OBJECTIVE: To identify clinical, laboratorial and radiographic predictors for Bordetella pertussis infection. METHODS: This was a retrospective study, which analyzed medical records of all patients submitted to a molecular diagnosis (qPCR) for B. pertussis from September 2011 to January 2013. Clinical and laboratorial data were reviewed, including information about age, sex, signs/symptoms, length of hospitalization, blood cell counts, imaging findings, coinfection with other respiratory pathogens and clinical outcome. RESULTS: 222 cases were revised. Of these, 72.5% had proven pertussis, and 60.9% were under 1 year old. In patients aging up to six months, independent predictors for B. pertussis infection were cyanosis (OR 8.0, CI 95% 1.8-36.3; p=0.007) and lymphocyte count >10(4)/μL (OR 10.0, CI 95% 1.8-54.5; p=0.008). No independent predictors of B. pertussis infection could be determined for patients older than six months. Co-infection was found in 21.4% of patients, of which 72.7% were up to six months of age. Adenovirus was the most common agent (40.9%). In these patients, we were not able to identify any clinical features to detect patients presenting with a respiratory co-infection, even though longer hospital stay was observed in patients with co-infections (12 vs. 6 days; p=0.009). CONCLUSIONS: Cyanosis and lymphocytosis are independent predictors for pertussis in children up to 6 months old.
OBJECTIVE: To identify clinical, laboratorial and radiographic predictors for Bordetella pertussis infection. METHODS: This was a retrospective study, which analyzed medical records of all patients submitted to a molecular diagnosis (qPCR) for B. pertussis from September 2011 to January 2013. Clinical and laboratorial data were reviewed, including information about age, sex, signs/symptoms, length of hospitalization, blood cell counts, imaging findings, coinfection with other respiratory pathogens and clinical outcome. RESULTS: 222 cases were revised. Of these, 72.5% had proven pertussis, and 60.9% were under 1 year old. In patients aging up to six months, independent predictors for B. pertussis infection were cyanosis (OR 8.0, CI 95% 1.8-36.3; p=0.007) and lymphocyte count >10(4)/μL (OR 10.0, CI 95% 1.8-54.5; p=0.008). No independent predictors of B. pertussis infection could be determined for patients older than six months. Co-infection was found in 21.4% of patients, of which 72.7% were up to six months of age. Adenovirus was the most common agent (40.9%). In these patients, we were not able to identify any clinical features to detect patients presenting with a respiratory co-infection, even though longer hospital stay was observed in patients with co-infections (12 vs. 6 days; p=0.009). CONCLUSIONS:Cyanosis and lymphocytosis are independent predictors for pertussis in children up to 6 months old.
Pertussis or whooping cough is an acute respiratory tract infection caused by
Bordettella pertussis and ranked among the 10 leading causes of
childhood mortality.1 An increasing number of
pertussis outbreaks have been reported in the last years despite vaccination coverage.
Indeed, in the last decades, the age range of affected individuals appears to have
widened and the incidence of pertussis in adolescents and adults has raised.2
-
5 It is essential the prompt recognition of
patients with this condition, because a delay in diagnosis could result in late onset of
antibiotic treatment subsequently increasing the potential for secondary
transmission.6 However, clinical diagnosis of
whooping cough is difficult to perform, once clinical manifestations can vary according
to immunization status, patient's age and the disease stages.3
,
5
,
7
-
8Previous studies have evaluated the impact of concomitant detection of B.
pertussis with other respiratory agents9
-
10, suggesting that B. pertussis
infection could be more severe in this context.11
-
13 Mixed respiratory infections have been
reported in children in several countries,14 but
its actual incidence is believed to be even higher.12
-
13The purpose of this study was to describe the clinical profile of patients with
suspected B. pertussis infection, and to identify the clinical,
laboratorial and radiographic predictors for B. pertussis infection. We
also aimed to determine the frequency of concomitant respiratory tract infections in
this population, as well as to determine if co-infections were associated with greater
morbidity and/or mortality in patients with B. pertussis infection.
