Literature DB >> 25450797

AmgRS-mediated envelope stress-inducible expression of the mexXY multidrug efflux operon of Pseudomonas aeruginosa.

Calvin Ho-Fung Lau1, Thomas Krahn, Christie Gilmour, Erin Mullen, Keith Poole.   

Abstract

AmgRS is an envelope stress-responsive two-component system and aminoglycoside resistance determinant in Pseudomonas aeruginosa that is proposed to protect cells from membrane damage caused by aminoglycoside-generated mistranslated polypeptides. Consistent with this, a ΔamgR strain showed increased aminoglycoside-promoted membrane damage, damage that was largely absent in AmgRS-activated amgS-mutant strains. Intriguingly, one such mutation, V121G, while providing for enhanced resistance to aminoglycosides, rendered P. aeruginosa susceptible to several ribosome-targeting nonaminoglycoside antimicrobials that are inducers and presumed substrates of the MexXY-OprM multidrug efflux system. Surprisingly, the amgSV 121G mutation increased mexXY expression threefold, suggesting that export of these nonaminoglycosides was compromised in the amgSV 121G mutant. Nonetheless, a link was established between AmgRS activation and mexXY expression and this was confirmed in studies showing that aminoglycoside-promoted mexXY expression is dependent on AmgRS. While nonaminoglycosides also induced mexXY expression, this was not AmgRS-dependent, consistent with these agents not generating mistranslated polypeptides and not activating AmgRS. The aminoglycoside inducibility of mexXY was abrogated in a mutant lacking the AmgRS target genes htpX and PA5528, encoding a presumed cytoplasmic membrane-associated protease and a membrane protein of unknown function, respectively. Thus, aminoglycoside induction of mexXY is a response to membrane damage and activation of the AmgRS two-component system.
© 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Entities:  

Keywords:  Efflux; Pseudomonas aeruginosa; envelope stress; multidrug; two-component system

Mesh:

Substances:

Year:  2014        PMID: 25450797      PMCID: PMC4335980          DOI: 10.1002/mbo3.226

Source DB:  PubMed          Journal:  Microbiologyopen        ISSN: 2045-8827            Impact factor:   3.139


Introduction

Pseudomonas aeruginosa is a common nosocomial pathogen (Hidron et al. 2008; Zhanel et al. 2008, 2010) and a major cause of morbidity and mortality in patients with cystic fibrosis (CF) (Govan et al. 2007; de Vrankrijker et al. 2010; Brugha and Davies 2011). Treatment of P. aeruginosa infections is complicated by the microorganism's innate resistance to many antimicrobials, a product of its impressive intrinsic resistome (Olivares et al. 2013), and its access to an array of acquired resistance mechanisms (Breidenstein et al. 2011; Poole 2011). Major contributors to antimicrobial resistance in this organism are multidrug efflux systems of the resistance-nodulation-division (RND) family, including MexAB-OprM, MexCD-OprJ, MexEF-OprN, and MexXY-OprM, which contribute to both intrinsic (MexAB-OprM, MexXY-OprM) and acquired (all) resistance (Poole 2013). MexXY-OprM is somewhat unique in P. aeruginosa in conferring resistance to the aminoglycoside (AG) class of antimicrobials (Sobel et al. 2003; Poole 2005a; Henrichfreise et al. 2007), a class long-used in the management of CF lung infections caused by this microorganism (Prayle and Smyth 2010). While several endogenous AG resistance determinants are present in P. aeruginosa (Schurek et al. 2008; Dötsch et al. 2009; Lee et al. 2009; Krahn et al. 2012), MexXY-OprM is the predominant mechanism of resistance to these agents in CF isolates (Poole 2005a; Henrichfreise et al. 2007; Vettoretti et al. 2009). The MexXY-OprM efflux system is comprised of a cytoplasmic membrane (CM) drug-proton antiporter (MexY), an outer membrane porin (OprM) and a periplasmic membrane fusion protein that joins the membrane-associated components together (MexX) (Aires et al. 1999). The MexX and MexY components are encoded by a single operon under the control of an adjacent repressor gene, mexZ (Aires et al. 1999; Matsuo et al. 2004), while OprM, which functions as the outer membrane component of several multidrug efflux systems in P. aeruginosa (Poole 2005b), is encoded by the 3rd gene of another multidrug efflux operon, mexAB-oprM (Aires et al. 1999; Mine et al. 1999). The mexXY operon is antimicrobial inducible, with only those agents known to target the ribosome able to promote mexXY expression (Masuda et al. 2000a; Jeannot et al. 2005; Morita et al. 2006). Antimicrobial-inducible mexXY expression is compromised by so-called ribosome protection mechanisms (Jeannot et al. 2005), suggesting that the MexXY efflux system is recruited in response to ribosome disruption or defects in translation. Consistent with this, mutations in fmt (encoding a methionyl-tRNA-formyltransferase) (Caughlan et al. 2009), folD (involved in folate biosynthesis and production of the formyl group added to initiator methionine) (Caughlan et al. 2009), and the ribosomal protein genes rplA (Westbrock-Wadman et al. 1999), rplY (El'Garch et al. 2007), and the rplU-rpmA operon (Lau et al. 2012), all of which are expected to negatively impact protein synthesis, increase the expression of mexXY. Upregulation of mexXY by antimicrobials (Morita et al. 2006) or mutations (fmt/folD [Caughlan et al. 2009], rplY [El'Garch et al. 2007] and rplU-rpmA [Lau et al. 2012]) is dependent upon a gene, armZ (formerly known as PA5471), encoding a MexZ-targeting anti-repressor (Yamamoto et al. 2009; Hay et al. 2013). Expression of armZ is also promoted by ribosome-disrupting antimicrobials (Morita et al. 2006) and fmt/folD (Caughlan et al. 2009) or rplU-rpmA (Lau et al. 2012) mutations. Moreover, armZ expression is governed by a transcriptional attenuation mechanism that directly links ribosome/translation disruption and armZ expression, providing a mechanism whereby ribosome perturbation drives MexXY recruitment (Morita et al. 2009). Still, drug-inducible mexXY expression independent of MexZ (Hay et al. 2013) and ArmZ (Muller et al. 2010) has been reported, an indication that additional regulator(s) influence mexXY expression. Indeed, the ParRS two-component system (TCS) implicated in adaptive resistance to cationic antimicrobial peptides, such as the polymyxins (Fernandez et al. 2010), has been linked to ArmZ-independent mexXY expression (Muller et al. 2010), with mutations in the parRS locus driving mexXY expression and AG resistance (Muller et al. 2010; Guenard et al. 2014). Although ArmZ is required for mexXY induction in response to ribosome perturbation, it is insufficient for maximal drug-inducible expression of this efflux operon – armZ/PA5471 hyperexpression from a multicopy plasmid or resultant from a mutation in the armZ leader peptide both provide for much more modest mexXY expression as compared with drug-treated cells (Morita et al. 2006). Presumably, additional downstream effects of ribosome perturbation work in concert with ArmZ to effect/promote mexXY derepression. In the case of AGs, which promote mistranslation (Weisblum and Davies 1968), this may relate to the generation of aberrant polypeptides that damage the CM (Davis et al. 1986; Busse et al. 1992). Interestingly, the AmgRS TCS (Lee et al. 2009) in P. aeruginosa that appears to be operationally similar to the CpxRA envelope stress response TCS in Escherichia coli (Ruiz and Silhavy 2005) has been proposed to control an adaptive response to membrane damage caused by AG-generated aberrant polypeptides (Lee et al. 2009). Contributing to intrinsic AG resistance (Lee et al. 2009) this TCS has also been linked to acquired resistance in both laboratories and clinical AG-resistant strains as a result of gain-of-function “activating” mutations in the amgS gene that encodes the sensor kinase component of this TCS (Lau et al. 2013). In the current study we confirm that AmgRS, indeed, provides protection against AG-promoted membrane damage. We further demonstrate that AmgRS activation via an amgS gain-of-function mutation or AG exposure promotes mexXY expression, and that AmgRS mediates mexXY expression in response to AGs, but not to other inducers of this efflux operon.

