Literature DB >> 25418049

Novel bluetongue virus in goats, Corsica, France, 2014.

Stéphan Zientara, Corinne Sailleau, Cyril Viarouge, Dirck Höper, Martin Beer, Maria Jenckel, Bernd Hoffmann, Aurore Romey, Labib Bakkali-Kassimi, Aurore Fablet, Damien Vitour, Emmanuel Bréard.   

Abstract

During 2000-2013, 4 genotypes of bluetongue virus (BTV) were detected in Corsica, France. At the end of 2013, a compulsory BTV-1 vaccination campaign was initiated among domestic ruminants; biological samples from goats were tested as part of a corresponding monitoring program. A BTV strain with nucleotide sequences suggestive of a novel serotype was detected.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25418049      PMCID: PMC4257820          DOI: 10.3201/eid2012.140924

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Bluetongue is an infectious, noncontagious, arthropodborne viral disease of domestic and wild ruminants (). Twenty-six distinct bluetongue virus (BTV) serotypes have been identified (). The first detection of bluetongue virus (BTV) on the island of Corsica, France, was in 2000, when sheep were found to be infected with BTV genotype 2 (BTV-2); the virus most likely originated from Sardinia (). In 2003 and 2004, BTV-4 and BTV-16 were detected on Corsica (). Since 2004, no other outbreaks of BTV had been reported on the island until September 2, 2013, when BTV-1 was isolated from 3 flocks of sheep in southern Corsica (). In the following weeks, the virus spread across the island, and by March 2014, 169 outbreaks had been reported.

The Study

During September–December 2013, a total of 1,097 blood and spleen samples were collected from diseased or dead animals on Corsica; the samples were sent to the French National Reference Laboratory at Agence Nationale de Sécurité Sanitaire (Maisons-Alfort, France) to be tested for the presence of BTV. RNA was extracted from the samples and then amplified by using a real-time reverse transcription PCR (RT-qPCR). The ADIAVET BTV Real-time PCR Kit (bioMérieux, Saint Brieuc, France) was used for BTV group (i.e., Orbivirus Bluetongue virus) and serotype 1 detection. The LSI VetMAX European BTV Typing (1-2-4-6-8-9-11-16) Real-time PCR Kit (Life Technologies, Lissieu, France) was used for BTV-2, -4, -9, and -16 serotyping. A total of 531 samples from sheep, cattle, and goats had RT-qPCR results positive for BTV. All genotyped samples were positive only for BTV-1. At the end of 2013, a compulsory vaccination program of domestic sheep, cattle, and goats was initiated by veterinary authorities in France. During the campaign, testing of ruminants with clinical signs of BTV was continued as part of a corresponding monitoring program. During January–April 2014, we analyzed 436 samples from goats; 86 (19.7%) had positive BTV group RT-qPCR results. This method detects the BTV RNA genome segment 10. Of the 86 BTV-positive samples, 73 with a cycle threshold (Ct) value of <35 were genotyped: 57 (78.0%) of the samples were classified as BTV-1, and 10 (13.7%) were classified as non–BTV-1, -2, -4, -9, -16, and -25. By using various primers (Table) with a conventional in-house RT-PCR that amplifies a region of the BTV RNA genome segment 2, we obtained an amplicon for each of the 10 samples that were negative for BTV-1, -2, -4, -9, -16, and -25 (segment 2 encodes viral protein 2 and determines the serotype). The animals from which these samples came were in 5 herds that were sampled in January and February 2014. One of the 10 amplified products (806 bp) was sequenced directly and compared with homologous sequences available in the GenBank database; Blast 2.2.28 (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used for the comparison. Because the genome sequence was similar to that of the BTV-25 segment 2, we selected different primers, and by gene walking, we obtained the full coding sequence of the gene.
Table

Primers and probe used to detect the BTV strain BTV-n in samples from goats, Corsica, France, 2014*

PCR typeTargetProbe and primer namesPrimer sequence, 5′ → 3′Nucleotide location
Conventional BTV RT-PCRSegment 2PFYRWTTGATTTTGARAARGA1549–1566


PR
GAAYCGACCACTGCCTATG
2355–2337
Conventional RT-PCRBTV-n segment 2BTV-n FCAGATCTGGTTTTACCGAG1546–1564


BTV-n R
ATGATCCATCGGACTTAACT
1949–1927
Real-time RT-PCRBTV-n segment 2BTV-n F3TGGATCATGATGGTTATGAACACC1942–1966
BTV-n R3CGCCTCTCCAATCTCACGTATT2102–2081
BTV-nFAM-TGACTATGCGAGGTTGG-MGB1987–2004

*BTV, bluetongue virus; RT, reverse transcription; PF, forward primer; PR, reverse primer.