Methods
This was a retrospective case series study performed at Santa Casa de Misericórdia de
Porto Alegre, Brazil, from September 2011 to January 2013. We studied patients with
suspected B. pertussis infection for whom a molecular diagnosis was
performed at Molecular Biology Laboratory at Santa Casa. We included hospitalized
patients, and patients with suspected infection that attended the emergency room or
physician's office in the hospital. All patients who were tested for pertussis by real
time polymerase chain reaction (qPCR) in the study period, regardless of age, were
studied. Clinical samples consisted of nasopharyngeal aspirates collected by hospital's
nursing team. Clinical and laboratorial data were extracted by a standardized clinical
form, including information about age, sex, signs/symptoms, length of hospitalization,
blood cells count, chest imaging findings, concomitant detection of other respiratory
pathogens and clinical outcome. This study was approved by the local Ethic Committee (n.
115333), and all researchers signed a commitment statement to use patient's records,
ensuring the confidentiality of this work.The in house qPCR test used in this study has been available in the institution since
2011. In summary, DNA was extracted with QIAamp DNA Mini Kit (Qiagen) and stored at
-80ºC. qPCR was performed using Platinum(r) SYBR(r) Green qPCR SuperMix-UDG
(Invitrogen(tm)). Primers (0.2uM each) were ACGCAGTGGCCTACTACCAG and
GCGGTAAGGTCGGGTAAAG. All reactions included a positive control (DNA extracted from
Fiocruz ATCC strain), a negative control and an internal control (HuPO), in 25ul
reactions. The qPCR conditions were 2 min at 50ºC, 5 min at 95ºC, 45 cycles of 15 sec at
95ºC and 30 sec at 60ºC, followed by 15 sec at 95ºC, 1 min at 60ºC, 30 sec at 95ºC, and
15 sec at 60ºC. A positive qPCR test was assumed as a confirmatory test for pertussis,
while a negative qPCR was considered as absence of the disease.Statistical analyzes were performed by SPSS software (version 17.0). Patients with
positive and negative qPCR results for B. pertussis were compared.
Chi-squared test was used for categorical variables and the Mann-Whitney test was
applied for continuous data. Significance was determined at α<0.05. Multivariate
analysis was performed in order to identify independent predictors for B.
pertussis infection.
Results
Medical records of 222 patients with suspected B. pertussis infection
were reviewed. Among these, qPCR confirmed B. pertussis infection in
161 (72.5%) patients. The great majority was tested by qPCR only. Four patients were
also submitted (and tested negative) to additional diagnostic test, including serology
and culture. Among positive qPCR cases, 60.9% were younger than 1 year, and 52.8% were
boys. Table 1 shows the age distribution
according to qPCR results. The most common clinical manifestations were cough (100%),
cyanosis (59.6%), plethora (49.7%), posttussive vomiting (37.9%), fever (34.2%),
respiratory effort (36%) and whoop (15.5%). Most of patients with cyanosis were up to
one year (81.3%), but this sign was also observed in older children and adolescents up
to 13 years old. The median time interval between the beginning of symptoms and the
sample submission for qPCR testing was 15 days (range, 1-60 days), versus 19 days in
qPCR negative group (p=0.49). In the positive qPCR patients, the main
alteration on chest X-ray was diffuse infiltrate (58.3%), followed by hyperinflated
lungs (22.8%) and atelectasis (16.5%). Mean [range] blood cells (% where indicated) for
patients with B. pertussis infection were as follows: 21,607 [6,470-99,700] (white blood
cells); 11,515 [367-43,908] (lymphocytes); 53.6% [5.5-78.0%] (percentage of
lymphocytes); and 503,205 [150,000-946,000] (platelets). Overall mortality in patients
with B. pertussis infection was 2.5%; all occurring in patients 3
months of age or younger. Comparisons of the clinical and laboratorial data of patients
with positive and negative qPCR results for pertussis are presented in Table 2.
Table 1
Age distribution and qPCR results in patients with suspected pertussis
infection.
Table 2
C Clinical and laboratorial data of patients with positive and negative
pertussis qPCR.