Experimental Procedures

Bacterial strains and growth conditions

The bacterial strains and plasmids used in this study are described in Table1. Bacterial cells were cultured in Luria broth (L-broth) and on Luria agar (L-agar), with antibiotics as necessary, at 37°C. In E. coli, plasmid pEX18Tc and its derivatives were maintained or selected with 10 μg/mL tetracycline, while plasmid pK18mobsacB and its derivatives were maintained or selected with 50 μg/mL kanamycin.
Table 1

Bacterial strains and plasmids used in this study.

Strain or plasmidDescription1Reference
Escherichia coli strains
 DH5αφ80d lacZΔM15 endA1 recA1 hsdR17 (rK mK+) supE44 thi- 1 gyrA96 relA1 FΔ(lacZYA-argF) U169Ausubel et al. (1992)
 S17-1thi pro hsdR recA Tra+Simon et al. (1983)
Pseudomonas aeruginosa strains
 K767PAO1 prototroph (wild-type)Masuda and Ohya (1992)
 K3249K767 derivative carrying the amgSR182C mutationLau et al. (2013)
 K3260K767 derivative carrying the amgSV121G mutationLau et al. (2013)
 K3159K767ΔamgRKrahn et al. (2012)
 K3583K767ΔamgSThis study
 K3584K3249ΔamgRThis study
 K3585K3260ΔamgRThis study
 K1525K767ΔmexXYDe Kievit et al. (2001)
 K3586K1525 derivative carrying the amgSV121G mutationThis study
 K2413K767ΔarmZMorita et al. (2006)
 K3587K2413 derivative carrying the amgSV121G mutationThis study
 K2415K767ΔmexZMorita et al. (2006)
 K3615K2415ΔamgRThis study
 K3589K767ΔyccAThis study
 K3590K767ΔhtpXThis study
 K3591K767ΔPA5528This study
 K3593K767ΔhtpXΔyccAThis study
 K3594K767 ΔhtpXΔPA5528This study
 K3595K767 ΔyccAΔPA5528This study
 K3596K767ΔhtpXΔPA5528ΔyccAThis study
Plasmids
 pEX18TcBroad-host-range gene replacement vector; sacB TcrHoang et al. (1998)
 pK18mobsacBBroad-host-range gene replacement vector; sacB KanrSchäfer et al. (1994)
 pCL6pEX18Tc derivative carrying amgSV121GLau et al. (2013)
 pCG005pEX18Tc::ΔamgRKrahn et al. (2012)
 pCL22pK18mobsacB::ΔamgRThis study
 pCL23pEX18Tc::ΔamgSThis study
 pCL24pEX18Tc::ΔyccAThis study
 pCL25pEX18Tc::ΔhtpXThis study
 pCL26pEX18Tc::ΔPA5528This study

Tcr, tetracycline-resistant; Kanr, kanamycin resistant.

Bacterial strains and plasmids used in this study. Tcr, tetracycline-resistant; Kanr, kanamycin resistant.

DNA methods

Standard protocols were used for restriction endonuclease digestion, ligation, transformation, and agarose gel electrophoresis, as described by Sambrook and Russell (Sambrook and Russell 2001). Plasmid and chromosomal DNA was prepared as before (Lau et al. 2012). DNA fragments used for cloning were extracted from agarose gels using a Wizard® SV gel and PCR clean-up system (Fisher Scientific, Ltd., Nepean, Canada). CaCl2-competent E. coli cells were prepared as described previously (Inoue et al. 1990). Oligonucleotide synthesis was carried out by Integrated DNA Technologies (Coralville, IA). Nucleotide sequencing was carried out by ACGT Corp. (Toronto, Canada) using universal primers.

Construction of P. aeruginosa gene-deletion mutants

Pseudomonas aeruginosa strains carrying various gene deletions were generated by first engineering the deletions in plasmid pEX18Tc (or plasmid pK18mobsacB in the case of the ΔamgR strain K3585) and then mobilizing them into P. aeruginosa from E. coli S17-1 as before (Srikumar et al. 1997; Krahn et al. 2012). Deletions were constructed by amplifying, via PCR, 1-kb fragments upstream and downstream of the sequences being deleted and cloning these individually into plasmid pEX18Tc for sequencing (to ensure that no mutations had been introduced during PCR) and then together into pEX18Tc to generate the deletion construct. PCR fragments were gel purified and digested with restriction enzymes (sites incorporated into the PCR primers) prior to cloning into appropriately digested plasmids. For deletions in amgS, htpX, yccA, and PA5528 the upstream and downstream fragments were amplified using the corresponding UP-F and UP-R, and DN-F and DN-R primers, respectively, (Table2) in separate 50-μL reaction mixtures containing 10 ng of P. aeruginosa K767 chromosomal DNA, 1 U of Phusion high-fidelity DNA polymerase (New England BioLabs, Ltd., Pickering, Ontario, Canada), 1X Phusion HF buffer, 5% (vol/vol) dimethyl sulfoxide (DMSO), primers at a 0.6 μmol/L final concentration, and deoxynucleoside triphosphates (dNTPs) at a 0.2 mmol/L final concentration. The mixtures were heated for 3 min at 98°C, followed by 35 cycles of 0.5 min at 98°C, 0.5 min at 72°C, and 0.5 min at 72°C, before finishing with 10 min at 72°C. For ΔamgR, the previously constructed amgR deletion plasmid pCG005 was employed as described (Krahn et al. 2012) or the ΔamgR gene was excised from pCG005 as a single 2-kb EcoRI-PstI restriction fragment and cloned into plasmid pK18mobsacB to generate an alternat-ive ΔamgR vector. Pseudomonas aeruginosa transconjugants harboring chromosomal inserts of the pEX18Tc- or pK18mobsacB-derived deletion vectors were selected on L-agar plates containing tetracycline (50 μg/mL) and chloramphenicol (5 μg/mL; to counterselect E. coli S17-1), or kanamycin (1500 μg/mL) and chloramphenicol (10 μg/mL; counterselect E. coli S17-1), respectively. These were subsequently streaked onto L-agar containing sucrose (10% [wt/vol]), with sucrose-resistant colonies screened for the appropriate deletion using colony PCR with 2.5 U Taq polymerase in 10% (vol/vol) DMSO (Sheu et al. 2000). Colony PCR was carried out using either the respective UP-F and DN-R primers (ΔamgR, ΔamgS, and ΔPA5528; Table2), or the scr-F and scr-R primer set (ΔyccA and ΔhtpX; Table2) for each deletion. The reaction mixtures were heated for 3 min at 95°C, followed by 30 cycles of 30 sec at 95°C, 30 sec at either 66.8°C (for ΔamgS), 65°C (for ΔamgR), 60°C (for ΔyccA), 55°C (for ΔhtpX) or 62°C (for ΔPA5528), and either 3.5 min (for ΔamgS), 3 min (for ΔamgR and ΔPA5528) or 2 min (for ΔyccA and ΔhtpX) at 72°C, before finishing with 10 min at 75°C.
Table 2

Oligonucleotides used in this study.

