Literature DB >> 25375111

The complete mitochondrial genome of Aix galericulata and Tadorna ferruginea: bearings on their phylogenetic position in the Anseriformes.

Gang Liu1, Lizhi Zhou1, Bo Li1, Lili Zhang1.   

Abstract

Aix galericulata and Tadorna ferruginea are two Anatidae species representing different taxonomic groups of Anseriformes. We used a PCR-based method to determine the complete mtDNAs of both species, and estimated phylogenetic trees based on the complete mtDNA alignment of these and 14 other Anseriforme species, to clarify Anseriform phylogenetics. Phylogenetic trees were also estimated using a multiple sequence alignment of three mitochondrial genes (Cyt b, ND2, and COI) from 68 typical species in GenBank, to further clarify the phylogenetic relationships of several groups among the Anseriformes. The new mtDNAs are circular molecules, 16,651 bp (Aix galericulata) and 16,639 bp (Tadorna ferruginea) in length, containing the 37 typical genes, with an identical gene order and arrangement as those of other Anseriformes. Comparing the protein-coding genes among the mtDNAs of 16 Anseriforme species, ATG is generally the start codon, TAA is the most frequent stop codon, one of three, TAA, TAG, and T-, commonly observed. All tRNAs could be folded into canonical cloverleaf secondary structures except for tRNASer (AGY) and tRNALeu (CUN), which are missing the "DHU" arm.Phylogenetic relationships demonstrate that Aix galericula and Tadorna ferruginea are in the same group, the Tadorninae lineage, based on our analyses of complete mtDNAs and combined gene data. Molecular phylogenetic analysis suggests the 68 species of Anseriform birds be divided into three families: Anhimidae, Anatidae, and Anseranatidae. The results suggest Anatidae birds be divided into five subfamilies: Anatinae, Tadorninae, Anserinae, Oxyurinae, and Dendrocygninae. Oxyurinae and Dendrocygninae should not belong to Anserinae, but rather represent independent subfamilies. The Anatinae includes species from the tribes Mergini, Somaterini, Anatini, and Aythyini. The Anserinae includes species from the tribes Anserini and Cygnini.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25375111      PMCID: PMC4222781          DOI: 10.1371/journal.pone.0109701

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Anseriformes is a highly differentiated order of birds with worldwide distribution, containing more than 150 species [1], [2]. Anseriformes is one of the best-studied groups of birds, largely owing to the group's historic importance in hunting, domestication, and aviculture [3]. The phylogenetic relationships among the Anseriformes, especially the phylogenetic position of several important species and groups, are rather complex and controversial, and have been affected by rearrangements several times throughout history [1], [2], [3]. Mandarin duck (Aix galericulata) and Ruddy shelduck (Tadorna ferruginea) are two typical Anseriform waterfowl, yet their phylogenetic status has remained controversial [3]. Traditionally, Aix galericulata belongs in Tadornini, and Tadorna ferruginea is a member of Cairinini; both of them placed inside Anatinae. The two birds have a moderately large body size, contrastingly pale dorsal wing-coverts, and blunt carpal (wing) spurs, along with other shared morphological characteristics; and both also feed through a combination of wading and dabbling [3]. All of these characteristics lie between the true ducks (Anatinae) and true geese (Anserinae) in terms of anatomy and behavior [12]. Accordingly, some authors believe Aix and Tadorna form an independent lineage together, the subfamily Tadorninae [8]. However, this view has often been challenged, and relationships within Tadorninae/Tadornini remain problematic, in particular, the taxonomy and systematic relationships within the groups. Many authors support Cairina a so-called “perching duck”, and Aix clustering together as a sister group, belonging to Tadornini [1], [2], [3]. Others suggest that Aix and Cairina should to be placed in their own tribe, Cairinini, within Anatinae [6]. However, still other authors consider the genera Aix and Cairina as forming the subtribe Cairinina, placed in the tribe Anatini [9]. Even other authors suggest that Tadornini (containing Aix and Cairina) should not belong to Anatinae at all, but rather represents the independent subfamily Tadorninae, placed in Anatidae [3]. Researchers have also used molecular evidence, based on combined Cyt b and ND2 gene sequences, to suggest placing Aix and Tadorna together as a tribe in the Anatinae [2]. These authors have also grouped the shelducks (Tadorna) together with the sheldgeese (Cyanochen, Alopochen, Neochen and Chloephaga), forming the tribe Tadornini, based on morphological and molecular data, but consider it a non-monophyletic grouping [2]. To add to the confusion, traditional primitive characters used to define “perching ducks” describes a polyphyletic grouping, because similar morphological, biochemical, and behavioral characteristics occur in many differing genera, including Anseranas, Dendrocygna, Sarkidiornis, Tadorna, Cairina, Aix, and Chenonetta [13]. Nonetheless, important groups in the Anseriformes remain controversial. Traditionally, the order Anseriformes has been considered to be composed of the families Anhimidae (two genera and three species) and Anatidae (approximately 41 genera and 147 species, including Anseranas semipalmata) [1]. However, some authors suggest that it should be divided into three families: Anhimidae, Anatidae, and Anseranatidae, the latter only containing one species, Anseranas semipalmata [1], [2]. The family Anhimidae is supported by both morphological and molecular data, usually without controversy [1], [3]. A major source of conflict at the family level is centered around Anseranas semipalmata, that is, whether it should be considered a member of an independent family by itself, or whether it is contained within a subfamily of Anatidae [1], [2], [4], [5], [6]. The Anatidae comprises the largest number of species in Anseriformes, and traditionally was divided into two subfamilies: Anatinae and Anserinae [1], [2], [3], [7], [8]. However, this view has been challenged by several authors, who recognize five subfamilies within Anatidae: Anatinae, Anserinae, Oxyurinae, Dendrocygninae, and Anseranatinae [2], [9], [10]. Anatinae, Anserinae, and Dendrocygninae are supported by previously published mtDNA data [10]. The stiff-tailed ducks (Oxyurinae/Oxyurini) include some of the most distinctive waterfowl species, showing the greatest sexual size dimorphism [11]. Most of its members have long stiff-tail feathers, which are erected at rest, and relatively large, swollen bills [3]. According to morphological and behavioral characteristics, stiff-tailed ducks (Oxyurinae/Oxyurini) appear to be closer to swans and true geese than they are to typical ducks [3]. Previously the group was considered to be a comparatively primitive member of the tribe Oxyurini; however, some authors do not support this view and considered it to be a subfamily, Oxyurinae [3]. Its relationships are still enigmatic, and are subject to considerable debate regarding its validity and circumscription [3], [11]. Systematic controversies concerning the stiff-tailed ducks (Oxyurinae/Oxyurini) have focused on whether they constitute a tribe or a subfamily, and often consider it to be close to Anserinae, not within Anatinae at all, and agree with morphology-based studies [8], [9], [11]. Mitochondrial DNA is a powerful, increasingly popular, and widely used molecular marker for the estimation of the animal phylogenetic relationships. It has become a major tool of comparative genomics and plays an important role in phylogenetic studies, comparative and evolutionary genomics, and molecular evolutionary analyses, owing to its maternal inheritance, lack of recombination, and accelerated nucleotide substitution rates compared with those of the nuclear DNA [14], [15]. Here, we attempt to resolve the controversial Aves species using mtDNA analyses. Our newly completed mitochondrial genomes should provide new insights into the phylogenetic position of important species, and yield insight into the higher-level systematics of Anseriform birds. Early molecular work disentangling the phylogeny of the Anseriformes was mostly based on one or a few mitochondrial loci, almost always including Cyt b, ND2, and/or control region (CR) sequences [1], [2]. However, complete mtDNA sequences have become increasingly important for comprehensive evolutionary and phylogenetic studies [10], [15], [16]. Several analyses have demonstrated that complete mtDNA provides higher levels of phylogenetic support than those based on individual or partial mitogenomes [10], [15], [16], [17], [18], [19]. Complete mtDNA sequences are not only more informative than shorter sequences of individual genes, but also provide reliable information toward the inference of phylogenetic relationships among controversial animals [17], [19], [20], [21]. Consequently, complete mtDNA genomes are becoming a preferred marker for resolving controversial species relationships, and are increasingly important for comprehensive evolutionary studies [10], [14], [15], [16], [22]. However, very few Anseriform birds are currently represented with complete mtDNAs, consequently, a number of Anseriform species and their phylogenetic relationships remain unresolved. We sequenced the complete mtDNA of two important Anseriform birds, from the genera Aix and Tadorna, in this study. We also analyzed the nucleotide composition, codon usage, and compositional biases of the mitogenomes. Our phylogenomic analysis should shed increased light on the phylogenetic status of Aix galericulata and Tadorna ferruginea, and on the phylogenetic relationships of other important groups of Anseriformes.