*BTV, bluetongue virus; RT, reverse transcription; PF, forward primer; PR, reverse primer. BLASTN 2.2.29 (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to align sequences: the virus showed highest identity with the BTV-25 and BTV-26 serotypes circulating in Switzerland and Kuwait, respectively (,) (Figure). The complete segment 2 sequence of this new virus from Corsica (termed BTV-n; GenBank accession no. KM200718) shared 73% nt and 75% aa identify with BTV-25 sequences and 65% nt and 60% aa identity with BTV-26 sequences.
Figure

Phylogenetic tree of segment 2, showing relationships between BTV-n (boldface) and other BTV strains available in GenBank (accession nos. are shown in parentheses). Scale bar represents the percentage of nucleotide substitutions. BTV, bluetongue virus.

Phylogenetic tree of segment 2, showing relationships between BTV-n (boldface) and other BTV strains available in GenBank (accession nos. are shown in parentheses). Scale bar represents the percentage of nucleotide substitutions. BTV, bluetongue virus. We developed a conventional in-house RT-PCR and an RT-qPCR that enabled specific detection of BTV-n by selection of BTV-n–specific primers and probe (Table). We could not detect BTV-n virus genome in any cattle or sheep samples tested in 2014, and we did not detect any co-infections with BTV-1 and BTV-n. We attempted to isolate BTV-n from blood samples of the 10 BTV-n–positive goats; BTV-group Ct values for the samples ranged from 28.6 to 34.2. After many isolation attempts using embryonated chicken eggs as well as KC cells (a Culicoides sonorensis–derived cell line), Vero cells, and BHK (baby hamster kidney) cells, we isolated 1 virus strain by using BSR (a clone of BHK-21) cells. We used supernatants to conduct a BTV-n–specific RT-qPCR (primers shown in Table); the resulting Ct value of <17, indicated efficient virus replication. The virus was not neutralized by the reference antisera raised against BTV genotypes 1–24 and 26 or by an anti–BTV-25 serum (a titrated anti–BTV-25 serum is not available). During May 2014, blood samples were collected from 56 goat bucks on a breeding farm located in the same area as the farms with the 4 previously sampled BTV-n–positive herds. Of the 56 sampled bucks, 51 were BTV-n positive by the BTV group–specific RT-qPCR (Ct value range 27.7–37.8). No buck was BTV-1 positive by the RT-qPCR, but 43 were positive by the BTV-n RT-qPCR; for the other 8 bucks, Ct values were beyond the positive range. Many of the bucks had not been vaccinated against BTV and showed no clinical signs of infection.

Conclusions

We report the detection and identification of a new BTV, BTV-n, that is circulating among goats on Corsica. BLAST analysis of the BTV-n RNA segment 2 suggests that this virus most likely belongs to the BTV serogroup. However, full-genome segment 2 sequence identity between BTV-n and its closest BTV relative, BTV-25, was low (73.0% homologous); thus, BTV-n may be a novel serotype. Some criteria for defining serotype/nucleotype have been defined by Maan et al. () and Hofmann et al. (). Comparison of the segment 2 nucleotide sequences of the 26 BTV serotypes enabled definition of 12 nucleotypes; members of the same segment 2 nucleotype are characterized by at least 66.9% identity in their segment 2 nucleotide sequences (). Our findings show that BTV-n shares 73.0% identity with the full genome segment 2 sequence of BTV-25. According to criteria defined by Maan et al. (), BTV-n cannot be considered a new nucleotype and seems to belong to the BTV-25 nucleotype. Maan et al. () also showed that the differences in segment 2 sequences correspond to differences in serotypes. They reported overall interserotype variations in segment 2 of 29.0% (BTV-8 and BTV-18) to 59.0% (BTV-16 and BTV-22); the deduced amino acid sequence of VP2 varied from 22.4% (BTV-4 and BTV-20) to 73.0% (BTV-6 and BTV-22) (). However, unlike BTV-25, BTV-n can grow in BSR cells (7,9). Like BTV-25 () and BTV-26 strains, BTV-n has been detected in goats without clinical signs and symptoms of infection. All of the samples positive for BTV-n by RT-qPCR were from healthy bucks, and most BTV samples from clinically affected goats were negative for BTV group by RT-qPCR. Thus, it is also likely that BTV-n is not pathogenic for goats. We suggest, on the basis of the following findings, that the newly detected BTV-n strain could be a new serotype: the differences between BTV-n sequences and other BTV sequences were as high as those described by Maan et al. (); BTV-n is genetically diverse from other BTVs; BTV-n could not be amplified by the BTV-25–specific RT-PCR; anti–BTV-25 serum could not neutralize BTV-n; and, unlike BTV-25, BTV-n can be cultivated on BSR cells (,). No information is available about the origin of this new BTV strain; more in-depth investigation is needed to determine when and how the virus arrived in Corsica. Additional genome sequencing and experiments in various ruminant species are planned. These studies will help characterize this new BTV strain and evaluate the duration of viremia, humoral immune response, and pathogenicity of this serotype.
  9 in total