PrimerOligonucleotide sequence (5′→3′)1Reference
amgRUp-FGACTGAATTCCTGTAGAAGTCCTGGCGGTKrahn et al. (2012)
amgRDown-RGACTCTGCAGCGGCGCTGGAGAAACTGGTKrahn et al. (2012)
amgSUP-FGGACGTGAATTCGACTTGCTGCGGTTGAACThis study
amgSUP-RGACCTGTCTAGAACCAGAGCGGCGTTTTCThis study
amgSDN-FGGCAGTTCTAGATGATACCCGACGGGTTTGThis study
amgSDN-RAACGCTAAGCTTGACAGAAGGTCCATGCCACThis study
yccAUP-FGCAGTTGAGCTCTGGTACTGGTGGACGACGATGThis study
yccAUP-RGCAGTTGGATCCTTGCATGGTGTGGGTACTCCThis study
yccADN-FGAGGCTGGATCCGGCGACGACTGATAGAAAACThis study
yccADN-RGAGGCATCTAGAGGGTTGAGCAGGTACAGGCAThis study
yccA-scr-FCCGTTGCCTTAAACCACTCGThis study
yccA-scr-RAATCACCTGGTCGTAGCGTTGThis study
htpXUP-FCATCGTGAGCTCGAAGGTCTCGACATCCTCGThis study
htpXUP-RCATCGTGGTACCTAATTCTGGCCGGTGAAGThis study
htpXDN-FCATCGTGGTACCTCCGCTTTCACACTTGGGAThis study
htpXDN-RCGTGAGTCTAGAACGCCAGGCAGTCGTAGThis study
htpX-scr-FCGCCAACACCATTCATTACGThis study
htpX-scr-RTGAACCATTCGGCCATGTGThis study
PA5528UP-FCATCGTGAGCTCGAACTTCGCCACGTAGGThis study
PA5528UP-RGCACTCGGTACCAGAACACGCTGCATTGTAGThis study
PA5528DN-FCATCGTGGTACCGAACTGATCCCGAGTGGTTGThis study
PA5528DN-RGGAGCTTCTAGATGGTGTCGCCATTCAGCThis study
qPCR-htpX-FATCTCCAAGTGGATGGCGALau et al. (2013)
qPCR-htpX-RCAGCTCTTCGACGGTTTGCLau et al. (2013)
qPCR-PA5528-FATGCAGCGTGTTCTCAGCLau et al. (2013)
qPCR-PA5528-RCGCTTGGCATTGGCATCCALau et al. (2013)
qPCR-mexX-FCTATCGGCATCACCAGCGLau et al. (2012)
qPCR-mexX-RATCTGGAACAGCACGGTGLau et al. (2012)
qPCR-PA5471-FCATCAAGCCTTTGTCCGCLau et al. (2012)
qPCR-PA5471-RCGGTGGTTTGCAGTTGCTLau et al. (2012)
qPCR-rpoD-FATCCTGCGCAACCAGCAGAALau et al. (2012)
qPCR-rpoD-RTCGACATCGCGCGGTTGATTLau et al. (2012)

Restriction endonuclease cleavage sites are underlined.

Oligonucleotides used in this study. Restriction endonuclease cleavage sites are underlined.

Construction of P. aeruginosa AmgSV121G mutants

To introduce the amgSV121G mutation into the P. aeruginosa ΔmexXY and ΔarmZ strains K1525 and K2413, respectively, plasmid pCL6, a pEX18Tc-based gene replacement vector carrying the amgSV121G mutation, was mobilized into the P. aeruginosa deletion strains from E. coli S17-1 and amgSV121G derivatives selected as before (Lau et al. 2013).

Membrane depolarization assay

A previously described fluorometric assay (Krahn et al. 2012), involving the membrane potential-sensitive dye bis-(1,3-dibutylbarbituric acid) trimethine oxonol [DiBAC4(3)], was employed to measure the degree of CM depolarization promoted by AG treatment of P. aeruginosa. Briefly, early logarithmic phase (optical density at 600 nm [OD600 nm] = 0.3–0.5) L-broth subcultures of P. aeurginosa were treated with the AGs gentamicin (2 or 5 μg/mL final concentration) or tobramycin (0.5 or 1.25 μg/mL final concentration) or the aminocyclitol, spectinomycin (SPC) (1280 μg/mL). In some experiments P. aeruginosa was pretreated with chloramphenicol (128 μg/mL) for 15 min prior to the addition of gentamicin. Samples (5 mL) of the AG-treated and untreated control cultures were taken immediately and then hourly over 3 h and exposed to DiBAC4(3) (Invitrogen, Burlington, Ontario, Canada) at 37°C for 5 min in the dark at a final concentration of 10 μg/mL. Bacteria were then pelleted and resuspended in phosphate-buffered saline (Nehme et al. 2004) to a final OD600 nm of 0.1. Membrane depolarization-dependent fluorescence emitted by cells was then measured using a Varian (now Agilent, Mississauga, Ontario, Canada) Cary Eclipse fluorescent spectrophotometer with excitation and emission wavelengths of 490 and 518, respectively.

Quantitative real-time PCR

Bacterial RNA was isolated, purified, and reverse transcribed into cDNA as described previously (Lau et al. 2012). The primers used in quantitative real-time PCR (qPCR designation, Table2) were designed to amplify specific gene fragments with lengths of 99 bp (htpX), 74 bp (PA5528), 142 bp (mexX), 89 bp (armZ/PA5471), or 91 bp (rpoD), and were validated and described previously (Lau et al. 2012, 2013). All quantitative real-time PCR primer sets used in the present study had a minimum 4-log10 dynamic range. The expression of htpX, PA5528, mexX, armZ, and rpoD was assessed by quantitative real-time PCR as described previously using a CFX96 real-time PCR detection system (Bio-Rad, Mississauga, Ontario, Canada) (Lau et al. 2012). For each gene studied, at least one control reaction with no cDNA template was included in each experiment to check for contamination of reagent(s) and to identify unintended amplification products (e.g., primer dimers). The levels of expression of the target genes in each strain studied, normalized against that of the reference gene, rpoD, were calculated using the standard analysis feature of the CFX-manager software version 3.0 (Bio-Rad) and were reported herein as fold change relative to that in the P. aeruginosa PAO1 wild-type (WT) strain K767, unless otherwise specified.