Results

Genome organization and arrangement

The complete mtDNAs of Aix galericulata and Tadorna ferruginea are 16,651 and 16,639 bp in length, respectively. Both contain the typical set of 37 genes, including 13 protein-coding genes (PCGs) (ATP6, ATP8, COI-III, ND1-6, ND4L, and Cyt b), two rRNAs (12S rRNA and 16S rRNA), 22 tRNAs and a putative CR (D-loop) (Table 1). The heavy (H-) DNA strand carries most of the genes, 12 PCGs, two rRNAs, and 14 tRNAs. ND6 and eight tRNAs are located on the light (L-) strand (Table 1).
Table 1

Organization of the complete mtDNAs of Aix galericulata and Tadorna ferruginea.

GeneDirection Aix galericulata Tadorna ferruginea
Nucleotide noSizeStart codonStop codonNucleotide noSizeStart codonStop codon
D-loopF1–107110711–10771077
tRNAPhe F1072–1139681078–114770
12S rRNAF1140–21369971148–2129982
tRNAVal F2137–2208722130–220071
16S rRNAF2209–381216042201–38101610
tRNALeu F3813–3886743811–388474
ND1F3893–4870978ATGAGG3891–4868978ATGAGG
tRNAIle R4869–4941734867–493973
tRNAGln F4949–5019714947–501771
tRNAMet F5019–5087695017–508569
ND2F5088–61281041ATGTAA5086–61261041ATGTAG
tRNATrp R6127–6203776125–619975
tRNAAla R6207–6275696203–627169
tRNAAsn R6276–6353786274–634673
tRNACys R6354–6418656347–641165
tRNATyr F6419–6492746412–648271
COIR6494–80441551GTGAGG6484–80341551GTGAGG
tRNASer (UCN) F8036–8108738026–809873
tRNAAsp F8111–8179698101–816969
COIIF8181–8867687GTGTAA8171–8857687ATGTAA
tRNALys F8869–8937698859–892769
ATP8F8939–9106168ATGTAA8929–9096168ATGTAA
ATP6F9097–9780684ATGTAA9087–9770684ATGTAA
COIIIF9780–10563784ATGT-9770–10541772ATGT-
tRNAGly F10564–106326910542–1061069
ND3F10633–10984352ATGTAG10611–10962352ATGTAG
tRNAArg F10986–110557010964–1103370
ND4LF11056–11352297ATGTAA11034–11330297ATGTAA
ND4F11355–127231369ATTT-11333–127011369ATTT-
tRNAHis F12724–127926912702–1277069
tRNASer (AGY) F12793–128596712771–1283666
tRNALeu (CUN) F12859–129297112836–1290772
ND5F12930–147561827GTGTAA12908–147281821GTGTAA
Cyt bF14756–158981143ATGTAA14728–158701143ATGTAA
tRNAThr R15901–159696915872–1594069
tRNAPro R15982–160517015951–1602070
ND6R16062–16583522ATGTAG16031–16552522ATGTAG
tRNAGlu F16584–166516816553–1663987

Protein-coding genes

Through the 13 protein-coding genes, ATG is the start codon in nine of the 13 PCGs in Aix galericulata, but ND4 starts with ATT, while COI, COII, and ND5 begin with the nonstandard start codon GTG. In Tadorna ferruginea ten PCGs start with ATG, and ATT is the start codon only in ND4, while COI and ND5 begin with GTG. The standard stop termination codon TAA occurs in most of the same genes in the two birds' mtDNAs, except ND2 stops with TAA in Aix galericulata and TAG in Tadorna ferruginea. Furthermore, AGG terminates the ND1 and COI genes, TAG terminates the ND3 and ND6 gene, and the incomplete termination codon T- occurs in the COIII and ND4 genes in both birds.

