| Literature DB >> 25374507 |
Steven A Szebenyi1, Tatsuya Ogura1, Aaron Sathyanesan1, Abdullah K AlMatrouk1, Justin Chang1, Weihong Lin1.
Abstract
Phospholipase C (PLC) and internal Ca(2+) stores are involved in a variety of cellular functions. However, our understanding of PLC in mammalian olfactory sensory neurons (OSNs) is generally limited to its controversial role in odor transduction. Here we employed single-cell Ca(2+) imaging and molecular approaches to investigate PLC-mediated Ca(2+) responses and its isozyme gene transcript expression. We found that the pan-PLC activator m-3M3FBS (25 μM) induces intracellular Ca(2+) increases in vast majority of isolated mouse OSNs tested. Both the response amplitude and percent responding cells depend on m-3M3FBS concentrations. In contrast, the inactive analog o-3M3FBS fails to induce Ca(2+) responses. The m-3M3FBS-induced Ca(2+) increase is blocked by the PLC inhibitor U73122, while its inactive analog U73433 has no effect. Removal of extracellular Ca(2+) does not change significantly the m-3M3FBS-induced Ca(2+) response amplitude. Additionally, in the absence of external Ca(2+), we found that a subset of OSNs respond to an odorant mixture with small Ca(2+) increases, which are significantly suppressed by U73122. Furthermore, using reverse transcription polymerase chain reaction and real-time quantitative polymerase chain reaction, we found that multiple PLC isozyme gene transcripts are expressed in olfactory turbinate tissue in various levels. Using RNA in situ hybridization analysis, we further show expression of β4, γ1, γ2 gene transcripts in OSNs. Taken together, our results establish that PLC isozymes are potent enzymes for mobilizing intracellular Ca(2+) in mouse OSNs and provide molecular insight for PLC isozymes-mediated complex cell signaling and regulation in the peripheral olfactory epithelium.Entities:
Keywords: RNA in situ hybridization; calcium imaging; olfactory sensory neuron; phospholipase C isozyme; real-time qPCR
Year: 2014 PMID: 25374507 PMCID: PMC4204526 DOI: 10.3389/fncel.2014.00336
Source DB: PubMed Journal: Front Cell Neurosci ISSN: 1662-5102 Impact factor: 5.505
Oligonucleotide primer sequences for individual PLC isozymes and their applications (RT-PCR and/or qPCR).
| Gene symbol | NCBI GI no. | Primer sequence | Expected amplicon size (bp) | Applications |
|---|---|---|---|---|
| 224967067 | 5′: GCCCCTGGAGATTCTGGAGT | 124 | RT-PCR, qPCR (PrimerBank ID: 4099293a1) | |
| 61676178 | 5′: TGGATGTCACGAGTATCCGAG | 798 | RT-PCR | |
| 5′: AGGATAGCTGTGATGGAAGAAGG | 176 | qPCR (PrimerBank ID: 27370658a1 | ||
| 118130639 | 5′: CTGCCGCTCTATCTTTGGGG | 134 | RT-PCR, qPCR (PrimerBank ID: 1246801a1) | |
| 118130923 | 5′: CAAGGGAGGCCGAGTTGATT | 428 | RT-PCR | |
| 5′: GGACAAGTGCTAGAATGTTCCC | 165 | qPCR (PrimerBank ID: 29293803a1) | ||
| 118129851 | 5′: CGCTGCATTGAGTTGGACTG | 899 | RT-PCR | |
| 5′: ATCCAGCAGTCCTAGAGCCTG | 105 | qPCR (PrimerBank ID: 1246803a1) | ||
| 26986602 | 5′: GTGGACACCCTTCCAGAATATG | 137 | RT-PCR, qPCR (PrimerBank ID: 26986603a1) | |
| 118130605 | 5′: CAGCTCGTGGCGTAGAGAAC | 122 | RT-PCR, qPCR (PrimerBank ID: 9790167a1) | |
| 258645147 | 5′: GGCTACGGGCACTGAAGAAG | 198 | RT-PCR, qPCR (PrimerBank ID: 22779905a1) | |
| 125347170 | 5′: GAAGGTTATGAAGTGTCCGATGT | 102 | RT-PCR, qPCR (PrimerBank ID: 22507345a1) | |
| 134053942 | 5′: TTCGTCGAGCTGTTCAAATCA | 81 | RT-PCR, qPCR (PrimerBank ID: 26330738a1) | |
| 295148203 | 5′: ACTACCAGTCTGAAGGGCGA | 966 | RT-PCR | |
| 294862234 | 5′: GTGGACGACAACGGATTCAAC | 559 | RT-PCR | |
| 5′: TTGGTCCGCTTCTACTACCTG | 98 | qPCR (PrimerBank ID: 26340698a1) | ||
| 146149119 | 5′: CTCGCAGAAGCAAGATGGTTT | 109 | RT-PCR (PrimerBank ID: 22550102a1) | |