Antibiotic susceptibility assay

The susceptibility of P. aeruginosa to antimicrobial agents was assessed using the twofold serial microtiter broth dilution method described previously (Jo et al. 2003), with an inoculum of ∼5 × 105 cells per mL. MICs were recorded as the lowest concentration of antibiotic inhibiting visible growth after 18 h of incubation at 37°C.

Results

AmgRS is a membrane damage-responsive TCS

A recent study showed that treatment of P. aeruginosa with the AG gentamicin-promoted depolarization of the CM and that this was exacerbated in a mutant lacking the AmgR component of the AmgRS TCS (Krahn et al. 2012). These data were interpreted as AG-generated mistranslated polypeptides damaging the CM, and AmgRS playing a role in ameliorating this damage. Consistent with AG-generated mistranslated/polypeptides being responsible for the observed CM depolarization, exposure of wild-type P. aeruginosa K767 to SPC, an aminocyclitol that is related to AGs but does not promote mistranslation (Wallace et al. 1974), failed to promote membrane depolarization (Fig.1A). Moreover, treatment of P. aeruginosa K767 with chloramphenicol, a translation inhibitor (Vazquez 1974), prior to the addition of gentamicin abrogated gentamicin-promoted membrane depolarization (Fig.1A), again consistent with (mis)translated polypeptides being central to the membrane damage being measured in the depolarization assay. In agreement with the previous study, loss of amgR enhanced membrane depolarization promoted by the AGs gentamicin (modestly at 2.5X MIC [data not shown] as seen before [Krahn et al. 2012] and much more strikingly at 1X MIC [Fig.1B, compare WT and ΔamgR]) and, especially, tobramycin (Fig.1C), which was markedly less membrane damaging than gentamicin at a comparable MIC (Fig.1C). In addition, amgS gain-of-function mutants K3249 (amgSR182C) and K3260 (amgSV121G), in which the AmgRS TCS is activated and AG resistance enhanced (Lau et al. 2013), showed reduced membrane depolarization, dependent on AmgR (Fig.1B). Taken together, these data support the conclusion that AmgRS protects the CM from damage(s) caused by AG-generated, mistranslated aberrant polypeptides.
Figure 1

Aminoglycoside-promoted cytoplasmic membrane depolarization. Cytoplasmic membrane depolarization, as assessed by DiBAC4(3) fluorescence, was measured over time following exposure of Pseudomonas aeruginosa to various antimicrobials added at T = 0 h. (A) Wild-type (WT) P. aeruginosa strain K767 exposed to 5 μg/mL (2.5X MIC) of gentamicin (GEN; filled circles), 128 μg/mL chloramphenicol + 5 μg/mL gentamicin (CAM + GEN; open circles) and 1280 μg/mL (2.5X MIC) spectinomycin (SPC; filled triangles). (B) Pseudomonas aeruginosa strains K767 (WT; open circles), K3159 (ΔamgR; filled circles), K3249 (amgSR182C; open triangles), K3584 (amgSR182C ΔamgR; filled triangles), K3260 (amgSV121G; open diamonds), and K3585 (amgSV121G ΔamgR; filled diamonds) exposed to 2 μg/mL (1X MIC) of gentamicin (GEN). (C) Pseudomonas aeruginosa strains K767 (WT; circles) and K3159 (ΔamgR; squares) exposed to 0.5 μg/mL (1X MIC) (open symbols) and 1.25 μg/mL (2.5X MIC) (filled symbols) tobramycin (TOB). The data are means ± standard errors of the means (SEMs) of three to four independent experiments and have been corrected for fluorescence measured in the absence of antimicrobial exposure.

Aminoglycoside-promoted cytoplasmic membrane depolarization. Cytoplasmic membrane depolarization, as assessed by DiBAC4(3) fluorescence, was measured over time following exposure of Pseudomonas aeruginosa to various antimicrobials added at T = 0 h. (A) Wild-type (WT) P. aeruginosa strain K767 exposed to 5 μg/mL (2.5X MIC) of gentamicin (GEN; filled circles), 128 μg/mL chloramphenicol + 5 μg/mL gentamicin (CAM + GEN; open circles) and 1280 μg/mL (2.5X MIC) spectinomycin (SPC; filled triangles). (B) Pseudomonas aeruginosa strains K767 (WT; open circles), K3159 (ΔamgR; filled circles), K3249 (amgSR182C; open triangles), K3584 (amgSR182C ΔamgR; filled triangles), K3260 (amgSV121G; open diamonds), and K3585 (amgSV121G ΔamgR; filled diamonds) exposed to 2 μg/mL (1X MIC) of gentamicin (GEN). (C) Pseudomonas aeruginosa strains K767 (WT; circles) and K3159 (ΔamgR; squares) exposed to 0.5 μg/mL (1X MIC) (open symbols) and 1.25 μg/mL (2.5X MIC) (filled symbols) tobramycin (TOB). The data are means ± standard errors of the means (SEMs) of three to four independent experiments and have been corrected for fluorescence measured in the absence of antimicrobial exposure.

Impact of amgSV121G on expression of the mexXY multidrug efflux operon

While the amgSR182C and amgSV121G mutations provided for a modest increase in resistance to AGs (Lau et al. 2013), evaluation of their impact on susceptibility to non-AGs revealed an unexpected decrease in resistance to several agents for the amgSV121G mutant (Table3). Interestingly, those agents for which resistance was reduced (SPC, chloramphenicol, tetracycline, and erythromycin) are known inducers (Masuda et al. 2000a; Jeannot et al. 2005; Morita et al. 2006) and probable substrates (Aires et al. 1999; Mine et al. 1999; Masuda et al. 2000b) of the MexXY-OprM multidrug efflux system. This suggested that the amgSV121G mutation was adversely affecting the induction of mexXY by these agents. Examination of mexXY expression using quantitative real-time PCR, however, revealed that mexXY expression was actually enhanced ca. threefold in the amgSV121G mutant relative to its parent strain K767 (Fig.2A). Moreover, this enhanced expression was wholly dependent on AmgR (Fig.2A), an indication that the mexXY upregulation was a direct result of AmgRS activation by the V121G mutation present in AmgS. This precisely mirrored the AmgR-dependent increase in the expression of htpX (Fig.2B), an established AmgRS-regulated gene (Lau et al. 2013). Since drug-inducible mexXY expression is invariably dependent on the MexZ anti-repressor, ArmZ (Morita et al. 2006; Hay et al. 2013), the dependence of amgSV121G mutational upregulation of mexXY on ArmZ was also assessed. Surprisingly, while loss of armZ had a modest negative impact on mexXY expression in both the WT and V121G amgS backgrounds relative to their ArmZ+ counterparts, the amgSV121G mutation still provided for a threefold increase in mexXY expression in the absence of armZ (Fig.2A). Thus, mexXY expression promoted by the amgSV121G mutation was independent of this anti-repressor. In agreement with this, and in contrast to drug-inducible mexXY expression where armZ is upregulated in parallel with mexXY (Morita et al. 2006), the amgSV121G mutation had no impact on armZ expression (data not shown).
Table 3

Impact of the amgSV121G mutation on resistance of Pseudomonas aeruginosa to nonaminoglycosides.

