated region, resulting in subsequent alterations of the AKT-GSK3β-cyclin D1 pathway. These results reveal miRNA-302a as a tumor suppressor in colon cancer, suggesting that miRNA-302a may be used as a potential target for therapeutic intervention in colon cancer.
Micro RNAs (miRNAs) are important regulators involved in various physical and pathological processes, including cancer. The miRNA-302 family has been documented as playing a critical role in carcinogenesis. In this study, we investigated the role of miRNA-302a in colon cancer. MiRNA-302a expression was detected in 44 colon cancer tissues and 10 normal colon tissues, and their clinicopathological significance was analyzed. Cell proliferation and cell cycle analysis were performed on colon cancer cells that stably expressed miRNA-302a. The target gene of miRNA-302a and the downstream pathway were further investigated. Compared with normal colon tissues, miRNA-302a expression was downregulated in colon cancer tissues. Overexpression of miRNA-302a induced G1/S cell cycle arrest in colon cancer cells, and suppressed colon cancer cell proliferation both in vitro and in vivo. Furthermore, miRNA-302a inhibited AKT expression by directly binding to its 3' untranslated region, resulting in subsequent alterations of the AKT-GSK3β-cyclin D1 pathway. These results reveal miRNA-302a as a tumor suppressor in colon cancer, suggesting that miRNA-302a may be used as a potential target for therapeutic intervention in colon cancer.
According to the Chinese Cancer Registry Annual Report (2012), colon/rectal cancer has become the second most common cancer and the second and fourth leading cause of cancer-related mortality in women and men, respectively, in China [1]. In fact, colon cancer is one of the most common cancers globally, accounting for approximately 9% of cancer related deaths [2], mostly due to metastatic progression [3]. This necessitates identifying advanced molecular markers for diagnosis which would aid in early diagnosis and prevention of metastatic progression in colon cancer. Surgery remains the therapy of choice for colon cancer; but of late, a more multidisciplinary approach incorporating neoadjuvant chemotherapy has become the hallmark of treatment [4]. It perhaps cannot be emphasized enough though the need to monitor the tumor response to therapy in order for selecting the best candidates for surgery to ensure positive outcomes, and there lies the need to understand the underlying pathologic mechanism of colon cancer onset and progression. The critical events that control the whole process of colon cancer metastasis are still largely unknown.Growing evidence indicates that microRNAs (miRNAs), a type of endogenous, small noncoding RNAs, participate in diverse cellular processes. Through specifically binding and cleaving mRNAs or inhibiting their translation [5], miRNAs function as either oncogenes or tumor suppressors [6].The miRNA-302 family was first identified in human embryonic stem cells (hESCs) and humanembryonic carcinoma cells in 2004. Since then, various studies on the miRNA-302 family have focused on its potential role in reprograming somatic cells into induced pluripotent stem cells, as well as embryonic self-renewal [7]. Several transcription factors that are expressed early in cancer stem cell development and maintenance, such as Oct4, Sox2, and Nanog, were found essential for the transcriptional regulation of the miRNA-302 family [8]. Interestingly, Fareh et al. demonstrated that stable expression of miRNA-302 was able to induce loss of Oct4, Sox2, and Nanog
[9]. The role of miRNA-302 in tumorigenesis has been debated recently, as conflicting conclusions have been drawn by different research groups. For instance, endogenous miRNA-302 was not detected in cervical cancer cells, and ectopic expression of miRNA-302 inhibited cell proliferation and tumor formation [10]. In contrast, transfection of miRNA-302b in colon cancer cells resulted in an increase in stemness of CD133+ HT 29 cells in vitro
[11]. However, to date, no studies have been conducted to investigate the possible role of miRNA-302 in colon cancerpatients or/and in colon cancer pathogenesis in xenograft models, which was the major objective of the current study.
Materials and Methods
Patient samples
Colon cancer tissue and benign colon tissue were obtained from the tissue bank at General Hospital of People's Liberation Army. Clinicopathological features of these patients were retrieved from the Department of Oncology database. The study protocol was approved by the Institutional Research Review Board at General Hospital of People's Liberation Army and signed informed consents were obtained from all study participants. All of the procedures were done in accordance with the Declaration of Helsinki and relevant policies in China.