1.  Identification of bluetongue virus serotype 2 (Corsican strain) by reverse-transcriptase PCR reaction analysis of segment 2 of the genome.

Authors:  S Zientara; C Sailleau; G Dauphin; C Roquier; E M Rémond; F Lebreton; S Hammoumi; E Dubois; C Agier; G Merle; E Bréard
Journal:  Vet Rec       Date:  2002-05-11       Impact factor: 2.695

2.  Bluetongue vaccination in Europe.

Authors:  Stéphan Zientara; Nigel James MacLachlan; Paolo Calistri; Jose-Manuel Sanchez-Vizcaino; Giovanni Savini
Journal:  Expert Rev Vaccines       Date:  2010-09       Impact factor: 5.217

3.  Emergence of Bluetongue Virus Serotype 1 in French Corsica Island in September 2013.

Authors:  C Sailleau; C Viarouge; E Bréard; J B Perrin; V Doceul; D Vitour; S Zientara
Journal:  Transbound Emerg Dis       Date:  2014-01-24       Impact factor: 5.005

4.  Detection of Toggenburg Orbivirus by a segment 2-specific quantitative RT-PCR.

Authors:  Martin A Hofmann; Sandra Renzullo; Jeannette Planzer; Markus Mader; Valérie Chaignat; Barbara Thuer
Journal:  J Virol Methods       Date:  2010-02-26       Impact factor: 2.014

5.  In vivo and in vitro propagation and transmission of Toggenburg orbivirus.

Authors:  Jeannette Planzer; Christian Kaufmann; Gabriella Worwa; Dolores Gavier-Widén; Martin A Hofmann; Valérie Chaignat; Barbara Thür
Journal:  Res Vet Sci       Date:  2011-03-31       Impact factor: 2.534

6.  Analysis and phylogenetic comparisons of full-length VP2 genes of the 24 bluetongue virus serotypes.

Authors:  S Maan; N S Maan; A R Samuel; S Rao; H Attoui; P P C Mertens
Journal:  J Gen Virol       Date:  2007-02       Impact factor: 3.891

7.  Complete genome characterisation of a novel 26th bluetongue virus serotype from Kuwait.

Authors:  Sushila Maan; Narender S Maan; Kyriaki Nomikou; Eva Veronesi; Katarzyna Bachanek-Bankowska; Manjunatha N Belaganahalli; Houssam Attoui; Peter P C Mertens
Journal:  PLoS One       Date:  2011-10-21       Impact factor: 3.240

8.  Novel bluetongue virus serotype from Kuwait.

Authors:  Sushila Maan; Narender S Maan; Kyriaki Nomikou; Carrie Batten; Frank Antony; Manjunatha N Belaganahalli; Attia Mohamed Samy; Ammar Abdel Reda; Sana Ahmed Al-Rashid; Maha El Batel; Chris A L Oura; Peter P C Mertens
Journal:  Emerg Infect Dis       Date:  2011-05       Impact factor: 6.883

9.  Genetic characterization of toggenburg orbivirus, a new bluetongue virus, from goats, Switzerland.

Authors:  Martin A Hofmann; Sandra Renzullo; Markus Mader; Valérie Chaignat; Gabriella Worwa; Barbara Thuer
Journal:  Emerg Infect Dis       Date:  2008-12       Impact factor: 6.883

  9 in total
  43 in total

1.  A protective bivalent vaccine against Rift Valley fever and bluetongue.

Authors:  Eva Calvo-Pinilla; Alejandro Marín-López; Sandra Moreno; Gema Lorenzo; Sergio Utrilla-Trigo; Luis Jiménez-Cabello; Julio Benavides; Aitor Nogales; Rafael Blasco; Alejandro Brun; Javier Ortego
Journal:  NPJ Vaccines       Date:  2020-07-30       Impact factor: 7.344