From all of our patients, 164 were hospitalized (73.8%). Hospitalization rate in age up
to 6 months was 94% (versus 56.6% of patients older than 6 months;
p<0.001). Besides age, laboratorial features were also predictors
of hospitalization in pertussis: lymphocytosis (p=0.001), leukocytosis
(p=0.001) and thrombocytosis (p<0.001). There
was no statistic significant difference between these groups (hospitalized vs.
outpatient) in relation to qPCR result (75.1% in qPCR+ vs. 70.4% in qPCR-;
p=0.4) and presence of co-infections (95% in coinfected vs. 91.3% in
no coinfected p=0.5).Immunization data was reported only in 54.5% of cases. Data available showed that 62% of
positive and 31% of negative cases had received any or only one dose of the vaccine
against B. pertussis, while only 6.5% of positive cases (versus 20.7%
of negative cases) had complete immunization [in Brazil, this consists in 3 doses and 2
boosters of the vaccine]. Despite this percentage contrast, there was no statistic
significant difference between the groups (p=0.068). Immunization
received according to age group is demonstrated in Table 3.
Table 3
Vaccine doses received distributed by age.
We divided patients in two different groups: children aged 6 months or younger and
patients older than 6 months. Predictors of B. pertussis infection at
univariate analysis for patients aged 6 months or younger were cyanosis (OR 5.32, CI 95%
1.79-15.8; p=0.001), plethora (OR 4.49, CI 95% 1.54-13.1;
p=0.004), leukocyte count (p=0.031), lymphocyte
count (p<0.0001), and percentage of lymphocytes
(p=0.002). At multivariate analysis, cyanosis (OR 8.0, CI 95% 1.8-36.3;
p=0.007) and lymphocyte count >104/µL (OR 10.0, CI 95%
1.8-54.5; p=0.008) were independent predictors for pertussis in
children younger than 6 months of age. The only variables associated with pertussis for
patients aged more than 6 months at univariate analysis were leukocyte count
(p=0.019) and lymphocyte count (p=0.018).
Atelectasis was associated with the presence of diagnoses other than pertussis (OR 0.2,
CI 95% 0.07-0.88; p=0.024), in this group of patients. At multivariate
analysis, no variable was associated with pertussis in patients older than 6 months of
age.A total of 103 patients with confirmed B. pertussis infection were also
tested for other respiratory pathogens [also detected by in house qPCR
or bacterial culture]. Co-detection was found in 21.4% of these patients, 72.7% of whom
were 6 months of age or younger, 13.6% were older than 6 months but younger than 1 year,
and 13.6% were between 1 and 4 years old. Fig. 1
displays the frequency of co-detection of other respiratory pathogens in patients with
pertussis. There was no statistically significant difference between age and pathogens
distribution (p=0.71). Patients with co-detection of pertussis and
other respiratory pathogens had prolonged stay in the hospital (12 vs. 6 days;
p=0.009) and more atelectasis on chest X-ray (38.1% vs. 16.7%; OR
3.3, CI 95% 1.1-9.5; p=0.023).
Figure 1
Frequency of codetection of other respiratory pathogens in patients with
Bordetella pertussis infection
Discussion
In this work, we reviewed the clinical charts of 222 patients suspected of B.
pertussis infection. Of these, the diagnosis of pertussis was confirmed in
72.5% by the means of qPCR. Considering that only four patients were also submitted to
another diagnostic test for comparison (serology or culture), we assumed that negative
qPCR indicated absence of the disease. Even though, all patients were in a similar
moment of disease by the time of molecular diagnosis.As expected, most of these children were aged 1 year of age or less (60.9%), which is in
accordance with previous data that reported rates between 50% and 64.6% in this age
group.15
-
16 Recently, it was reported a significant
increase in the incidence of pertussis in adolescents and adults.2
-
3 However, in this study, few individuals with
positive qPCR were older than 15 years (1.8%). This fact could be justified by the
heterogeneity in the clinical manifestations of pertussis, in association with a low
index of suspicion among clinicians for such condition in adults.3
,
17
-
20It is well known that pertussis may present different manifestations according to
patients' age, among children.3
,
5
,
8
,
21
-
22 In this work, we stratified patients in two
separated groups: children aged 6 months or less and patients older than 6 months. Our
results suggest that classical manifestations of pertussis vary according to patients'
age and presumably to the number of vaccine doses against B. pertussis
they receive. For instance, in younger children (i.e., <6 months of age), pertussis
was associated with the presence of cyanosis, plethora, leukocyte count, lymphocyte
count and lymphocytes percentage. Multivariate analysis showed that cyanosis and
lymphocyte count were able to predict pertussis in this patient group. On the other
hand, older patients (i.e., >6 months of age) presented with less classical symptoms
of pertussis, and no variable could be independently associated with pertussis. This is
similar to previously reported data, showing that patients who were immunized against
pertussis may develop the disease with atypical presentations.5
,
6
,
18
-
20 The most common typical finding, which appears
to be present in all age groups, is prolonged cough.7
,
18
-
19Cyanosis is already known as a pertussis classic symptom,2
,
8 and leukocytosis attributable to lymphocytosis
is also recognized as a hallmark of pertussis.7
,
23
-
25 In this study, lymphocytosis was not only a
hallmark, but also was an independent predictor for B. pertussis
infection in young infants. The cutoff point (104/µL) was similar with those
found in previous studies.24
,
25 These data suggest that the occurrence of
cyanosis should increase the pediatrician´s suspicion of B. pertussis
infection, particularly in the presence of lymphocytosis in a young child.Co-detection of B. pertussis with other respiratory agents has already
been reported,12
,
22
,
26
-
29 and it may be actually underestimated.12
-
13 It was reported that pertussis toxin may
suppress innate immune response and sensitize the host to a secondary respiratory
pathogen.13 In our study, we found an
incidence of 21.4% of mixed infections; the most frequent pathogens associated with