Ribosomal RNA, transfer RNA, and non-coding regions

In Aix galericulata and Tadorna ferruginea 12S rRNA (997 bp and 982 bp, respectively) and 16S rRNA (1,604 bp and 1,610 bp, respectively) genes are located between the tRNAPhe and tRNALeu genes, separated by the tRNAVal gene. The two complete mtDNAs contain 22 tRNAs genes, and except for tRNASer (AGY) and tRNALeu (CUN), which lack dihydrouridine (DHU) arms, all other tRNAs could be folded into the typical cloverleaf structure. The longest tRNAs are tRNAAsn (78 bp) and tRNAGlu (87 bp) in Aix galericulata and Tadorna ferruginea, respectively, and the shortest is tRNACys (65 bp in both). Non-coding regions in the mtDNAs include the CRs and a few intergenic spacers. The CRs are located between the tRNAGlu and tRNAPhe genes, which are 1,071 bp and 1,077 bp, respectively, in Aix galericulata and Tadorna ferruginea. Additionally, 11 gene junction regions spacer by a total of 31 bp, with the longest one being 10 bp between ND6 and tRNAGlu in Aix galericulata (Table 1). There are a total of 55 bp spacer region at 12 gene junctions in Tadorna ferruginea (Table 1).

Phylogenetic reconstructions

Our chosen 16 Anseriforme species represent two major branches of the Anseriformes phylogeny with highly similar topologies and only slight differences in bootstrap support and posterior probability values (Figure 1). The first branch is Anatidae and the second is Anseranatidae. Anatidae contains Anatinae, Tadorninae, Anserinae, and Dendrocygninae; and Anseranatidae only contains Anseranas semipalmata. Anatinae and Tadorninae are sister groups, grouped together nestled within the clades Anserinae and Dendrocygninae. Mergini, Anatini, and Aythyini form Anatinae; Anserinae contains Anserini and Aythyini. Aix galericulata and Tadorna ferruginea are in the Tadorninae group.
Figure 1

Phylogenetic relationships among the 16 Anseriforme species based on complete mtDNA sequences.

Numbers at each node are Bayesian posterior probabilities (left) and maximum likelihood bootstrap proportions (estimated from 100 pseudoreplicates) (right).

Phylogenetic relationships among the 16 Anseriforme species based on complete mtDNA sequences.

Numbers at each node are Bayesian posterior probabilities (left) and maximum likelihood bootstrap proportions (estimated from 100 pseudoreplicates) (right). Phylogenetic analysis was also performed on a concatenated Cyt b, ND2, and COI genes among 68 Anseriforme species. The trees from the maximum likelihood (ML) and Bayesian inference (BI) analyses share identical topologies and high node support values (Figure 2). The results indicate that Anseriformes could be divided into three branches: Anatidae, Anseranatidae, and Anhimidae. Anatidae and Anseranatidae are sister branchs, then grouped with Anhimidae. Anatidae contains five clades: Anatinae, Tadorninae, Anserinae, Oxyurinae, and Dendrocygninae. The Anatinae, includes species from the tribes Mergini, Somaterini, Anatini, and Aythyini. This subfamily is a sister group to Tadorninae, comprising Aix, Cairina, Tadorna, and Chloephaga. These two subfamilies form a clade that is in a sister group relationship with Anserinae, comprising the tribes Anserini and Cygnini. In turn, this clade is sister to the remaining Oxyurinae and Dendrocygninae. All of them are grouped with families Anseranatidae and Anhimidae.
Figure 2

Phylogenetic relationships among the 68 Anseriforme species based on Cyt b, ND2, and COI genes.

Numbers at each node indicate Bayesian posterior probabilities (left) and maximum likelihood bootstrap proportions (from 100 pseudoreplicates) (right).

Phylogenetic relationships among the 68 Anseriforme species based on Cyt b, ND2, and COI genes.

Numbers at each node indicate Bayesian posterior probabilities (left) and maximum likelihood bootstrap proportions (from 100 pseudoreplicates) (right).

Discussion

Mitochondrial genome annotation and features

The gene order and arrangement of the two new mtDNA sequences, including such features as gene length, base composition, and RNA structure, are extremely conservative, and similar to that of other Anseriform birds [10], [16], [23], [24]. The overall base composition is similar to other Anseriforme species, for example, A+T content is higher than C+G content, conforming to other Anseriforme species (51.6–55.7%) [10], [16], [23], [24]. The relative abundance of nucleotides is C>A>T>G, reflecting the strong AT bias [10], [16]. Guanine is the rarest nucleotide. Results indicate that all Anseriformes mtDNAs so far sequenced have the same gene order and arrangement, no introns, no long intergenic spacers, and only a few overlapping sequences [10], [16]. All genes are encoded on the same arrangement, and there are no missing or duplicated genes [10], [16]. Among the 16 mtDNAs the longest is from Anseranas semipalmata (16,870 bp), and the shortest is Anas formosa (16,594 bp). Homologous regions comprise 12,748 bp, representing 79.68% of the complete genome (Table 2). The 16 genomes generally have the highest transition/transversion ratio in closely-related species [25]. The A, T, and A+T compositions are similar, and shared with a strong AT bias and rare guanines (Table 2). Metazoan mtDNA usually present a clear strand bias in nucleotide composition; this strand bias can be measured as AT-skew and GC-skew [26]. All of the Anseriformes mtDNAs exhibit a slight AT-skew (average value: 0.137), ranging from 0.125 in Dendrocygna javanica to 0.147 in Tadorna ferruginea (Table 2). The GC-skew ranges from −0.377 (Anseranas semipalmata) to −0.327 (Dendrocygna javanica), with an average value of −0.353 (Table 2).
Table 2

Nucleotide composition (%) of some Anseriforme mitochondrial genomes.

SpeciesT (%)C (%)A (%)G (%)A+T (%)G+C (%)AT-skewGC-skewTotal nucleotide
Anser albifrons 22.6332.0530.1515.1852.7847.230.142−0.35716 737
Anser anser 22.5832.1430.1915.0952.7747.230.144−0.36116 738
Anser fabalis 22.7431.8430.0615.3652.8047.200.138−0.34916 688
Anas formosa 22.5132.4429.5215.5352.0347.970.134−0.35316 594
Anas platyrhynchos 22.1932.5229.2116.0851.4048.600.136−0.33816 606
Aythya americana 22.2432.7529.3915.6251.6048.400.138−0.35416 616
Anseranas semipalmata 23.4931.3830.9214.2154.4145.590.136−0.37716 870
Branta canadensis 22.6032.0730.1815.1552.7847.220.143−0.35816 760
Cygnus columbianus 22.7931.8930.1015.2252.8947.110.138−0.35416 728
Cygnus atratus 22.2032.5529.5215.7351.7248.280.142−0.34816 748
Cairina moschata 21.9332.9529.0016.1254.8845.120.129−0.37316 610
Dendrocygna javanica 23.6730.4430.4415.4554.1145.890.125−0.32716 753
Mergus squamatus 22.2632.7629.0415.9451.3048.700.132−0.34516 595
Anas falcata 22.3532.6528.8916.1151.2448.760.128−0.33916 601
Aix galericulatata 22.3632.6529.2415.7551.6048.400.133−0.34916 651
Tadorna ferruginea 22.0032.9629.5715.4751.5748.430.147−0.36116 639

