| Literature DB >> 25538559 |
Greig Joilin1, Diane Guévremont1, Brigid Ryan1, Charles Claudianos2, Alexandre S Cristino2, Wickliffe C Abraham3, Joanna M Williams1.
Abstract
Coordinated regulation of gene expression is essential for consolidation of the memory mechanism, long-term potentiation (LTP). Triggering of LTP by N-methyl-D-aspartate receptor (NMDAR) activation rapidly activates constitutive and inducible transcription factors, which promote expression of genes responsible for LTP maintenance. As microRNA (miRNA) coordinate expression of genes related through seed sites, we hypothesize that miRNA contribute to the regulation of the LTP-induced gene response. MiRNA function primarily as negative regulators of gene expression. As LTP induction promotes a generalized rapid up-regulation of gene expression, we predicted a complementary rapid down-regulation of miRNA levels. Accordingly, we carried out global miRNA expression profiling in the rat dentate gyrus 20 min post-LTP induction in vivo. Consistent with our hypothesis, we found a large number of differentially expressed miRNA, the majority down-regulated. Detailed analysis of miR-34a-5p and miR-132-3p revealed this down-regulation was transient and NMDAR-dependent, whereby block of NMDARs released an activity-associated inhibitory mechanism. Furthermore, down-regulation of mature miR-34a-5p and miR-132-3p occurred solely by post-transcriptional mechanisms, occurring despite an associated up-regulation of the pri-miR-132 transcript. To understand how down-regulation of miR-34a-5p and miR-132-3p intersects with the molecular events occurring following LTP, we used bioinformatics to identify potential targets. Previously validated targets included the key LTP-regulated genes Arc and glutamate receptor subunits. Predicted targets included the LTP-linked kinase, Mapk1, and neuropil-associated transcripts Hn1 and Klhl11, which were validated using luciferase reporter assays. Furthermore, we found that the level of p42-Mapk1, the protein encoded by the Mapk1 transcript, was up-regulated following LTP. Together, these data support the interpretation that miRNA, in particular miR-34a-5p and miR-132-3p, make a surprisingly rapid contribution to synaptic plasticity via dis-inhibition of translation of key plasticity-related molecules.Entities:
Keywords: long-term potentiation; maintenance; memory; microRNA; synaptic plasticity
Year: 2014 PMID: 25538559 PMCID: PMC4260481 DOI: 10.3389/fnmol.2014.00098
Source DB: PubMed Journal: Front Mol Neurosci ISSN: 1662-5099 Impact factor: 5.639
Oligonucleotides including exact match, target and mutated sequences of rno-miR-132-3p MRE that were cloned into the ψCheck-2 vector.
| Name of Insert | Sequence |
|---|---|
| miR-132-3p Perfect Match | CAGTGACTCTCGAGCAG |
| CAGTGACTCTCGAGCAG | |
| CAGTGACTCTCGAGCAG | |
| CAGTGACTCTCGAGCAG | |
| CAGTGACTCTCGAGCAG | |
| CAGTGACTCTCGAGCAGATGAGGAGCAAGGCAAATATATCAATTGACGCGGCCGCCAGTGACT | |
| CAGTGACTCTCGAGCAGGTACTTCTTAGTCCTGAAATATTGCTGACGCGGCCGCCAGTGACT | |
| CAGTGACTCTCGAGCAGGGCTGGAGATCCTTGAAATATTACTGACGCGGCCGCCAGTGACT | |
| CAGTGACTCTCGAGCAGACTTACTGTGCTATTGCATAAATATTAAGGACGCGGCCGCCAGTGACT | |
| rno-miR-132 mimic | UAACAGUCUACAGCCAUGGUCG |
| cel-miR-239b Negative Control | UUGUACUACACAAAAGUACUG |
Experimentally validated miRNA-target interactions for miR-34a-5p and miR-132-3p.
| MiRNA | Gene symbol | Gene name | Reference | Prediction algorithm |
|---|---|---|---|---|
| miR-34a-5p | Activity related cytoskeletal protein | miRanda | ||
| Calpain 8 | miRanda, miRDB | |||
| E2F transcription factor 3 | PicTar, TargetScan | |||
| Glutamate receptor, metabotropic 7 | PicTar, TargetScan | |||
| V-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) | miRanda, TargetScan, miRDB, miRWalk | |||
| Notch 1 | PicTar, TargetScan, miRDB | |||
| Sirtuin 1 | PicTar | |||
| Syntaxin 1A | ||||
| Synapsin I | ||||
| Synaptotagmin I | ||||
| Transgelin | ||||
| miR-132-3p | Calpain 8 | miRanda | ||
| Glutamate receptor, ionotropic, AMPA 1 | ||||
| Methyl CpG binding protein 2 (Rett syndrome) | PicTar, TargetScan | |||
| Matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) | miRanda | |||
| Glutamate receptor, ionotropic, | ||||
| Glutamate receptor, ionotropic, | ||||
| Rho GTPase activating protein 32 | PicTar |