StrainAmgS1MexXY1Minimal inhibitory concentration (μg/mL) for:2
SPCTETERYCAMCAR
K767WT+1024165126464
K3249R182C+1024165126464
K3260V121G+25682563264
K1525WT64161286464
K3586V121G64161283264

The status of the AmgS (wild-type [WT] or with the indicated amino acid substitution) and MexXY (+, present; −, absent) components of the indicated strains is shown.

SPC, spectinomycin; TET, tetracycline; ERY, erythromycin; CAM, chloramphenicol; CAR, carbenicillin.

Figure 2

Impact of the amgSV121G mutation on mexXY and htpX expression. Expression of (A) mexXY and (B) htpX was assessed in late-log phase cultures of the indicated strains using real-time quantitative PCR. The status of the amgS (wild-type [WT] or V121G mutation) and the amgR and armZ genes (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate.

Impact of the amgSV121G mutation on resistance of Pseudomonas aeruginosa to nonaminoglycosides. The status of the AmgS (wild-type [WT] or with the indicated amino acid substitution) and MexXY (+, present; −, absent) components of the indicated strains is shown. SPC, spectinomycin; TET, tetracycline; ERY, erythromycin; CAM, chloramphenicol; CAR, carbenicillin. Impact of the amgSV121G mutation on mexXY and htpX expression. Expression of (A) mexXY and (B) htpX was assessed in late-log phase cultures of the indicated strains using real-time quantitative PCR. The status of the amgS (wild-type [WT] or V121G mutation) and the amgR and armZ genes (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate. A possible explanation for the apparent disconnect between the increased susceptibility to non-AG MexXY-OprM substrates and the increase in mexXY expression was that the reduced resistance of the amgSV121G strain K3260 was, in fact, unrelated to mexXY. To assess this, the mexXY genes were deleted in strain K3260 (yielding strain K3586) and susceptibility to these non-AGs reexamined and compared with a ΔmexXY strain carrying a WT amgS gene (strain K1525). As seen in Table3, while the mexXY-mutant strains were both more susceptible to these non-AG mexXY inducers/substrates, there was no longer any difference in susceptibility to these agents between the amgSWT and the amgSV121G derivatives. Thus, the enhanced drug susceptibility seen in the MexXY+ amgSV121G strain K3260 was dependent on the presence of mexXY. Given the increased mexXY expression seen in strain K3260, it was possible that the enhanced AG resistance of this mutant was attributable to MexXY-OprM and not AmgRS-mediated expression of its other target genes (e.g., htpX, PA5528). To assess this, the impact of the amgSV121G mutation on AG resistance in a ΔmexXY background was examined. As seen in Table4, the amgSV121G mutation promoted a comparable and, in some instances (e.g., for tobramycin and streptomycin), greater increase in AG resistance in the MexXY− derivative K3586 than in the MexXY+ derivative K3260 (although the absolute level of resistance was lower owing to the absence of the AG-accommodating multidrug efflux system in the MexXY− strains). Thus, while MexXY-OprM clearly contributes to AG resistance in the amgSV121G strain K3260, the increase in AG resistance seen in K3260 relative to its wild-type parent strain K767 is not explained by the increased mexXY expression in the mutant.
Table 4

Impact of the amgSV121G mutation on aminoglycoside resistance of Pseudomonas aeruginosa.

StrainAmgS1MexXY1Minimal inhibitory concentration (μg/mL) for:2
TOBGENSTRPARNEO
K767WT+123225632
K3260V121G+246451264
K1525WT0.512168
K3586V121G2283216

The status of the AmgS (wild-type [WT] or with the indicated amino acid substitution) and MexXY (+, present; −, absent) components of the indicated strains is shown.

TOB, tobramycin; GEN, gentamicin; STR, streptomycin; PAR, paromomycin; NEO, neomycin.

Impact of the amgSV121G mutation on aminoglycoside resistance of Pseudomonas aeruginosa. The status of the AmgS (wild-type [WT] or with the indicated amino acid substitution) and MexXY (+, present; −, absent) components of the indicated strains is shown. TOB, tobramycin; GEN, gentamicin; STR, streptomycin; PAR, paromomycin; NEO, neomycin.

AG induction of mexXY is AmgRS-dependent

Given that mutational activation of the AmgRS TCS upregulated mexXY expression, we questioned whether the previously reported induction of mexXY by AGs (Masuda et al. 2000a; Jeannot et al. 2005; Morita et al. 2006), the only agents known to activate AmgRS (Lau et al. 2013), was similarly AmgRS dependent. Initially, since the original studies of AG activation of AmgRS involved the use of late-log phase cells and 1X MIC of AGs such as paromomycin (PAR) and neomycin (Lau et al. 2013) (vs. mid-log phase cells and ¼ MIC of AGs which was used previously for inducing mexXY expression [Morita et al. 2006]), the potential involvement of AmgRS in AG induction of mexXY was assessed using late-log phase cells and 1X MIC of PAR. In agreement with previous reports of AGs inducing mexXY expression (Masuda et al. 2000a; Jeannot et al. 2005; Morita et al. 2006), PAR-induced mexXY expression in wild-type P. aeruginosa strain K767 (threefold; Fig.3A). PAR-inducible mexXY expression was, however, lacking in amgR and amgS deletion strains (Fig.3A), an indication that AG induction of mexXY expression was dependent on AmgRS. As expected, SPC strongly stimulated mexXY expression in K767 (20-fold; Fig.3A), but this was minimally impacted by the loss of amgR or amgS (Fig.3A), consistent with SPC not activating AmgRS (Lau et al. 2013) and so not stimulating mexXY expression via this TCS. PAR (and SPC) induction of mexXY was, as expected, also dependent on armZ – mexXY expression was lost in the ΔarmZ strain K2413 (Fig.3A). Comparable results were seen when mid-log phase cells were exposed to ¼ MIC of PAR as in previous studies of AG-inducible mexXY expression (Fig.3B), an indication that AG-inducible mexXY expression is generally dependent on AmgRS, regardless of growth phase or inducing drug concentration. To confirm and extend this observation, the AmgRS dependence of AG-inducible mexXY expression was assessed using an additional AG, gentamicin, which was previously shown to induce mexXY expression (Jeannot et al. 2005). As seen in Figure4, gentamicin-induced mexXY expression, and this was dependent on AmgR. Moreover, and consistent with gentamicin activating this TCS, expression of the AmgRS target genes htpX and PA5528 was increased two- to threefold by gentamicin, and this was also dependent on AmgR (Fig.4).
Figure 3

Impact of AmgRS on paromomycin-inducible mexXY expression. Expression of mexXY (A, B, and D) and armZ (C) was assessed in late- (A and C) and mid- (B and D) log phase cultures of the indicated strains without (open bars) or with (filled bars) exposure to paromomycin (PAR; black bars) or spectinomycin (SPC; gray bars) using real-time quantitative PCR. The status of the amgR, amgS, armZ, and mexZ genes (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate.