B. pertussis were adenovirus, RSV and parainfluenza type 3 virus.
These viruses (especially RSV) were also prevalent in some previous reports.22
,
26
-
29 The evaluation of laboratorial data of infants
up to 6 months showed that lymphocyte percentage is significant different (and higher)
among patients with respiratory pathogens co-detection and patients with only pertussis
identification. Previous studies related mixed infection with higher severity of the
disease.11
-
13 In this work, patients with co-detection
pathogens had a longer period of hospitalization, reinforcing the relationship between
mixed infection and a more severe disease. On the other hand, as reported in other
works, we did not reliably distinguish clinical features of infants with mixed infection
from those with only pertussis detection.11
-
12
,
22
,
26
-
27 Furthermore, it is important to note that less
than 50% of our patients were tested to other patogens, and these results must be seen
with caution.This study has some limitations that should be mentioned. In view of its retrospective
design and the samples were obtained by convenience, some data were missing at analysis,
particularly those related to immunization history, clinical and laboratorial exams, and
co-infection tests. Despite that were to study a large number of patients, and for most
of the other variables data missing was minimal. Another limitation is related to the
limited number of adult patients included in the study - therefore, our conclusion
cannot be extrapolated to this patient group.An increasing number of pertussis outbreaks have been reported despite vaccination
coverage.2
-
5 It is unclear the factor that contribute to
pertussis resurgence, but waning immunity, improved surveillence and diagnosis, as well
as adaptation of circulating Bordetella pertussis strains could be involved.5 Even though, the most important and effective way
to control pertussis remains vaccination.5
Ensuring wider immunization coverage, as well as developing newer strategies to avoid
waning immunity after pertussis vaccination and disease - as booster vaccines in
adolescents and adults - is something highly desirable.2
,
4
,
5B. pertussis infection is a common disease affecting all ages.
Clinicians should be aware of this condition and perform a prompt diagnosis and initiate
an early treatment, avoiding secondary transmission of the disease. This work showed
that young children may manifest clinical and laboratorial features that may help the
clinician to suspect the presence of pertussis. Although children with 6 months or more
and adults may present with atypical manifestations of pertussis, the diagnosis must be
always considered in these patients, in the presence of prolonged cough.
Introdução
Pertussis ou coqueluche é uma infecção aguda do trato respiratório causada porBordetella pertussis, e classificada entre as 10 principais
causas de mortalidade infantil.1 Um número
crescente de surtos de coqueluche foi relatado nos últimos anos, apesar da cobertura
vacinal. De fato, nas últimas décadas, a faixa etária dos indivíduos afetados parece
ter sido ampliada, e a incidência de coqueluche em adolescentes e adultos tem
aumentado.2
-
5 É essencial o reconhecimento imediato dos
pacientes com essa condição, pois a demora no diagnóstico pode resultar em início
tardio do tratamento antibiótico, posteriormente aumentando o potencial de
transmissão secundária.6 No entanto, o
diagnóstico clínico de coqueluche é de difícil execução, já que as manifestações
clínicas podem variar de acordo com o estado de imunização, idade do paciente e as
fases da doença.3
,
5
,
7
-
8Estudos anteriores já haviam avaliado o impacto da detecção concomitante de
B. pertussis com outros agentes respiratórios,9
-
10 sugerindo que a infecção por B.
pertussis pode ser mais grave nesse contexto.11
-
13 Infecções respiratórias mistas foram
relatadas em crianças em vários países,14 mas
acredita-se que sua verdadeira incidência seja ainda maior.12
-
13O objetivo desse estudo foi descrever o perfil clínico de pacientes com suspeita de
infecção porB. pertussis, e identificar os preditores clínicos,
laboratoriais e radiográficos para a infecção porB. pertussis.