Comparison of protein-coding genes

We compared the total length of the 13 PCGs in Aix galericulata and Tadorna ferruginea with other Anseriform birds. Lengths among them are quite similar and very conservative; the longest one is Aix galericulata (11,403 bp) and the shortest is Anser fabalis (11,328 bp). The 13 PCGs have a total length of 11,331 bp in Aix galericulata and 11,385 bp in Tadorna ferruginea, which is 68.05% and 68.42% of each entire mtDNA genome, respectively. In both species, the longest gene is ND5, located between the tRNALeu (CUN) and Cyt b genes, and the shortest is ATP8, which is between the tRNALys and ATP6 genes. Most PCGs used ATG as start codons, only a few start with GTG, GTC, or ATA. Stop codons are also similar across species, with TAA, TAG, and T- occurring most frequently. In Tadorna ferruginea and Tadorna ferruginea, the start condons are ATG, GTG and ATT, and TAA, AGG, TAG and T- as stop termination codons occur in most of the same genes in the two birds' mtDNAs. Among the 13 PCGs, specific examples include the following: the COI initiation codon is GTG and the termination codon is AGG in all 16 species; Cyt b starts with ATG and ends with TAA; COII starts with ATG and ends with TAG, except in Branta canadensis, where it starts with GTC; ND6 starts with ATG and ends with TAG, except in Anser fabalis it ends with TAA; ND1 starts with ATG and ends with AGG, except in Anser albifrons where the stop codon is TAA; and ND2 starts with ATG and ends with TAG, except in Anseranas semipalmata, Cygnus atratus, and Tadorna ferruginea, where the stop codon is TAA (Table 3).
Table 3

Predicted initiation and termination codons for 13 mitochondrial PCGs in the 16 Anseriforme species.

GenePredicted initiation and termination
ABCDEFGHIJKLMNOP
ND1ATG/TAAATG/AGGATG/AGGATG/AGGATG/AGGATG/AGGATA/AGGATG/AGGATG/AGGATG/AGGATG/AGGATG/AGGATG/AGGATG/AGGATG/AGGATG/AGG
ND2ATG/TAGATG/TAGATG/TAGATG/TAAATG/TAGATG/TAGATG/TAGATG/TAGATG/TAGATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAG
COIGTG/AGGGTC/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGGGTG/AGG
COIIGTG/TAAGTG/TAAGTC/TAAGTG/TAAGTG/TAAGTG/TAAGTG/TAAGTG/TAAGTG/TAAATG/TAAGTG/TAAGTG/TAAGTG/TAAGTG/TAAGTG/TAAGTG/TAA
ATP8ATA/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATT/TGGAT G/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAA
ATP6ATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAA
COIIIATG/TAAATG/T-ATG/TAAATG/T-ATG/T-ATG/T-ATG/T-ATG/T-ATG/T-ATG/T-ATG/TAAATG/TAAATG/T-ATG/TAAATG/T-ATG/T-
ND3ATG/TAGATG/TAAATG/TAAATG/TAGATG/TAAATG/AGGATG/TAAATG/TAAATG/TAAATA/TAAATG/T-ATG/TAAATG/TAAATG/TAAATG/TAGATG/TAG
ND4LATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/T-GTG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAA
ND4ATG/T-ATC/T-ATG/T-ATG/T-ATG/T-ATG/T-ATG/T-ATG/TAAATG/T-ATG/T-ATG/TAAATG/TAAATG/TAAATG/TAGATG/T-ATG/T-
ND5GTG/TAAGTG/AGAAGT/TAAGTG/AGAGTG/AGAGTG/TAAGTG/TAAGTG/TAAGTG/TAAATG/AGAGTG/AGAGTG/TAAGTG/AGAGTG/TAAGTG/TAAGTG/TAA
CytbATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAA
ND6ATG/TAGATG/TAGATG/TAGATG/TAGATG/TAGATG/TAGATG/TAGATG/TAGATG/TAGATG/TAGATG/TAGATG/TAGATG/TAAATG/TAGATG/TAGATG/TAG

Notes: A: Anser albifrons (NC_004539), B: Anser anser (NC_011196), C: Branta canadensis (NC_0071011), D: Cygnus atratus (NC_012843), E: Cygnus columbianus (NC_007691), F: Mergus merganser (NC_016723), G: Cairina moschata (NC_010965), H: Anas platyrhynchos (NC_009684), I: Aythya americana (NC_000877), J: Anseranas semipalmata (NC_005933), K: Dendrocygna javanica (NC_012844), L: Anas formosa (NC_015482), M: Anas fabalis (NC_016922), N: Anas falcata, O: Aix galericulata (this study), P: Tadorna ferruginea (this study).

Notes: A: Anser albifrons (NC_004539), B: Anser anser (NC_011196), C: Branta canadensis (NC_0071011), D: Cygnus atratus (NC_012843), E: Cygnus columbianus (NC_007691), F: Mergus merganser (NC_016723), G: Cairina moschata (NC_010965), H: Anas platyrhynchos (NC_009684), I: Aythya americana (NC_000877), J: Anseranas semipalmata (NC_005933), K: Dendrocygna javanica (NC_012844), L: Anas formosa (NC_015482), M: Anas fabalis (NC_016922), N: Anas falcata, O: Aix galericulata (this study), P: Tadorna ferruginea (this study). Some mtDNA PCGs are particularly worthy of note. Avian species generally exhibit moderate levels of sequence divergence in some mitochondrial genes, including Cyt b, ND2, and COI. These genes are of special interest, because they have been widely used to resolve the taxonomy of controversial groups in Anseriformes [2]. A combination of these three genes is often adequate and has been used for resolving phylogenetic problems at many different taxonomic levels, ranging from related species to genera and families [25]. They have been valuable for clarifying phylogenetic relationships within many controversial animal groups, especially that of Anseriform birds [16], [25], [27].