Cell culture
Humancolon cancer cell lines, HCT8 and HCT116, and humanembryonic kidney293T cells (HEK293T) were purchased from the Shanghai Bioleaf Biotech Co., Ltd. (Shanghai, China). HCT8, HCT116, and HEK293T cells were grown in DMEM medium supplemented with 10% fetal bovine serum. Cells were cultured at 37°C at 5% CO2.
RNA, miRNA extraction, and quantitative real-time polymerase chain reaction
Total RNA was isolated from cultured cells and tumor tissues using Trizol reagent. First strand cDNA was synthesized using the RevertAid First Strand cDNA synthesis Kit (Life Technology, Carlsbad, CA), which was then used for real-time polymerase chain reaction (PCR), together with forward and reverse primers and the Power SYBR Green PCR Master Mix. β-actin was used as an internal control for AKT transcript levels. The primer sequences used were as follows: AKT-forward: GGGTTTCTCCCAGGAGGTTT, reverse: GTCCATGGTGTTCCTACCCA; β-actin-forward: ACCGAGCGCGGCTACAG, reverse: CTTAATGTCACGCACGATTTCC. According to the manufacturer's instructions, miRNA from tissues and cells was extracted using the mirVana miRNA isolation kit (Life Technology, Carlsbad, CA), and the expression levels of miRNA-302a were detected by TaqMan miRNA assays (Life technology, Carlsbad, CA), using U6 small nuclear RNA as an internal control.
Vector construction, lentivirus production, and stable transfection
The mature hsa-miRNA-302a sequence was synthesized and introduced into the PLKO.3G vector to produce PLKO.3G-miR-302a. The luciferase-3′ untranslated region (UTR) reporter vector was generated through subcloning the AKT 3′UTR, which carries a putative miRNA-302a binding site into vector MT01. All the constructed vectors were verified by sequencing. PLKO.3G-miR-302a mixed with psPAX2 and PMD2-G was transfected into HEK293T cells using Lipofectamine 2000 reagent (Life Technologies, Carlsbad, CA) according to the manufacturer's protocol. Forty-eight hours later, lentivirus was harvested and used to infect HCT8 and HCT116 cells. Next, the cells were sorted by flow cytometry (Beckman Coulter, Brea, CA) to establish stable cell lines constitutively expressing miRNA-302a (HCT8-302a and HCT116-302a cells).
Luciferase assays
Forty-eight hours after transfection, cells were lysed using 50 µL of passive lysis buffer. Next, a dual-luciferase assay was carried out as directed by the manufacturer (Promega, Madison, WI). The ratio of firefly to Renilla luciferase activity was used to express luciferase activities. All experiments were performed in triplicate. Data is represented as mean ± standard deviation (sd).
Protein harvest and western blot
Total proteins were harvested using the CelLytic Extraction kit (Roche, Basel, Switzerland) containing protease inhibitors and then quantified using the BCA Protein Assay Reagent kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's instructions. After separating proteins using sodium dodecyl sulfatepolyacrylamide gel electrophoresis, protein was transferred to polyvinylidene fluoride membranes and then blocked in 5% fat-free milk. Using the primary antibodies and anti-rabbit linked to horseradish peroxidase (1∶5000) (Santa Cruz Biotechnology, Dallas, TX) as the secondary antibody, the target proteins were probed and then visualized using the ECL Plus Western Blotting System (Thermo Fisher Scientific, Waltham, MA). The blots were stripped and probed with α-β-actin antibody to confirm equivalent loading. The primary antibodies included the following: AKT (1∶1000), GSK3β (1∶500), cyclin D1 (1∶1000), PI3K (1∶1000), PTEN (1∶500) (Cell Signaling Technology, Boston, MA) and β-actin (1∶2000) (Santa Cruz Biotechnology, Dallas, TX).
Cell proliferation and cell cycle assays
CCK-8 and EdU assays were performed to detect cell proliferation. Briefly, CCK-8 assays were carried out as follows: cells were seeded in a 96-well plate at a concentration of 1×104 cells/well. After adherence, the cells were cultured in fresh medium mixed with CCK-8 (10∶1) (Dojindo, Shanghai, China) for 2 hours, before the absorbance was measured with a microplate reader at 450 nm. For EdU assays, cells were incubated in EdU solution (1∶5000) for 2 hours, then were harvested and stained using the Cell-Light EdU Apollo 643 In vitro Flow Cytometry Kit (Ribobio, Guangzhou, China), according to the manufacturer's instructions. The cells were then analyzed by flow cytometry.A cell cycle assay was also performed using flow cytometry: briefly, cells were fixed with 75% cold ethanol overnight, and then washed with phosphate-buffered saline. Next, propidium iodide (50 µg/mL) was added to the cells for DNA staining before flow cytometry analysis.