Figure 4

Impact of gentamicin on expression of AmgRS target genes. Expression of mexXY, htpX, and PA5528 was assessed in late-log phase cultures of the indicated strains without (open bars) or with (filled bars) exposure to gentamicin. The status of the amgR gene (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate.

Impact of AmgRS on paromomycin-inducible mexXY expression. Expression of mexXY (A, B, and D) and armZ (C) was assessed in late- (A and C) and mid- (B and D) log phase cultures of the indicated strains without (open bars) or with (filled bars) exposure to paromomycin (PAR; black bars) or spectinomycin (SPC; gray bars) using real-time quantitative PCR. The status of the amgR, amgS, armZ, and mexZ genes (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate. Impact of gentamicin on expression of AmgRS target genes. Expression of mexXY, htpX, and PA5528 was assessed in late-log phase cultures of the indicated strains without (open bars) or with (filled bars) exposure to gentamicin. The status of the amgR gene (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate. AG-inducible mexXY expression is ultimately dependent on AG induction of armZ (Morita et al. 2006). Although not previously studied, we show here that PAR also induces expression of this anti-repressor (Fig.3C). Interestingly, such induction was not compromised by loss of amgR or amgS (Fig.3C), an indication that the AmgRS involvement in AG-inducible mexXY expression is independent of MexZ (i.e., does not promote mexXY expression by influencing ArmZ-modulation of MexZ repressor activity). Consistent with MexZ and AmgRS regulating mexXY expression independently and AmgRS being required only for AG-promoted mexXY expression, the elevated, drug-independent expression of mexXY seen in the ΔmexZ strain K2415 was not lost in the absence of amgR (Fig.3D; see strain K3615). Thus, AG-inducible mexXY expression is not a simple matter of ArmZ-mediated MexZ derepression but also requires activation or operation of the AmgRS TCS.

Involvement of AmgRS-regulated protease genes in AG-inducible mexXY expression

Nine genes show AmgRS-dependent induction by the AG tobramycin (Lee et al. 2009), of which three, htpX, yccA, and PA5528, were primarily responsible for this TCS's contribution to the intrinsic AG resistance of P. aeruginosa (Hinz et al. 2011). The htpX and yccA homologues in E. coli encode a CM-associated protease (Sakoh et al. 2005) and a modulator of the FtsH protease (van Stelten et al. 2009), respectively, with both proteases implicated in membrane protein quality control (Sakoh et al. 2005; van Stelten et al. 2009). PA5528 encodes a predicted CM-associated protein of unknown function. Since MexXY is recruited in response to AmgRS activation (by mutation or AG exposure) and proteases are central to the AmgRS-regulated response to AGs (Hinz et al. 2011), we reasoned that mexXY induction might be dependent on this protease activity, possibly promoted by the degradation products of AG-generated mistranslated polypeptides. These products might, in turn, be the inducers and intended substrates for MexXY. To test this, the aforementioned AmgRS-regulated genes were deleted individually and in combination, and the resultant deletion strains were assessed for AG-inducible mexXY expression. Single knockouts in htpX, PA5528, or yccA had no impact on AG- (i.e., PAR-) inducible expression of mexXY (Fig.5A). Mutants lacking yccA in combination with htpX or PA5528 also retained PAR-inducible mexXY expression (Fig.5B). In contrast, PAR-inducible mexXY expression was absent in the HtpX- PA5528- double-knockout strain K3594, and the further elimination of yccA in the triple knockout stain K3596 had no additional adverse impact on mexXY expression (Fig.5B). Thus, htpX and PA5528 are the sole AmgRS-regulated genes that are required for AmgRS-dependent PAR-inducible mexXY expression. Loss of htpX, PA5528, and yccA, alone or in combination, had no effect on armZ expression (Fig.5C and D), consistent with the AmgRS independence of and, so, lack of a need for AmgRS targets for PAR-inducible armZ expression.
Figure 5

Contribution of AmgRS target genes to aminoglycoside-inducible mexXY expression. Expression of mexXY (A and B) and armZ (C and D) was assessed in late-log phase cultures of the indicated strains without (open bars) and with (filled bars) exposure to paromomycin using real-time quantitative PCR. The status of the htpX, PA5528 and yccA genes (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate.

Contribution of AmgRS target genes to aminoglycoside-inducible mexXY expression. Expression of mexXY (A and B) and armZ (C and D) was assessed in late-log phase cultures of the indicated strains without (open bars) and with (filled bars) exposure to paromomycin using real-time quantitative PCR. The status of the htpX, PA5528 and yccA genes (+, wild-type gene present; −, gene deleted) in each strain is indicated. Expression was normalized to rpoD and is reported relative to the wild-type Pseudomonas aeruginosa strain K767 (fold-change). Values are means ± standard errors of the means (SEMs) from at least three independent determinations, each performed in triplicate.