Também tivemos como objetivo determinar a frequência de infecções concomitantes do
trato respiratório nessa população, bem como determinar se coinfecções estavam
associadas a maior morbidade e/ou mortalidade em pacientes com infecção porB. pertussis.
Métodos
Estudo retrospectivo de série de casos realizado na Santa Casa de Misericórdia de
Porto Alegre, Brasil, de setembro de 2011 a janeiro de 2013. Estudamos pacientes com
suspeita de infecção porB. pertussis submetidos a diagnóstico
molecular realizado no Laboratório de Biologia Molecular da Santa Casa. Foram
incluídos pacientes internados e pacientes com suspeita de infecção que buscaram
atendimento no pronto-socorro ou em consultório médico no hospital.Todos os pacientes que foram testados para coqueluchepor reação da polimerase em
cadeia em tempo real (PCRq) durante o período de estudo, independente da idade, foram
estudados. Analisamos material de secreção nasofaríngea coletados pela equipe de
enfermagem do hospital. Os dados clínicos e laboratoriais foram extraídos em um
formulário clínico padronizado, incluindo informações sobre idade, sexo,
sinais/sintomas, tempo de internação, hemograma, exames de imagem do tórax, detecção
concomitante de outros patógenos respiratórios e evolução clínica. Esse estudo foi
aprovado pelo Comitê de Ética da instituição (no. 115333), e todos os
pesquisadores assinaram um termo de compromisso para utilizar o prontuário do
paciente, garantindo a confidencialidade desse estudo.O teste de PCRq in-house utilizado nesse estudo está disponível na instituição desde
2011. Em resumo, o DNA foi extraído com QIAamp DNA Mini Kit (Qiagen,
Califórnia, Estados Unidos) e armazenado a -80°C. qPCR foi realizada utilizando
Platinum(r) SYBR(r) Green qPCR SuperMix-UDG (Invitrogen(tm), Life
Technologies, Nova York, Estados Unidos). Primers (0.2 uM cada)
foram ACGCAGTGGCCTACTACCAG e GCGGTAAGGTCGGGTAAAG. Todas as reações incluíam um
controle positivo (DNA extraído de cepa ATCC gentilmente cedida pela Fiocruz),
controle negativo e um controle interno (HuPO), em reações de 25 ul. As condições da
qPCR foram 2 minutos a 50°C, 5 minutos a 95°C, 45 ciclos de 15 segundos a 95°C e 30
segundos a 60°C, seguidos de 15 segundos a 95°C, 1 minuto a 60°C, 30 segundos a 95°C
e 15 segundos a 60°C. Um teste positivo de PCRq foi considerado um teste
confirmatório para a coqueluche, enquanto um PCRq negativo foi considerado como a
ausência da doença.As análises estatísticas foram realizadas utilizando-se o software SPSS, versão 17
(SPSS Statistics for Windows, Chicago, Estados Unidos). Os
pacientes com resultados positivos e negativos de PCRq para B.
pertussis foram comparados. O teste do qui-quadrado foi utilizado para
variáveis categóricas, e o teste de Mann-Whitney foi utilizado para dados
contínuos. A significância foi estabelecida em α<0,05. A análise multivariada foi
realizada para identificar preditores independentes para a infecção por B.
pertussis.
Resultados
Os registros médicos de 222 pacientes com suspeita de infecção por B.
pertussis foram revisados. Entre esses, PCRq confirmou infecção porB. pertussis em 161 (72,5%) pacientes. A maioria foi testada
apenas por PCRq. Quatro pacientes foram submetidos (com resultado negativo) a teste
diagnóstico adicional, incluindo sorologia e cultura. Entre os casos positivos de
PCRq, 60,9% tinham menos de 1 ano de idade, e 52,8% eram do sexo masculino. A tabela 1 mostra a distribuição etária de acordo
com resultados de PCRq. As manifestações clínicas mais comuns foram tosse (100%),
cianose (59,6%), pletora (49,7%), vômitos pós-tosse (37,9%), febre (34,2%), esforço
respiratório (36%) e tosse convulsa (15,5%).