Colony formation assay
Isolated cells were seeded in 60 mm plates at a concentration of 500 cells/well and then incubated in 5% CO2 at 37°C. Twenty days later, cells were stained with 0.5% crystal violet for 30 minutes. Colony numbers in each plate were counted using an inverted microscope.
In vivo tumorigenicity
The PLKO.3G-Scr-transfected HCT8 cells (HCT-8-Scr cells) and HCT116-302a cells were injected subcutaneously into either posterior flank of the same 4–6-week-old male nude mouse. Tumor volume was calculated and tumor weight was measured after sacrifice on day 40. Tumors were then divided into two parts, each part fixed with 10% formalin or preserved in −80°C. The animal experiments were performed with the approval of the Animal Studies Ethics Committee of General Hospital of People's Liberation Army.
Immunohistochemistry
Immunohistochemistry (IHC) staining of paraffin-embedded specimens was performed as previously described [12]. Briefly, rabbit anti-AKT antibody and anti-mouse/rabbithorseradish peroxidase-labeled antibody (Santa Cruz Biotechnology Co., Ltd, Shanghai, China) were used as the primary and the second antibody, respectively.
Statistical analyses
The difference between continuous variables was analyzed using the Student's t-test or analysis of variance. Two-sided P-values <0.05 were considered statistically significant. Statistical analyses were performed using SPSS version 20.0 (IBM Corporation, NY).
Results
MiRNA-302a expression is suppressed in colon cancer tissues
Colon cancer tissues were acquired from a total of 44 male patients with an average age of 67 years (range, 49 to 77 years) with newly diagnosed, pathologically confirmed colon cancer. All patients had received surgical resection. Pathologically confirmed normal colon tissues were acquired from 10 male patients with bladder cancer who had received radical cystectomy.We detected miRNA-302a expression levels in 44 colon tissues and 10 normal colon tissues and found that, compared with normal colon tissues, colon cancer tissues expressed lower levels of miRNA-302a (
). Furthermore, we analyzed the relationship between miRNA-302a levels and clinicopathological features in colon cancerpatients. There was no significant association observed between miRNA-302a levels and age or clinical stage (data not shown).
Figure 1
MiRNA-302a expression profiles in colon cancer tissue, normal prostate tissue, and colon cancer cells.
(A) MiRNA-302a expression was downregulated in colon cancer tissue compared with normal colon tissue. (B) Low levels of miRNA-302a expression were detected in four human colon cancer cell lines, HCT8, HCT116, HT29, and CaCO2. (C) High levels of miRNA-302a expression were detected in HCT8 and HCT116 colon cancer cells stably expressing miRNA-302a (*P<0.05).
MiRNA-302a expression profiles in colon cancer tissue, normal prostate tissue, and colon cancer cells.
(A) MiRNA-302a expression was downregulated in colon cancer tissue compared with normal colon tissue. (B) Low levels of miRNA-302a expression were detected in four humancolon cancer cell lines, HCT8, HCT116, HT29, and CaCO2. (C) High levels of miRNA-302a expression were detected in HCT8 and HCT116colon cancer cells stably expressing miRNA-302a (*P<0.05).
Overexpression of miRNA-302a inhibits colon cancer cell growth in vitro and in vivo
To investigate the function of miRNA-302a in colon cancer, we measured the expression of miRNA-302a in four humancolon cancer cell lines (HCT8, HCT116, HT29, and Caco2) by quantitative real-time PCR. As shown in
, there was low expression of miRNA-302a in all four cell lines. Because we speculated that overexpression of miRNA-302a may inhibit colon cancer cell growth, we stably overexpressed miRNA-302a in HCT8 and HCT116 cells (termed as HCT8-302a and HCT116-302a cells), which was confirmed by quantitative reverse-transcriptase (qRT)-PCR (
).The CCK-8, EdU, and colony forming assays were carried out to examine whether miRNA-302a overexpression affected colon cancer cell proliferation in vitro. As shown in
, there was a significantly lower (P<0.05) growth rate in HCT8-302a and HCT116-302a cells compared with the controls. Flow cytometric analyses indicated that the percentages of EdU-positive cells in both HCT8-302a and HCT116-302a cells were lower than in the controls. In addition, compared with the controls, both HCT8-302a and HCT116-302a cells developed fewer colonies on the 20th and 15th days, respectively. Therefore, in vitro experiments demonstrated that miRNA-302a exerted a suppressive role in colon cancer cell proliferation.