Discussion

Although inducible by ribosome-perturbing agents and mutations, it is clear that mexXY “inducers” are not created equally, with SPC, for example, promoting substantial induction of mexXY (Jeannot et al. 2005; Hay et al. 2013) (this study) while AGs provide for very modest induction of this efflux system (Jeannot et al. 2005) (this study). This speaks to possibly different pathways to the recruitment of the MexXY-OprM efflux system by ribosome-perturbing agents. Indeed, the current study demonstrates that AGs, unique amongst ribosome-targeting antimicrobials in promoting mistranslation and generating membrane-damaging aberrant polypeptides (Davis et al. 1986; Busse et al. 1992), upregulate the mexXY operon by activating the AmgRS TCS that responds to AG-promoted membrane damage and that protects P. aeruginosa from this damage, with AG induction of mexXY dependent on AmgRS. In common with non-AG inducers of mexXY, AG induction of mexXY is, however, also dependent on the ArmZ anti-repressor of MexZ, an indication that AmgR activation of this efflux operon still requires loss of MexZ repression of mexXY. Consistent with these regulators operating independently of one another, armZ expression was not regulated by AmgRS (this study) (loss of armZ also had no impact on the expression of the AmgRS-regulated htpX and PA5528 genes [data not shown]), and the drug-independent expression of mexXY seen in a mexZ mutant was not compromised by the absence of amgR. In addition, loss of amgRS appears only to block AG enhancement of mexXY expression, with basal expression levels of mexXY retained in AmgRS− strains, while loss of armZ has a more significant impact on mexXY expression, eliminating AG-inducible expression of mexXY and reducing basal level expression of the efflux operon. Presumably, additional endogenous ArmZ-dependent mexXY inducers exist in the cell that, as with non-AG antimicrobial inducers of mexXY, operate independent of AmgRS (and likely dependent on other regulators). Despite differences in AmgRS dependency amongst mexXY inducers it is unclear whether the actual inducing signals and/or efflux substrates that are generated and ultimately accommodated by MexXY-OprM differ in cells treated with AmgRS-dependent (i.e., AGs) versus AmgRS-independent inducers. Since drug-inducible mexXY expression is a response to ribosome perturbation and not the drugs themselves (Jeannot et al. 2005) the actual inducing signal(s) are likely generated as a result of some downstream effect(s) of translation disruption. Whether these are common to both classes of inducers and can be generated with or without membrane perturbation is unknown. Still, it is hard to imagine inducers whose generation is dependent on an envelope stress response (AmgRS) and two of its target genes (htpX, PA5528) being the same as those generated independent of these. It may be, therefore, that other regulators/regulatory systems mediate mexXY induction by non-AGs. The observation, for example, that SPC induction of mexXY greatly exceeds that seen in a mexZ knockout strain and is retained in a MexZ− P. aeruginosa strain (Hay et al. 2013) indicates that MexZ derepression alone does not explain SPC-inducible mexXY expression, and suggests that other factor(s)/regulator(s) (but not AmgRS) mediate this. Still, SPC induction of mexXY expression also requires loss of MexZ repression, just as AmgRS-dependent AG induction of mexXY does, an indication that the downstream-of-ribosome-perturbation signals must similarly be acting through both ArmZ/MexZ as well as the putative additional factor(s)/regulator(s). Thus, the simplest explanation for drug-inducible mexXY expression is that some shared feature or downstream effect of ribosome perturbation by AGs and non-AGs promotes MexZ derepression via ArmZ while unique downstream effects of AG versus non-AG perturbation of the ribosome signals though AmgRS (AGs) and other regulators (non-AG ribosome perturbing agents) (Fig.6). Certainly, ribosome-targeting agents have a myriad of effects on bacterial gene expression and physiology (Ng et al. 2003; Sabina et al. 2003; Shaw et al. 2003; Hutter et al. 2004; Aakra et al. 2005; Lin et al. 2005; Qiu et al. 2005; Nanduri et al. 2009), some common and some agent specific (Ng et al. 2003; Sabina et al. 2003; Hutter et al. 2004). Having mexXY regulators responsive to drug-specific effects would ensure mexXY recruitment in response only to those consequences of translation perturbation where MexXY-OprM function is required. What that function is, and what the intended efflux substrates are, is as yet undetermined, although the observation here that AG-promoted mexXY expression is dependent on AmgRS targets that include a presumed protease (HtpX) is consistent with the AG-generated mexXY inducer and possible MexXY-OprM substrate being a degradation product(s) of AG-generated aberrant polypeptides. As such, MexXY-OprM may function generally as part of an aberrant polypeptide turnover and detoxification process. Still, if this is the case, then there must be some overlap in HtpX and PA5528 function, at least as regards of generation of the mexXY inducer, since loss of either alone has no impact on AG-promoted mexXY expression (i.e., not simply a matter of HtpX cleaving mistranslated proteins to yield the mexXY inducer). Consistent with HtpX and PA5528 having some shared and, thus, mutually compensatory function, PA5528 expression increases threefold in an htpX-mutant strain (data not shown). Although SPC treatment does not yield membrane-damaging aberrant polypeptides, it may well yield truncated/prematurely terminated polypeptides as a result of its interference with the translocation step of translation (Peske et al. 2004). SPC does not appear to fully block translation (Peske et al. 2004), perhaps allowing for partial synthesis of some translation products, with accumulation of these truncated polypeptides possibly having their own deleterious effects on the cell. As such, they may need to be turned over by another (not AmgRS) stress response system and, perhaps, its own set of proteases, with MexXY-OprM again possibly responsible for the export of their degradation products.
Figure 6

Schematic representation of ArmZ and AmgRS regulation of mexXY in Pseudomonas aeruginosa. In the absence of ribosome-perturbing agents, protein synthesis occurs normally and native, functional proteins are synthesized. In the presence of ribosome-targeting antimicrobials including aminoglycosides (AG), which promote mistranslation and aberrant polypeptide synthesis, and nonaminoglycosides (non-AG), which halt protein synthesis, expression of the amrZ gene is induced. ArmZ, an anti-repressor, modulates the activity of the mexXY repressor, MexZ, leading to expression of mexXY and, ultimately, production and assembly of the MexXY-OprM multidrug efflux system. Additionally, AG-generated aberrant polypeptides disrupt the inner membrane (IM) activating AmgS, the sensor component of the AmgRS two-component system, which in turn activates AmgR to drive expression of the htpX and PA5528 genes. The activities of the htpX and PA5528 gene products in some, as yet unknown way promote expression of the mexXY operon, dependent on ArmZ-mediated loss of MexZ repression of mexXY. Nonaminoglycoside ribosome inhibitors may also promote mexXY expression via additional, as yet unknown regulatory pathway(s), also dependent on ArmZ-mediated loss of MexZ repression. OM, outer membrane.

Schematic representation of ArmZ and AmgRS regulation of mexXY in Pseudomonas aeruginosa. In the absence of ribosome-perturbing agents, protein synthesis occurs normally and native, functional proteins are synthesized. In the presence of ribosome-targeting antimicrobials including aminoglycosides (AG), which promote mistranslation and aberrant polypeptide synthesis, and nonaminoglycosides (non-AG), which halt protein synthesis, expression of the amrZ gene is induced. ArmZ, an anti-repressor, modulates the activity of the mexXY repressor, MexZ, leading to expression of mexXY and, ultimately, production and assembly of the MexXY-OprM multidrug efflux system. Additionally, AG-generated aberrant polypeptides disrupt the inner membrane (IM) activating AmgS, the sensor component of the AmgRS two-component system, which in turn activates AmgR to drive expression of the htpX and PA5528 genes. The activities of the htpX and PA5528 gene products in some, as yet unknown way promote expression of the mexXY operon, dependent on ArmZ-mediated loss of MexZ repression of mexXY. Nonaminoglycoside ribosome inhibitors may also promote mexXY expression via additional, as yet unknown regulatory pathway(s), also dependent on ArmZ-mediated loss of MexZ repression. OM, outer membrane. The observation that the increased mexXY expression of the amgSV121G mutant is ArmZ independent is puzzling, contrasting as it does with the ArmZ dependence of drug- (Morita et al. 2006) and ROS- (Fraud and Poole 2011) inducible mexXY expression. Whether this reflects the presence of a truly ArmZ-independent route to mexXY recruitment in P. aeruginosa is, at present, unknown. It is worth noting, however, that not all amgS gain-of-function mutations impact mexXY expression – the R182C mutation does not – an indication that AmgRS activation alone is insufficient to drive mexXY expression. Presumably, this speaks to some unique feature of the amgSV121G mutation and its impact on AmgRS signaling. Equally puzzling is the observation of decreased resistance to non-AG inducers/substrates of mexXY in the amgSV121G mutant, despite the increase in mexXY expression that results from this amgS mutation. This suggests that the operation of the MexXY-OprM pump is being compromised in some way in the amgSV121G mutant. The failure of the amgSV121G mutation to adversely impact resistance to AGs, which are also mexXY inducers/MexXY-OprM substrates, is presumably due to the positive impact of AmgRS activation on non-MexXY contributors to AG resistance. Consistent with this, the amgSV121G mutation promoted AG resistance in the absence of mexXY. In addition, the observation that the positive impact of the amgSV121G mutation on resistance to some AGs was actually greater in the absence versus the presence of the pump is in agreement with the MexXY-mediated export of/resistance to AGs also being compromised in the amgSV121G mutant (i.e., net impact of the mutation was less in the latter instance owing to the reduced MexXY-OprM contribution to AG resistance). Whatever the explanations for these unique features of the amgSV121G mutant, the mutant provided the crucial link between AmgRS and mexXY, ultimately confirming a role for the TCS in AG-inducible expression of the efflux system.
  65 in total

Review 1.  Efflux-mediated antimicrobial resistance.