Tabela 1
Distribuição etária e resultados da qPCR em pacientes com suspeita de
infecção por pertussis
A maioria dos pacientes com cianose tinha até um ano de idade (81,3%), mas esse
sintoma também foi observado em crianças mais velhas e adolescentes de até 13 anos. O
tempo de intervalo mediano entre o início dos sintomas e o envio das amostras para
testes de PCRq foi de 15 dias (variação de 1-60 dias), contra 19 dias no grupo PCRq
negativo (p=0,49). Nos pacientes PCRq positivos, a principal
alteração na radiografia de tórax foi infiltrado difuso (58,3%), seguido por pulmões
hiperaerados (22,8%) e atelectasia (16,5%). As médias [variação] de células
sanguíneas (% quando indicadas) foram as seguintes: 21.607 [6.470-99.700] (células
brancas do sangue); [11.515] 367-43.908 (linfócitos); 53,6% [5,5-78,0%] (porcentagem
de linfócitos); e 503.205 [150,000-946,000] (plaquetas).A mortalidade geral em pacientes com infecção porB. pertussis foi
de 2,5%; todos tinham 3 meses de idade ou menos. A comparação dos dados clínicos e
laboratoriais de pacientes com resultados positivos e negativos de PCRq para
coqueluche é apresentada na tabela 2.
Tabela 2
Dados clínicos e laboratoriais de pacientes com resultados positivo e
negativo de qPCR para pertussis
Do total de pacientes, 164 foram hospitalizados (73,8%). A taxa de hospitalização em
idade até 6 meses foi de 94% (contra 56,6% em pacientes com mais de 6 meses;
p<0,001). Além da idade, características laboratoriais também
foram preditoras de hospitalização em coqueluche: linfocitose
(p=0,001), leucocitose (p=0,001) e trombocitose
(p<0,001). Não houve diferença estatisticamente significante
entre os grupos (hospitalizado vs. ambulatorial) em relação ao resultado da PCRq
(75,1% em PCRq+ vs. 70,4% em PCRq-, p=0,4) e
presença de coinfecções (95% em coinfectados vs. 91,3% em não
coinfectados, p=0,5).Dados de imunização foram relatados em apenas 54,5% dos casos. Os dados disponíveis
mostram que 62% dos casos positivos e 31% dos negativos receberam nenhuma ou apenas
uma dose da vacina contra a B. pertussis, enquanto apenas 6,5% dos
casos positivos (contra 20,7% dos casos negativos) tiveram a imunização completa no
Brasil, isso consiste em 3 doses e 2 reforços da vacina. Apesar desse contraste de
porcentagens, não houve diferença estatisticamente significativa entre os grupos
(p=0,068). A imunização recebida de acordo com a faixa etária é
mostrada na tabela 3.
Tabela 3
Doses de vacina recebidas distribuídas por idade
Os pacientes foram divididos em dois grupos: crianças de até 6 meses, e pacientes com
mais de 6 meses. Preditores de infecção porB. pertussis na análise
univariada para pacientes com idade até 6 meses foram cianose (OR: 5,32, IC 95%:
1,79-15,8, p=0,001), pletora (OR: 4,49, IC 95%: 1,54-13,1,
p=0,004), contagem de leucócitos (p=0,031),
contagem de linfócitos (p<0,0001), e a porcentagem de linfócitos
(p=0,002).Na análise multivariada, cianose (OR: 8,0, IC 95%: 1,8-36,3,
p=0,007) e contagem de linfócitos >104/mL (OR: 10,0,
IC 95%: 1,8-54,5, p=0,008) foram preditores independentes para
coqueluche em crianças menores de 6 meses de idade. As únicas variáveis associadas
à coqueluche em pacientes com idade superior a 6 meses na análise univariada foram
contagem de leucócitos (p=0,019) e contagem de linfócitos
(p=0,018). A presença de atelectasia foi associada à presença de
outros diagnósticos diferentes de coqueluche (OR: 0,2, IC 95%: 0,07-0,88,
p=0,024) nesse grupo de pacientes. Na análise multivariada,
nenhuma variável estava associada à coqueluche em pacientes com mais de 6 meses de
idade.Um total de 103 pacientes com infecção porB. pertussis confirmada
também foram testados para outros patógenos respiratórios. Co-detecção foi encontrada
em 21,4% desses pacientes, dos quais 72,7% tinham 6 meses de idade ou menos, 13,6%
tinham idade superior a 6 meses, mas menos de 1 ano, e 13,6% tinham entre 1 e 4 anos
de idade. A figura 1 mostra a frequência de
codetecção de outros patógenos respiratórios em pacientes com coqueluche. Não houve
diferença estatisticamente significativa entre a idade e a distribuição de patógenos
(p=0,71). Pacientes com co-detecção de coqueluche e outros
patógenos respiratórios apresentaram maior tempo de internação hospitalar (12
vs. 6 dias; p=0,009) e mais atelectasia na
radiografia de tórax (38,1% vs. 16,7%; OR: 3,3, IC 95%: 1,1-9,5,
p=0,023).