Figure 2
Overexpression of miRNA-302a significantly inhibits cell proliferation in colon cancer cells in vitro.
CCK-8 assay was performed to measure proliferation in (A) HCT8 and (B) HCT116 cells. Data represent the mean ± standard deviation of the optical density (OD) value detected at 450 nm from three independent experiments. Cell proliferation was detected in (C) HCT8 and (D) HCT116 cells using EdU assay analyzed by flow cytometry. (E, F) Colony formation assays indicated fewer colonies in miRNA-302a overexpressing HCT8 cells. (*P<0.05).
Overexpression of miRNA-302a significantly inhibits cell proliferation in colon cancer cells in vitro.
CCK-8 assay was performed to measure proliferation in (A) HCT8 and (B) HCT116 cells. Data represent the mean ± standard deviation of the optical density (OD) value detected at 450 nm from three independent experiments. Cell proliferation was detected in (C) HCT8 and (D) HCT116 cells using EdU assay analyzed by flow cytometry. (E, F) Colony formation assays indicated fewer colonies in miRNA-302a overexpressing HCT8 cells. (*P<0.05).To further validate our observations in vivo, HCT8-Scr cells and HCT8-302a cells were injected into the left and right posterior flank of nude mice, respectively. Tumor volumes were measured using calipers at different time points after inoculation, and tumor weights were measured after sacrifice. Both volume and mass were notably lower in HCT8-302a tumors than in HCT8-Scr tumors (P<0.05;
). Taken together, obvious cell proliferation inhibition was observed after overexpression of miRNA-302a in colon cancer cells.
Figure 3
Overexpression of miRNA-302a significantly inhibits cell proliferation in colon cancer cells in vivo.
HCT8-GFP cells and HCT8-302a cells were injected into the left and right posterior flank of nude mice, respectively (A, B). The tumor volume (C) and mass (D) in the HCT8-302a group were notably lower than in the HCT8-GFP group. (* P<0.05).
Overexpression of miRNA-302a significantly inhibits cell proliferation in colon cancer cells in vivo.
HCT8-GFP cells and HCT8-302a cells were injected into the left and right posterior flank of nude mice, respectively (A, B). The tumor volume (C) and mass (D) in the HCT8-302a group were notably lower than in the HCT8-GFP group. (* P<0.05).
Overexpression of miRNA-302a induces cell cycle arrest in colon cancer cells
Now that growth inhibition was observed in colon cancer cells, we performed cell cycle analysis to investigate whether overexpression of miRNA-302a resulted in cell cycle alterations. As shown in
, the proportion of cells in G1-phase increased remarkably in HCT8-302a cells, while the proportion of cells in the S phase were notably less than in the control. Analogous results were observed in HCT16-302a cells, suggesting that miRNA-302a effectively induce G1/s cell cycle arrest in colon cancer cells.
Figure 4
Overexpression of miRNA-302a induces G1/S phase cell cycle arrest in colon cancer cells.
The proportion of cells in G1-phase increased significantly in HCT8-302a cells (A, C) and HCT116-302a cells (B, D) compared with controls, while the proportion of cells in the S phase were notably less than the controls. (* P<0.05).
Overexpression of miRNA-302a induces G1/S phase cell cycle arrest in colon cancer cells.
The proportion of cells in G1-phase increased significantly in HCT8-302a cells (A, C) and HCT116-302a cells (B, D) compared with controls, while the proportion of cells in the S phase were notably less than the controls. (* P<0.05).
MiRNA-302a suppresses AKT expression by directly targeting its 3′UTR
To detect the molecular mechanisms by which miRNA-302a exerts its posttranscriptional regulatory functions, we used bioinformatics algorithms (http://www.targetscan.org) to seek possible target genes, and found that the 3′UTR of AKT mRNA harbors a conserved binding site for miRNA-302a. Next, we examined the expression of AKT at the mRNA and protein level in HCT8-302a and HCT116-302a cells and controls. As shown in Fig. 5A and 6, compared with controls, AKT expressions decreased significantly in HCT8-302a and HCT116-302a cells, at both the mRNA and protein level. Furthermore, AKT expression in HCT8-302a tumors was significantly lower than in HCT8-Scr tumors, as determined by real-time PCR and IHC staining (
). These results suggest that AKT expression is downregulated by miRNA-302a in colon cancer.