Control region comparisons

The CR is the only major non-coding segment of mtDNA, and has higher variability, evolving three to five times more rapidly, than other vertebrate mtDNAs [28]. Its primary function is thought to be the regulation of replication and transcription [29]. In Aves the CR is located between the tRNAGlu and tRNAPhe genes. Sequence variation in the CR results in length variability in different birds [28], [29]. Similar to other Anseriform birds, there is only one CR in Aix galericulata and Tadorna ferruginea, 1,071 bp and 1,077 bp in length, respectively. Comparing the length of the CR in the 16 Anseriforme species that we researched shows lengths ranging from 1,045 bp (Anas formosa) to 1,335 bp (Anseranas semipalmata) with an average length of 1,127 bp. The high AT content (53.55%) is similar to other organisms [10], [16], [30]. Regions of recognizable homology comprise only 406 bp, representing 27.92% of the entire mtDNA genome. An alignment of the 16 CR sequences contains 406 variable sites and 537 parsimony informative sites. Its nucleotide frequencies are not significantly different from other birds. Some conspicuous macro-repeat units are found in the CR of some Anseriforme species, including microsatellite-like (C)11 repeats in Anser albifrons and Anser anser, and (ATCAAACG)15 elements in Anseranas semipalmata. The average genetic distance (0.376) between the CR of Anseranas semipalmata and the other species in our analysis is higher than average (0.288) (Table 4).
Table 4

The genetic distances among the 16 Anseriforme species of mtDNA CR based on kimura-2-parameter model in this study.

Genetic distances12345678910111213141516
1
20.191
30.2030.065
40.1980.0520.072
50.3290.2620.2640.274
60.3460.2670.2750.2700.043
70.3310.2690.2740.2810.0270.062
80.5500.4910.4840.4740.5010.5130.518
90.2190.1420.1460.1350.2660.2640.2780.493
100.3050.2460.2410.2490.1190.1160.1380.5220.241
110.1710.1530.1430.1500.2950.3090.3010.4960.1530.275
120.3340.2630.2550.2570.1510.1440.1720.4720.2460.1520.272
130.3180.2600.2540.2590.1480.1410.1670.5130.2450.1470.2580.102
140.4110.3870.3930.3850.4160.4110.4320.4000.4190.3980.3700.3970.393
150.1840.1870.1820.1830.3280.3400.3300.5330.2230.2920.1780.3270.3090.407
160.3140.2760.2590.2760.4200.4200.4250.6100.2750.4100.2370.4020.3780.5100.309

Notes: 1: Aix galericulatata, 2: Anas falcata, 3: Anas formosa, 4: Anas platyrhynchos, 5: Anser albifrons, 6: Anser anser, 7: Anser fabalis, 8: Anseranas semipalmata, 9: Aythya americana, 10: Branta canadensis, 11: Cairina moschata, 12: Cygnus atratus, 13: Cygnus columbianus, 14: Dendrocygna javanica, 15: Mergus squamatus, 16: Tadorna ferruginea.

Notes: 1: Aix galericulatata, 2: Anas falcata, 3: Anas formosa, 4: Anas platyrhynchos, 5: Anser albifrons, 6: Anser anser, 7: Anser fabalis, 8: Anseranas semipalmata, 9: Aythya americana, 10: Branta canadensis, 11: Cairina moschata, 12: Cygnus atratus, 13: Cygnus columbianus, 14: Dendrocygna javanica, 15: Mergus squamatus, 16: Tadorna ferruginea. Comparative analysis of the structure and organization of CRs can help show relationships in the Anseriformes [8], [27], [31]. A better understanding of CR characteristics can provide insights into phylogenetics [28], Anseranas semipalmata thus has the most divergent CR of the studied species (Figure 3). Typically, vertebrate CRs are subdivided into three domains (Domain I, Domain II, and Domain III) [28]. Within the central conserved domain (Domain II), conserved sequence blocks (CSBs) C, D, E, and F show evolutionary conservation, and exhibit a rather homogeneous evolutionary rate [28], and are 31 bp, 24 bp, 20 bp and 20 bp in the length, respectively (Figure 3). It has lower variation rate among the Domain II of 16 Anseriforme species, and there are no base insert, only three bases deletion are found in Aix galericulata and 13 bases deletion in Tadorna ferruginea (Figure 3). These boxes are present in most avian taxa, are similar to those of other vertebrates, and are associated with regulating H-strand synthesis [8], [31]. Several CR CBS boxes exist in the 16 species of Anseriformes studied as well, which suggests that the boxes may play a key role in the replication and transcription of the mitochondrial genome [27], [31].
Figure 3

Structure of the central conserved domain of the CR in 16 Anseriforme species.

Dots indicate nucleotides with identity to the reference sequences, and dashes indicate indels.

Structure of the central conserved domain of the CR in 16 Anseriforme species.

Dots indicate nucleotides with identity to the reference sequences, and dashes indicate indels.

Phylogenetic analyses

The trees from the ML and BI analyses based on the complete mtDNA of 16 Anseriform species share similar topologies and high node support values with those of the concatenated three mitochondrial gene sequences from 68 species (Figures 2 and 3). The results support the grouping of Aix galericula and Tadorna ferruginea together in the same lineage, Tadorninae. Livezey included Aix and Cairina in the Anatini but proposed a subtribe, Cairinina, clustering these species together on the basis of a single osteological synapomorphy [9]. Dickinson considered Aix and Cairina to be members of the Anatinae [6]. Our molecular results show Aix and Cairina grouped with Tadorna and Chloephaga, supported by high bootstrap values, forming the Tadorninae, which is located between Anatinae and Anserinae. Therefore, we agree that Tadorninae should be an independent subfamily in the Anatidae, and that Aix and Cairina don't belong to Anatinae, but are members of Tadorninae, which is a little different from Dickinson's view [6]. The taxonomy and systematic relationships within the Tadorninae have been considerably debated. Our results show that the relationships between Aix and Cairina, and Tadorna and Chloephaga are much closer. Cairina and Aix cluster together as a sister group adjacent to Tadorna and Chloephaga, which, based on morphological and molecular studies, has been repeatedly claimed [2]. Aix and Cairina have several similar characteristics in behavior and breeding biology, and molecular phylogenetic trees also suggest that they are sister branches, showing they have a close genetic relationship as well [8]. Our mtDNA evidence also supports Tadorna and Chloephaga having a much closer genetic relationship, congruent with morphological studies [9]. Our results combine the data of several new mitogenomes within the growing phylogeny of the Anseriformes. Molecular phylogenetic results indicate that the 68 Anseriform birds studied could be divided into three families: Anhimidae, Anatidae, and Anseranatidae. Anhimidae diverged first, followed by Anseranatidae and Anatidae, similar to previous molecular phylogenetic and morphological studies [1], [2], [4], [5]. Anseranas semipalmata does not belong in Anatidae, but represents an independent family, Anseranatidae [1], [2]. According to our study Aythyini diverged earlier than Anatini within Anatidae and is monophyletic [1], [2]. Systematic relationships concerning the stiff-tailed ducks (Oxyurinae) have also been very controversial [5], [8], [9]. According to traditional morphological studies the stiff-tailed ducks share a common ancestor with geese and swans [3], [9], are closest to the Anserinae, and are not within the Anatinae. Our results don't support stiff-tailed ducks (Oxyurinae) as being a tribe within Anatidae, but present them as an independent subfamily, Oxyurinae, which diverged earlier than the whistling ducks (Dendrocygninae) in Anatidae [2], [10], [16]. Our mtDNA analysis suggests that the genus Anas is actually polyphyletic, but Anas formosa formosa, which is found in one of the Anatini branches, has no close relatives among living ducks, and should be placed in some distinct genera. Anas formosa formosa should be in a distinct genus; and Anas discors, Anas querquedula, Anas clypeata and Anas platalea should be placed in another distinct genus, closest to the multigenus duck group (Tachyeres, Lophonetta, and Amazonetta).