Authors:  Keith Poole
Journal:  J Antimicrob Chemother       Date:  2005-05-24       Impact factor: 5.790

Review 2.  Pseudomonas aeruginosa: all roads lead to resistance.

Authors:  Elena B M Breidenstein; César de la Fuente-Núñez; Robert E W Hancock
Journal:  Trends Microbiol       Date:  2011-06-12       Impact factor: 17.079

3.  Antibiotic inhibitors of the bacterial ribosome.

Authors:  B Weisblum; J Davies
Journal:  Bacteriol Rev       Date:  1968-12

4.  Characterization of a Pseudomonas aeruginosa efflux pump contributing to aminoglycoside impermeability.

Authors:  S Westbrock-Wadman; D R Sherman; M J Hickey; S N Coulter; Y Q Zhu; P Warrener; L Y Nguyen; R M Shawar; K R Folger; C K Stover
Journal:  Antimicrob Agents Chemother       Date:  1999-12       Impact factor: 5.191

5.  Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum.

Authors:  A Schäfer; A Tauch; W Jäger; J Kalinowski; G Thierbach; A Pühler
Journal:  Gene       Date:  1994-07-22       Impact factor: 3.688

6.  Resistance mechanisms of multiresistant Pseudomonas aeruginosa strains from Germany and correlation with hypermutation.

Authors:  B Henrichfreise; I Wiegand; W Pfister; B Wiedemann
Journal:  Antimicrob Agents Chemother       Date:  2007-09-17       Impact factor: 5.191

7.  Proteolytic activity of HtpX, a membrane-bound and stress-controlled protease from Escherichia coli.

Authors:  Machiko Sakoh; Koreaki Ito; Yoshinori Akiyama
Journal:  J Biol Chem       Date:  2005-08-02       Impact factor: 5.157

8.  Determinants of intrinsic aminoglycoside resistance in Pseudomonas aeruginosa.

Authors:  Thomas Krahn; Christie Gilmour; Justin Tilak; Sebastien Fraud; Nicholas Kerr; Calvin Ho-Fung Lau; Keith Poole
Journal:  Antimicrob Agents Chemother       Date:  2012-08-20       Impact factor: 5.191

9.  A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants.

Authors:  T T Hoang; R R Karkhoff-Schweizer; A J Kutchma; H P Schweizer
Journal:  Gene       Date:  1998-05-28       Impact factor: 3.688

10.  Pseudomonas aeruginosa: resistance to the max.

Authors:  Keith Poole
Journal:  Front Microbiol       Date:  2011-04-05       Impact factor: 5.640

View more
  21 in total

1.  Hypermutator Pseudomonas aeruginosa Exploits Multiple Genetic Pathways To Develop Multidrug Resistance during Long-Term Infections in the Airways of Cystic Fibrosis Patients.

Authors:  C A Colque; A G Albarracín Orio; S Feliziani; R L Marvig; A R Tobares; H K Johansen; S Molin; A M Smania
Journal:  Antimicrob Agents Chemother       Date:  2020-04-21       Impact factor: 5.191

Review 2.  The challenge of efflux-mediated antibiotic resistance in Gram-negative bacteria.

Authors:  Xian-Zhi Li; Patrick Plésiat; Hiroshi Nikaido
Journal:  Clin Microbiol Rev       Date:  2015-04       Impact factor: 26.132

3.  Analysis of the Pseudomonas aeruginosa Aminoglycoside Differential Resistomes Allows Defining Genes Simultaneously Involved in Intrinsic Antibiotic Resistance and Virulence.

Authors:  Fernando Sanz-García; Carolina Alvarez-Ortega; Jorge Olivares-Pacheco; Paula Blanco; José Luis Martínez; Sara Hernando-Amado
Journal:  Antimicrob Agents Chemother       Date:  2019-04-25       Impact factor: 5.191

4.  A large-scale whole-genome comparison shows that experimental evolution in response to antibiotics predicts changes in naturally evolved clinical Pseudomonas aeruginosa.

Authors:  Samuel J T Wardell; Attika Rehman; Lois W Martin; Craig Winstanley; Wayne M Patrick; Iain L Lamont
Journal:  Antimicrob Agents Chemother       Date:  2019-09-30       Impact factor: 5.191

5.  Mechanisms of Resistance to Aminoglycoside Antibiotics: Overview and Perspectives.

Authors:  Sylvie Garneau-Tsodikova; Kristin J Labby
Journal:  Medchemcomm       Date:  2015-09-21       Impact factor: 3.597

Review 6.  Targeting the Holy Triangle of Quorum Sensing, Biofilm Formation, and Antibiotic Resistance in Pathogenic Bacteria.

Authors:  Ronit Vogt Sionov; Doron Steinberg
Journal:  Microorganisms       Date:  2022-06-16

7.  Cell Envelope Stress Response in Pseudomonas aeruginosa.

Authors:  Sylvie Chevalier; Emeline Bouffartigues; Damien Tortuel; Audrey David; Ali Tahrioui; Clarisse Labbé; Magalie Barreau; Anne-Sophie Tareau; Mélissande Louis; Olivier Lesouhaitier; Pierre Cornelis
Journal:  Adv Exp Med Biol       Date:  2022       Impact factor: 3.650

8.  Potentiation of Aminoglycoside Activity in Pseudomonas aeruginosa by Targeting the AmgRS Envelope Stress-Responsive Two-Component System.

Authors:  Keith Poole; Christie Gilmour; Maya A Farha; Erin Mullen; Calvin Ho-Fung Lau; Eric D Brown
Journal:  Antimicrob Agents Chemother       Date:  2016-05-23       Impact factor: 5.191

9.  The MisR Response Regulator Is Necessary for Intrinsic Cationic Antimicrobial Peptide and Aminoglycoside Resistance in Neisseria gonorrhoeae.

Authors:  Justin L Kandler; Concerta L Holley; Jennifer L Reimche; Vijaya Dhulipala; Jacqueline T Balthazar; Artur Muszyński; Russell W Carlson; William M Shafer
Journal:  Antimicrob Agents Chemother       Date:  2016-07-22       Impact factor: 5.191

10.  Rifampicin potentiation of aminoglycoside activity against cystic fibrosis isolates of Pseudomonas aeruginosa.

Authors:  Alaya Mikalauskas; Michael D Parkins; Keith Poole
Journal:  J Antimicrob Chemother       Date:  2017-12-01       Impact factor: 5.790

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.