Figure 5
MiRNA-302a suppresses AKT expression by directly targeting its 3′ untranslated region.
AKT mRNA expression was remarkably suppressed in (A) HCT8-302a and HCT116-302a cells, and (B) HCT8-302a tumors. (C) Immunohistochemistry staining indicated lower expression of AKT in HCT8-302a tumors. (D) Relative luciferase activity was notably suppressed in wild-type AKT-3′ untranslated region (UTR) transfected cells. (E) Schematic representation of the luciferase reporter, which carried the wild-type or mutant AKT-3′ UTR. (* P<0.05).
Figure 6
Overexpression of miRNA-302a in colon cancer cells triggers alterations in the AKT-GSK3β-cyclin D1 signaling pathway.
Western blot analyses showed downregulated AKT and cyclin D1 levels, and upregulated GSK3β levels in miRNA-302a overexpressing HCT8 cells. PTEN and PI3K levels were not affected.
MiRNA-302a suppresses AKT expression by directly targeting its 3′ untranslated region.
AKT mRNA expression was remarkably suppressed in (A) HCT8-302a and HCT116-302a cells, and (B) HCT8-302a tumors. (C) Immunohistochemistry staining indicated lower expression of AKT in HCT8-302a tumors. (D) Relative luciferase activity was notably suppressed in wild-type AKT-3′ untranslated region (UTR) transfected cells. (E) Schematic representation of the luciferase reporter, which carried the wild-type or mutant AKT-3′ UTR. (* P<0.05).
Overexpression of miRNA-302a in colon cancer cells triggers alterations in the AKT-GSK3β-cyclin D1 signaling pathway.
Western blot analyses showed downregulated AKT and cyclin D1 levels, and upregulated GSK3β levels in miRNA-302a overexpressing HCT8 cells. PTEN and PI3K levels were not affected.To test whether miRNA-302a regulates AKT by directly binding to its 3′UTR, a luciferase reporter vector containing the humanAKT 3′UTR that carried the wild-type miRNA-302a binding sequence was sub cloned. A luciferase vector carrying the mutant 7-bp region complementary to the 5′ seed region of miRNA-302a was generated as the control reporter (
). Compared with the control, the relative luciferase activity was suppressed by 36% (P<0.05) in wild-type AKT 3′UTR transfected cells (
). Therefore, miRNA-302a inhibits colon cancer cells via directly targeting AKT.
MiRNA-302a induced cell cycle alterations in colon cancer cells by inhibiting the AKT-GSK3β-cyclin D1 pathway
To further evaluate the effect of miRNA-302a on the AKT signaling pathway, we detected the expression of upstream (PI3K and PTEN) and downstream (GSK3β and cyclin D1) AKT effectors by western blot. Compared with the corresponding control cells, GSK3β levels were notably elevated, while cyclin D1 was notably reduced in miRNA-302a transfected HCT8 andHCT116 cells. However, expression of two major upstream effectors of AKT, PI3K and PTEN, were not influenced by miRNA-302a transfection (
). Given the critical role of the AKT-GSK3β-cyclin D1 signaling pathway in cell cycle transition, our results suggest that miRNA-302a might induce G1/S cell cycle arrest in colon cancer cells by inhibiting the AKT-GSK3β-cyclin D1 pathway, thereby suppressing colon cancer cell proliferation.