Materials and Methods

Sample collection

Trace blood samples from Aix galericulata and Tadorna ferruginea were collected using non-invasive methods at the Hefei Wild Animal Park in May 2013. No animal was killed for the purpose of the experiment, the method will not affect the health of the animals, and it conforms to our animal ethics committee's guidline in this study. The Hefei Wild Animal Park is authorized to administer animal rescue and medical treatment by Anhui Provincial Conservation and Mangement Station for Wildlife (APCMSW), a provincial government agency for wildlife conservation in the Anhui Province of China. We were authorized to study the birds by the APCMSW. The samples were stored at −20°C at the Institute of Biodiversity and Wetland Ecology, School of Resources and Environmental Engineering, Anhui University (Sample codes are AHU-WB20130522 and AHU-WB20130523, respectively).

DNA extraction, PCR amplification, and sequencing

Whole genomic DNA was isolated from blood samples using the phenol/chloroform method. Extracted DNA was examined on a 1.0% agarose/TBE gel and stored at −20°C as templates for PCR. Based on an alignment of complete mtDNA sequences from Cygnus atratus (NC_012843), Anas platyrhynchos (NC_009684), and Aythya americana (NC_000877), we designed three primer pairs (primer sets 9, 11, and 14) using Primer 5.0. We also used other primers developed from Anser fabalis [10], [16]. These primers were used to amplify and sequence the complete mtDNAs of Aix galericulata and Tadorna ferruginea (Table 5). Generated sequences were all less than 1,200 bp each, with each segment overlapping the next by 80–150 bp.
Table 5

The 5 Primer sequences used in this study.

Primer NoAmplified regionForward primer sequence (5'→3')Reverse primer sequence (5'→3')
1840–2106 CCACTACCCGAGACCTACG TAAGTCTTTTGTCCGCAGGCAT
21997–3190 ATAGGGCTATTTAGTGAATGCT TGAGTATTCTAAGTACACCTTC
33017–5121 GTCACCCTCCTCATAAGCCA GTTGCTGGAGATTGTGATTGT
44944–7091 TTACCAAAAACATAGCCTTCAG GTTGCTGGAGATTGTGATTGT
56886–8340 GATCAAAACTCTCCATACTTCC TCGGTCGGTTAGTAGCATTGT
68210–9346 TGGCTATCTTCTCACTTCACCT GGGTAGGATTGTTCAGATTAGT
79176–10285 ACCACGCTCTGATTGTTGCCT TTGTGTGGTGGGGTGAATGT
810127–11367 CGACTTTCCACCATCCAACT CTTCGTGGTATTCTATTGCCT
911017–12122 TACTAAACACAGCAATCCTCCT GAATTTTGGTGGGGACAGTAG
1011944–12925 CTACACCTGAGCTTCTACT GAGACAGATTGAGCTAGT
1112747–13834 TCTGACTACCAAAAGCCCAC GTGAGTAGTGTGAGGGAGTT
1213685–14810 GAGTTAAATCAACAAGAGCT GTCCGATGGCTACTATTAT
1314702–15767 ACTAGCCACCAACCAAACAG CGAAGTTTCATCAGGCAGAG
1415663–16493 ATGATCTTAACCACACAGACC GTTGTCCGATGATGATGAATG
1516347–1128CCTMCTRCTCACTCTTAT CTATGCACGATATGCAT

Note: M refers to A and C, R refers to A and G.

Note: M refers to A and C, R refers to A and G. PCR amplifications were carried out in 50 µl volumes containing 100 ng template DNA, 5 µl of 10× reaction Buffer, 2 µl of 25 mM MgCl2, 4 µl of 2 mM dNTPs, 1 µl of each 10 mM primer, 0.5 U Taq DNA polymerase (Trans Taq-T DNA Polymerase, Beijing, China), and sterile doubly-distilled water to final volume. PCR amplification conditions follow: denaturation for 5 min at 94°C, followed by 30 cycles of denaturation for 30 s at 94°C, annealing for 30 s at 49–55°C (depending on primer combinations), elongation for 2 min at 72°C, and a final extension step of 10 min at 72°C. PCR products were examined using electrophoresis on a 1% agarose/TBE gel (Figure 4) and purified and bidirectionally sequenced by Sangon Biotech Co., Ltd. (Shanghai, China).
Figure 4

The typical amplification results (bands 1–10) of representative sequences from Tadorna ferruginea and Aix galericulata.

Notes: bands 1–6 are the PCR amplification products used primers 6–11 of Tadorna ferruginea, and bands 7–10 are the PCR amplification products used primers 6–9 of Aix galericulata.

The typical amplification results (bands 1–10) of representative sequences from Tadorna ferruginea and Aix galericulata.

Notes: bands 1–6 are the PCR amplification products used primers 6–11 of Tadorna ferruginea, and bands 7–10 are the PCR amplification products used primers 6–9 of Aix galericulata.