Figura 1
Frequência de codetecção de outros patógenos respiratórios em pacientes
com infecção por Bordetella pertussis.
Discussão
Nesse trabalho, analisamos os prontuários de 222 pacientes com suspeita de infecção
porB. pertussis. Desses, o diagnóstico de coqueluche foi confirmado
em 72,5% por meio de PCRq. Considerando que apenas quatro pacientes também foram
submetidos a outro teste diagnóstico para comparação (sorologia ou cultura),
concluímos que um resultado negativo da PCRq indica ausência da doença. Entretanto,
todos os pacientes estavam em um momento semelhante da doença quando foi realizado o
diagnóstico molecular.Como esperado, a maioria dessas crianças tinha um ano de idade ou menos (60,9%), o
que está de acordo com dados anteriores que relataram taxas entre 50% e 64,6% nessa
faixa etária.15
-
16 Recentemente, foi relatado um aumento
significativo na incidência de coqueluche em adolescentes e adultos.2-3 Entretanto,
nesse estudo, poucos indivíduos com PCRq positivo tinham mais de 15 anos de idade
(1,8%). Esse fato pode ser justificado pela heterogeneidade nas manifestações
clínicas da coqueluche, em associação a um baixo índice de suspeita entre os médicos
para tal condição em pacientes adultos.3
,
17
-
20É um fato bem conhecido que a coqueluche pode apresentar diferentes manifestações de
acordo com a idade do paciente, quando na faixa etária pediátrica.3
,
5
,
8
,
21
-
22 Nesse trabalho, estratificamos os pacientes
em dois grupos distintos: crianças de 6 meses de idade ou menos, e pacientes com mais
de 6 meses. Nossos resultados sugerem que as manifestações clássicas da coqueluche
variam de acordo com a idade dos pacientes e, presumivelmente, de acordo com o número
de doses de vacina contra B. pertussis que receberam. Por exemplo,
em crianças mais jovens (ou seja, ≤6 meses de idade), coqueluche estava associada à
presença de cianose, pletora, contagem de leucócitos, contagem de linfócitos e
porcentagem de linfócitos. A análise multivariada mostrou que cianose e a contagem de
linfócitos eram capazes de prever a presença de coqueluche nesse grupo de pacientes.Por outro lado, pacientes mais velhos (ou seja, idade >6 meses) apresentaram menos
sintomas clássicos da coqueluche, e nenhuma variável pode ser associada de forma
independente à coqueluche. Esses dados são semelhantes aos dados relatados
anteriormente, mostrando que os pacientes que foram imunizados contra a coqueluche
podem desenvolver a doença com apresentações atípicas.5
,
6
,
18
-
20 O achado típico mais comum, que parece
estar presente em todas as faixas etárias, é a tosse prolongada.7
,
18
-
19Sabe-se que a cianose é um dos sintomas clássicos da coqueluche,2
,
8 e a leucocitose atribuível à linfocitose
também é reconhecida como uma característica de coqueluche.7
,
23
-
25 Nesse estudo, a linfocitose não foi apenas
uma característica, mas também um preditor independente para a infecção porB. pertussis em lactentes jovens. O ponto de corte
(104/μL) foi semelhante aos encontrados em estudos anteriores.24
,
25 Esses dados sugerem que a ocorrência de
cianose deve aumentar a suspeita do pediatra de infecção por B.