Discussion
In this study, we observed that miRNA-302a was downregulated in colon cancer tissues. Overexpression of miRNA-302a induced G1/S arrest in colon cancer cells, and remarkably suppressed colon cancer cell proliferation in vitro and in vivo. Moreover, AKT was revealed as a direct and functional target gene of miRNA-302a.Over the past decade, most research involving miRNA-302 has focused on its role in hESCs, which are characterized by self-renewal and pluripotency. Studies analyzing miRNA-302 function in carcinogenesis are limited and inconsistent. Lin et al. found that miRNA-302 could inhibit tumorigenicity and induce apoptosis in humanbreast cancerMCF7 cells, embryonic teratocarcinomaTera-2 cells, and hepatocellular carcinomaHepG2 cells [13]. Similarly, cell proliferation was suppressed in cervical cancer Hela and SiHa cells, as well as hepatocellular carcinomaSMMC-7721 cells, via cell cycle regulation [10], [14]. However, Zhu et al. observed an inverse phenomenon in colon cancer cells, where overexpression of miRNA-302b led to enhanced colony-forming ability in vitro
[11]. The augmented colony formation ability was likewise validated in cancer stem cells from head and neck squamous cell carcinoma [15]. For the first time, we reveal suppressed miRNA-302a expression in colon cancer tissues compared with normal colon tissues. Hence, we speculate that miRNA-302a might play an important role in colon cancer development and progression.In our study, an inhibitory effect of miRNA-302a on cell proliferation was observed in colon cancer HCT8 and HCT116 cells, through hindering the G1 to S phase transition, which is considered as a key event during cell proliferation. In agreement with previous studies [8], [10], [14], we also found notable downregulation of cyclin D1 in miRNA-302a overexpressing colon cancer cells. Interestingly, miRNA-302 is predicted to target many cell cycle regulators. For instance, Lin et al. demonstrated that miRNA-302 simultaneously suppressed both cyclin E-CDK2 and cyclin D-CDK4/6 signaling pathways [13], and this target blocking was regulated by several transcriptional factors, such as Oct4 and Sox28. However, Card et al. reported that miRNA-302a promoted an increase in S phase and a decrease in G1 phase in hESCs, although cyclin D1 was also repressed [8]. Clearly, further research elucidating the exact mechanisms of miRNA-302 function is warranted.Our observations that overexpression of miRNA-302a in colon cancer cells induced cell growth inhibition in vitro and in vivo suggest that miRNA-302a might post-transcriptionally regulate a pivotal gene that is involved in cell proliferation. As an important oncogene, AKT influences a wide range of physiological functions, including metabolism, proliferation, survival, angiogenesis, migration, and invasion [16]. Our results indicate that miRNA-302a suppressed the proliferation and tumorigenicity of colon cancer cells through the AKT-GSK3β-cyclin D1 pathway, and by directly binding the 3′UTR of AKT. Furthermore, the expression of PI3K and PTEN, which are principal upstream effectors of AKT and have also proven important in colon cancer development, were not affected by miRNA-302. The regulatory role of miRNA-302 in AKT was also demonstrated by Cai et al: after miRNA-302s transfection into cervical cancer cells, they observed elevated expression of cyclin-dependent kinase inhibitors p27Kip1 and p21Cip1, along with downregulated AKT levels [10]. Hence, as a target of miRNA-302, AKT was notably suppressed and evoked alterations in many downstream signaling pathways.Our findings also give certain clues with respect to miRNAs-targeted cancer treatment. Previous studies revealed that some specific miRNAs were often overexpressed in tumors, while most miRNAs were.Downregulated [17], [18]. Global miRNA suppression was found to boost carcinogenesis in both in vitro and in vivo models [19], highlighting the pro tumorigenic effects following miRNA loss-of-function. Liang et al. observed a sensitizing role of miRNA-302 replacement therapy in breast cancer cells to ionizing radiation [20]. Another recent study reported that viral delivery of let-7 miRNA could inhibit tumor growth in a mouselung adenocarcinoma model [21]. Likewise, our results validated the inhibitory effect of miRNA-302a replacement in colon cancer cells. Taken together, these studies suggest that overexpression of even a single miRNA in cancer cells might confer substantial therapeutic benefit.In summary, our study demonstrates that miRNA-302a is pivotal for colon cancer cell growth by regulating G1-S phase transition. MiRNA-302a expression is suppressed in colon cancer tissues. Additionally, through direct binding to its 3′UTR, miRNA-302a inhibits AKT expression, resulting in subsequent alterations in AKT-GSK3β-cyclin D1 pathways. Although it is clear that miRNA-302a participates in colon cancer, further studies are required to explain the precise mechanisms underlying its role in colon cancer progression, and thus determine its potential value as a biomarker and/or a therapeutic target.
Authors: M Fareh; L Turchi; V Virolle; D Debruyne; F Almairac; S de-la-Forest Divonne; P Paquis; O Preynat-Seauve; K-H Krause; H Chneiweiss; T Virolle Journal: Cell Death Differ Date: 2011-07-01 Impact factor: 15.828
Authors: Aurora Esquela-Kerscher; Phong Trang; Jason F Wiggins; Lubna Patrawala; Angie Cheng; Lance Ford; Joanne B Weidhaas; David Brown; Andreas G Bader; Frank J Slack Journal: Cell Cycle Date: 2008-03-03 Impact factor: 4.534