Sequence analysis

Sequences were checked and assembled using the programs Seqman (DNASTAR, 2001), BioEdit, and Chromas 2.22, and then adjusted manually. PCGs were identified by comparison with the known complete mtDNA sequences of Anseriform birds using Sequin 11.0. The 22 tRNA genes were identified using the software package tRNA Scan-SE 1.21 (http://lowelab.ucsc.edu/tRNAscan-SE), and their cloverleaf secondary structures and anticodon sequences were determined using DNASIS (Ver.2.5, Hitachi Software Engineering). Two rRNAs were identified by comparison with complete mtDNA sequences of other Anseriformes available in GenBank. The complete mtDNA sequences have been deposited in GenBank under accession numbers KF437906 and KF684946. Phylogenetic trees were estimated using ML and BI methods, to study the phylogeny of the Anseriformes. Corresponding Gallus gallus (NC_001323) sequence was used as outgroup. Phylogenetic trees were estimated for two cases: one based on the complete mtDNA of 16 Anseriforme species (Table 6), and another one based on a multiple sequence alignment of three mitogenome (Cyt b, ND2, and COI) sequences from 68 typical Anseriform species from GenBank (Table 7). Our previous research has shown that the combined gene sequence from Cyt b, ND2, and COI is suitable for resolving phylogenetic relationships among Anseriform species in the absence of sufficient complete mtDNA data [16].
Table 6

GenBank accession numbers for the 16 complete mtDNA of Anseriforme species in this study.

SpeciesAccession numberSpeciesAccession number
Anas platyrhynchos NC_009684 Aythya americana NC_000877
Anas formosa NC_015482 Branta canadensis NC_007011
Anser anser NC_011196 Cairina moschata NC_010965
Anser albifrons NC_004539 Cygnus columbianus NC_007691
Anseranas semipalmata NC_005933 Cygnus atratus NC_012843
Dendrocygna javanica NC_012844 Anas falcate KC759527
Anser fabalis NC_016922 Mergus squamatus NC_016723
Aix galericulatata In this study Tadorna ferruginea In this study
Table 7

GenBank accession numbers (Cyt b, ND2 and COI) for the 68 Anseriforme species in this study.

SpeciesAccession number (Cyt b,ND2,COI)SpeciesAccession number (Cyt b,ND2,COI)
Anhima cornuta AY140735,AY140737,AY140729 Anas falcata KC759527,KC759527,KC759527
Anseranas semipalmata NC_005933,NC_005933,C_005933 Anas poecilorhyncha EU914150,AF059143,JN703239
Dendrocygna arcuata AF082061,U97735,U97739 Anas discors EU914146,AF059128,DQ434285
Dendrocygna eytoni EU585647,EU585710,U97733 Anas acuta AF059055,AF059116,JN703180
Dendrocygna viduata EU585649,EU585712,FJ027502 Anas platalea AF059084,AF059144,FJ027099
Dendrocygna javanica NC_012844,NC_012844,C_012844 Anas clypeata EU914154,AF059174,DQ434274
Anser albifrons NC_004539,NC_004539,C_004539 Anas gibberifrons AF059076,AF059136,JQ174015
Anser anser NC_011196,NC_011196,C_011196 Anas bahamensis EU914147,AF059120,JQ174013
Anser brachyrhynchus EU585614,EU585677,GU179004 Anas querquedula AF059086,EU585673,GU571723
Anser indicus EU585619,EU585682,GU179002 Anas penelope AF059107,AF059167,JN703206
Anser fabalis NC_016922,NC_016922,C_016922 Anas platyrhynchos NC_009684,C_009684,C_009684
Anser rossii EU914156,EU585683,DQ434539 Anas laysanensis AF059078,AF059138,JF498830
Anser canagica EU585615, EU585678, DQ432849 Anas superciliosa FJ498963, AF059152, JN801396
Branta bernicla EU585628,EU585691,DQ434344 Anas formosa NC_015482,NC_015482,NC_015482
Branta canadensis NC_007011,NC_007011,NC_007011 Netta rufina EU585657,EU585720,GU571988
Branta leucopsis EU585630,EU585693,GU179003 Aythya ferina NC_000877,NC_000877,NC_000877
Branta sandvicensis EU585632,EU585695,JF498832 Aythya affinis EU585621,EU585684,DQ434310
Coscoroba coscoroba EU585639, EU585702,FJ027452 Aythya americana NC_000877,NC_000877,NC_000877
Cygnus atratus NC_012843,NC_012843,C_012843 Aythya marila EU585625,EU585688,DQ434333
Cygnus columbianus NC_007691,NC_007691,NC_007691 Aythya nyroca EU585626, EU585689, GQ481388
Cygnus cygnus EU585643,EU585706,GU571854 Somateria spectabilis EU585662,EU585725,DQ434103
Cygnus olor EU585645,EU585708,GU571856 Somateria mollissima AF515264,AF515268,DQ434751
Tachyeres pteneres AF059112,JQ408332,JN802006 Melanitta perspicillata EU585652,EU585715,DQ434655
Sarkidiornis melanotos EU585660, EU585723, FJ028237 Melanitta nigra AF515263,AF515267,AY666338
Chloephaga picta AF515262,AF515266,FJ027353 Bucephala albeola EU585633, EU585696, DQ434491
Chloephaga poliocephala EU585637,EU585700,FJ027355 Bucephala clangula AF515261, AF515265, EU525336
Tadorna ferruginea In this study Bucephala islandica EU585635, EU585698, DQ434502
Tadorna tadorna AF059113,AF059173,GU571650 Mergellus albellus EU585653, EU585716, GU571480
Cairina moschata NC_010965,NC_010965,NC_010965 Lophodytes cucullatus EU585650, EU585713,AY666346
Aix galericulata In this study Mergus serrator EU585655,EU585718,DQ434677
Aix sponsa AF059053, AF059114, DQ434254 Mergus squamatus NC_016723,NC_016723,NC_016723
Lophonetta specularoides AF059102, JQ408334, FJ027113 Mergus merganser EU585654, EU585717, DQ434672
Amazonetta brasiliensis AF059054,AF059115,FJ027065 Nomonyx dominicus AF119165,AY747864,FJ027905
Anas strepera EU574791,AF059169,DQ434298 Oxyura jamaicensis EU585658,EU585721,AY666448
Before phylogenetic tree estimations all 16 complete mtDNAs and the three concatenated data sets of 68 Anseriform species were aligned using ClustalX 1.8, followed by manual adjustment. Specifics of the phylogenetic tree estimation based on the three concatenated data sets among the 68 Anseriforme species follows: the three mitogenome sequences were translated into their corresponding amino acid sequences and saved into.meg format, then turned it into.nex format, and then remove each third position of every codon using MEGA 4.0. We then concatenated the three mitogenome sequences to each other under the each species bird name, saved the file in.meg format, and then turned it into nex form. ML analyses was performed in PAUP* 4.0b10 using TBR branch swapping (10 random addition sequences) and a general time-reversible model with invariant sites and among-site variation (GTR+I+Γ) that was selected as the best fit model of evolution using Modeltest (version 3.06) based on the AIC criterion. Internal ML tree branch support was evaluated using a bootstrap test with 100 iterations. Bayesian phylogenetic inference was done using MrBayes 3.1.2, with the same best-fit substitution model as that selected for the ML analysis. MrBayes 3.1.2 simultaneously initiates two Markov Chain Monte Carlo (MCMC) runs to provide additional confirmation of convergence of posterior probability distributions. Analyses were run for one million generations until the average standard deviation of split frequencies was less than 0.01, which indicated that convergence was reached. Chains were sampled every 1,000 generations. Phylogenetic Classification of the Anseriformes. (DOC) Click here for additional data file.
  19 in total