pertussis, particularmente na presença de linfocitose em uma criança
pequena.A co-detecção de B. pertussis com outros agentes respiratórios já
foi relatada anteriormente,12
,
22
,
26
-
29 e pode ser na verdade subestimada.12
-
13 Foi relatado que a toxina da coqueluche
pode suprimir a resposta imune inata e sensibilizar o hospedeiro a um patógeno
respiratório secundário.13 Em nosso estudo,
encontramos uma incidência de 21,4% de infecções mistas; os patógenos mais frequentes
associados a B. pertussis foram adenovírus, VRS, e vírus da
Parainfluenza tipo 3. Esses vírus (especialmente VRS) também foram encontrados em
alguns estudos anteriores.22
,
26
-
29A avaliação de dados laboratoriais de lactentes de até 6 meses de idade mostrou que a
porcentagem de linfócitos é significativamente diferente (e maior) entre pacientes
com co-detecção de outros patógenos respiratórios e pacientes com identificação
apenas de coqueluche. Estudos anteriores associaram a presença de infecção mista à
maior gravidade da doença.11
-
13 Nesse trabalho, os pacientes com
co-detecção de patógenos apresentaram um maior período de internação hospitalar,
reforçando a associação entre a infecção mista e doença mais grave. Por outro lado,
conforme relatado em outros trabalhos, não pudemos distinguir de forma confiável as
características clínicas de crianças com infecção mista quando comparadas àquelas com
detecção apenas de coqueluche.11
,
12
,
22
,
26
-
27 Além disso, é importante notar que menos de
50% de nossos pacientes foram testados para outros patógenos, e esses resultados
devem ser considerados com cautela.Esse estudo apresenta algumas limitações que devem ser mencionadas. Tendo em vista
seu caráter retrospectivo e o fato de que as amostras foram obtidas por conveniência,
alguns dados estavam faltando na análise, particularmente aqueles relacionados ao
histórico de imunizações, exames clínicos e laboratoriais, e os testes de coinfecção.
Apesar disso, conseguimos estudar um grande número de pacientes e, na maior parte das
outras variáveis, a informação ausente era mínima. Outra limitação foi o pequeno
número de pacientes adultos incluídos no estudo - logo, nossas conclusões não podem
ser extrapoladas para este grupo de pacientes.Um número crescente de surtos de coqueluche foi relatado, apesar da cobertura
vacinal.2
-
5 Não está claro qual é o fator contribuinte
para o ressurgimento da coqueluche, mas o enfraquecimento da imunidade, melhoria do
rastreamento e do diagnóstico, bem como a adaptação de cepas circulantes de
Bordetella pertussis podem estar ser envolvidos.5 Entretanto, a forma mais importante e eficaz
para controlar a coqueluche continua sendo a vacinação.5 Garantir a cobertura vacinal mais ampla, bem como o
desenvolvimento de estratégias mais recentes para evitar o declínio da imunidade após
a vacinação contra coqueluche e a doença - como doses de reforço em adolescentes e
adultos - é algo altamente desejável.2
,
4
,
5A infecção porB. pertussis é uma doença comum que afeta todas as
faixas etárias. Os médicos devem estar cientes dessa condição, realizar o diagnóstico
em tempo hábil e iniciar o tratamento precocemente, evitando a transmissão secundária
da doença. Esse trabalho mostrou que as crianças podem manifestar características
clínicas e laboratoriais que podem auxiliar o médico na suspeita da presença de
coqueluche. Embora as crianças com 6 meses de idade ou mais e adultos possam
apresentar manifestações atípicas da coqueluche, o diagnóstico sempre deve ser
considerado nesses pacientes, na presença de tosse prolongada.
Authors: James D Cherry; Tina Tan; Carl-Heinz Wirsing von König; Kevin D Forsyth; Usa Thisyakorn; David Greenberg; David Johnson; Colin Marchant; Stanley Plotkin Journal: Clin Infect Dis Date: 2012-03-19 Impact factor: 9.079
Authors: I Srugo; D Benilevi; R Madeb; S Shapiro; T Shohat; E Somekh; Y Rimmar; V Gershtein; R Gershtein; E Marva; N Lahat Journal: Emerg Infect Dis Date: 2000 Sep-Oct Impact factor: 6.883