2.  Isolation and Characterization of Bluetongue Virus Recovered from Blood Samples by Immunoaffinity Purification.

Authors:  Karam Chand; Sanchay K Biswas; Bimalendu Mondal
Journal:  Indian J Microbiol       Date:  2018-05-08       Impact factor: 2.461

3.  Novel Function of Bluetongue Virus NS3 Protein in Regulation of the MAPK/ERK Signaling Pathway.

Authors:  Damien Vitour; Grégory Caignard; Cindy Kundlacz; Marie Pourcelot; Aurore Fablet; Rayane Amaral Da Silva Moraes; Thibaut Léger; Bastien Morlet; Cyril Viarouge; Corinne Sailleau; Mathilde Turpaud; Axel Gorlier; Emmanuel Breard; Sylvie Lecollinet; Piet A van Rijn; Stephan Zientara
Journal:  J Virol       Date:  2019-07-30       Impact factor: 5.103

4.  Genetic and phylogenetic characterization of polycistronic dsRNA segment-10 of bluetongue virus isolates from India between 1985 and 2011.

Authors:  Sanchay Kumar Biswas; Bimalendu Mondal; Karam Chand; Sushmita Nautiyal; Saravanan Subramaniam; Karam Pal Singh; Vivek Kumar Gupta; Muthannan Andavar Ramakrishnan
Journal:  Virus Genes       Date:  2021-06-12       Impact factor: 2.332

5.  Turnover Rate of NS3 Proteins Modulates Bluetongue Virus Replication Kinetics in a Host-Specific Manner.

Authors:  Najate Ftaich; Claire Ciancia; Cyril Viarouge; Gerald Barry; Maxime Ratinier; Piet A van Rijn; Emmanuel Breard; Damien Vitour; Stephan Zientara; Massimo Palmarini; Christophe Terzian; Frédérick Arnaud
Journal:  J Virol       Date:  2015-08-05       Impact factor: 5.103

6.  Epidemiological characteristics and clinicopathological features of bluetongue in sheep and cattle, during the 2014 BTV serotype 4 incursion in Greece.

Authors:  Panagiotis-Dimitrios Katsoulos; Nektarios D Giadinis; Serafeim C Chaintoutis; Chrysostomos I Dovas; Evangelos Kiossis; Georgios Tsousis; Vassilios Psychas; Ioannis Vlemmas; Theologos Papadopoulos; Orestis Papadopoulos; Stéphan Zientara; Harilaos Karatzias; Constantinos Boscos
Journal:  Trop Anim Health Prod       Date:  2016-01-14       Impact factor: 1.559

7.  Entry-competent-replication-abortive African horse sickness virus strains elicit robust immunity in ponies against all serotypes.

Authors:  Edward Sullivan; Sylvie Lecollinet; Adeline Kerviel; Erika Hue; Stéphane Pronost; Cécile Beck; Marine Dumarest; Stephan Zientara; Polly Roy
Journal:  Vaccine       Date:  2021-05-03       Impact factor: 3.641

8.  Putative Novel Atypical BTV Serotype '36' Identified in Small Ruminants in Switzerland.

Authors:  Christina Ries; Andrea Vögtlin; Daniela Hüssy; Tabea Jandt; Hansjörg Gobet; Monika Hilbe; Carole Burgener; Luzia Schweizer; Stephanie Häfliger-Speiser; Martin Beer; Bernd Hoffmann
Journal:  Viruses       Date:  2021-04-21       Impact factor: 5.048

9.  The Bluetongue Disabled Infectious Single Animal (DISA) Vaccine Platform Based on Deletion NS3/NS3a Protein Is Safe and Protective in Cattle and Enables DIVA.

Authors:  Piet A van Rijn; Mieke A Maris-Veldhuis; René G P van Gennip
Journal:  Viruses       Date:  2021-05-07       Impact factor: 5.048

10.  Environment, vector, or host? Using machine learning to untangle the mechanisms driving arbovirus outbreaks.

Authors:  Moh A Alkhamis; Nicholas M Fountain-Jones; Cecilia Aguilar-Vega; José M Sánchez-Vizcaíno
Journal:  Ecol Appl       Date:  2021-08-23       Impact factor: 6.105

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.