1.  Slow rate of evolution in the mitochondrial control region of gulls (Aves: Laridae).

Authors:  P A Crochet; E Desmarais
Journal:  Mol Biol Evol       Date:  2000-12       Impact factor: 16.240

2.  Characterization and evolution of the mitochondrial DNA control region in hornbills (Bucerotiformes).

Authors:  Wayne Delport; J Willem H Ferguson; Paulette Bloomer
Journal:  J Mol Evol       Date:  2002-06       Impact factor: 2.395

3.  Structure and evolution of the avian mitochondrial control region.

Authors:  Minna Ruokonen; Laura Kvist
Journal:  Mol Phylogenet Evol       Date:  2002-06       Impact factor: 4.286

4.  Two new avian mitochondrial genomes (penguin and goose) and a summary of bird and reptile mitogenomic features.

Authors:  Kerryn E Slack; Axel Janke; David Penny; Ulfur Arnason
Journal:  Gene       Date:  2003-01-02       Impact factor: 3.688

5.  How do insect nuclear and mitochondrial gene substitution patterns differ? Insights from Bayesian analyses of combined datasets.

Authors:  Chung-Ping Lin; Bryan N Danforth
Journal:  Mol Phylogenet Evol       Date:  2004-03       Impact factor: 4.286

Review 6.  Evolution of the mitochondrial genome of Metazoa as exemplified by comparison of congeneric species.

Authors:  C Gissi; F Iannelli; G Pesole
Journal:  Heredity (Edinb)       Date:  2008-07-09       Impact factor: 3.821

7.  A molecular phylogeny of anseriformes based on mitochondrial DNA analysis.

Authors:  Carole Donne-Goussé; Vincent Laudet; Catherine Hänni
Journal:  Mol Phylogenet Evol       Date:  2002-06       Impact factor: 4.286

8.  The mitochondrial genome sequence and molecular phylogeny of the turkey, Meleagris gallopavo.

Authors:  X Guan; P Silva; K B Gyenai; J Xu; T Geng; Z Tu; D C Samuels; E J Smith
Journal:  Anim Genet       Date:  2008-12-05       Impact factor: 3.169

9.  The complete mitochondrial genome of bean goose (Anser fabalis) and implications for anseriformes taxonomy.

Authors:  Gang Liu; Lizhi Zhou; Lili Zhang; Zijun Luo; Wenbin Xu
Journal:  PLoS One       Date:  2013-05-23       Impact factor: 3.240

10.  Mitochondrial genomes of two Barklice, Psococerastis albimaculata and Longivalvus hyalospilus (Psocoptera: Psocomorpha): contrasting rates in mitochondrial gene rearrangement between major lineages of Psocodea.

Authors:  Hu Li; Renfu Shao; Fan Song; Xuguo Zhou; Qianqian Yang; Zhihong Li; Wanzhi Cai
Journal:  PLoS One       Date:  2013-04-22       Impact factor: 3.240

View more
  7 in total

1.  Complete mitochondrial genome of Porzana fusca and Porzana pusilla and phylogenetic relationship of 16 Rallidae species.

Authors:  Peng Chen; Yuqing Han; Chaoying Zhu; Bin Gao; Luzhang Ruan
Journal:  Genetica       Date:  2017-09-23       Impact factor: 1.082

2.  Genome Assembly and Evolutionary Analysis of the Mandarin Duck Aix galericulata Reveal Strong Genome Conservation among Ducks.

Authors:  Chen Siang Ng; Cheng-Kuo Lai; Huei-Mien Ke; Hsin-Han Lee; Chih-Feng Chen; Pin-Chi Tang; Hsu-Chen Cheng; Meiyeh J Lu; Wen-Hsiung Li; Isheng Jason Tsai
Journal:  Genome Biol Evol       Date:  2022-05-31       Impact factor: 4.065

3.  Osteology Supports a Stem-Galliform Affinity for the Giant Extinct Flightless Bird Sylviornis neocaledoniae (Sylviornithidae, Galloanseres).

Authors:  Trevor H Worthy; Miyess Mitri; Warren D Handley; Michael S Y Lee; Atholl Anderson; Christophe Sand
Journal:  PLoS One       Date:  2016-03-30       Impact factor: 3.240

4.  The evolution of giant flightless birds and novel phylogenetic relationships for extinct fowl (Aves, Galloanseres).

Authors:  Trevor H Worthy; Federico J Degrange; Warren D Handley; Michael S Y Lee
Journal:  R Soc Open Sci       Date:  2017-10-11       Impact factor: 2.963

5.  The complete mitochondrial genome of common Shelduck Shengjin Lake Tadorna tadorna.

Authors:  Gang Liu; Qingyue Li; Zhizong Gong
Journal:  Mitochondrial DNA B Resour       Date:  2019-09-19       Impact factor: 0.658

6.  Rapid and recent diversification patterns in Anseriformes birds: Inferred from molecular phylogeny and diversification analyses.

Authors:  Zhonglou Sun; Tao Pan; Chaochao Hu; Lu Sun; Hengwu Ding; Hui Wang; Chenling Zhang; Hong Jin; Qing Chang; Xianzhao Kan; Baowei Zhang
Journal:  PLoS One       Date:  2017-09-11       Impact factor: 3.240

7.  Sharp Increase of Problematic Mitogenomes of Birds: Causes, Consequences, and Remedies.

Authors:  George Sangster; Jolanda A Luksenburg
Journal:  Genome Biol Evol       Date:  2021-09-01       Impact factor: 3.416

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.