Dong-Mei He1, Hong Wu1, Xiu-Li Wu1, Li Ding1, Ling Xu1, Yang-Qiu Li1. 1. 1 Institute of Hematology, Medical College, 2 Key Laboratory for Regenerative Medicine of Ministry of Education, Jinan University, Guangzhou 510632, China.
Abstract
OBJECTIVE: The results of a previous study showed that a clear dysregulation was evident in the global gene expression of the BCL11A-suppressed B-lymphoma cells. In this study, the bone morphogenetic protein receptor, type II (BMPR2), E1A binding protein p300 (EP300), transforming growth factor-β2 (TGFβ2), and tumor necrosis factor, and alpha-induced protein 3 (TNFAIP3) gene expression patterns in B-cell malignancies were studied. METHODS: The relative expression levels of BMPR2, EP300, TGFβ2, and TNFAIP3 mRNA in B-lymphoma cell lines, myeloid cell lines, as well as in cells from healthy volunteers, were determined by real-time quantitative reverse transcript-polymerase chain reaction (qRT-PCR) with SYBR Green Dye. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as reference. RESULTS: The expression level of TGFβ2 mRNA in B-lymphoma cell lines was significantly higher than those in the cells from the healthy control (P<0.05). However, the expression level of TNFAIP3 mRNA in B-malignant cells was significantly lower than that of the healthy control (P<0.05). The expression levels of BMPR2 and EP300 mRNA showed no significant difference between B-malignant cell lines and the healthy group (P>0.05). In B-lymphoma cell lines, correlation analyses revealed that the expression of BMPR2 and TNFAIP3 (r=0.882, P=0.04) had significant positive relation. The expression levels of BMPR2, EP300, and TNFAIP3 mRNA in cell lines from myeloid leukemia were significantly lower than those in the cells from the healthy control (P<0.05). The expression levels of TGFβ2 mRNA showed no significant difference between myeloid leukemia cell lines and the healthy control or B-malignant cell lines (P>0.05). The expression levels of BMPR2, EP300, and TNFAIP3 mRNA in B-lymphoma cells were significantly higher than those of the myeloid leukemia cells (P<0.05). CONCLUSION: Different expression patterns of BMPR2, EP300, TGFβ2, and TNFAIP3 genes in B-lymphoma cells exist.
OBJECTIVE: The results of a previous study showed that a clear dysregulation was evident in the global gene expression of the BCL11A-suppressed B-lymphoma cells. In this study, the bone morphogenetic protein receptor, type II (BMPR2), E1A binding protein p300 (EP300), transforming growth factor-β2 (TGFβ2), and tumor necrosis factor, and alpha-induced protein 3 (TNFAIP3) gene expression patterns in B-cell malignancies were studied. METHODS: The relative expression levels of BMPR2, EP300, TGFβ2, and TNFAIP3 mRNA in B-lymphoma cell lines, myeloid cell lines, as well as in cells from healthy volunteers, were determined by real-time quantitative reverse transcript-polymerase chain reaction (qRT-PCR) with SYBR Green Dye. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as reference. RESULTS: The expression level of TGFβ2 mRNA in B-lymphoma cell lines was significantly higher than those in the cells from the healthy control (P<0.05). However, the expression level of TNFAIP3 mRNA in B-malignant cells was significantly lower than that of the healthy control (P<0.05). The expression levels of BMPR2 and EP300 mRNA showed no significant difference between B-malignant cell lines and the healthy group (P>0.05). In B-lymphoma cell lines, correlation analyses revealed that the expression of BMPR2 and TNFAIP3 (r=0.882, P=0.04) had significant positive relation. The expression levels of BMPR2, EP300, and TNFAIP3 mRNA in cell lines from myeloid leukemia were significantly lower than those in the cells from the healthy control (P<0.05). The expression levels of TGFβ2 mRNA showed no significant difference between myeloid leukemia cell lines and the healthy control or B-malignant cell lines (P>0.05). The expression levels of BMPR2, EP300, and TNFAIP3 mRNA in B-lymphoma cells were significantly higher than those of the myeloid leukemia cells (P<0.05). CONCLUSION: Different expression patterns of BMPR2, EP300, TGFβ2, and TNFAIP3 genes in B-lymphoma cells exist.
Entities:
Keywords:
B-lymphoma cells; Bone morphogenetic protein receptor, type II (BMPR2); E1A binding protein p300 (EP300); myeloid leukemia cells; quantitative reverse transcription polymerase chain reaction (qRT-PCR); transforming growth factor-β2 (TGFβ2); tumor necrosis factor, and alpha-induced protein 3 (TNFAIP3)
Non-Hodgkin lymphomas (NHLs) are the fifth most frequently occurring cancer worldwide-. Diffuse large B-cell lymphoma (DLBCL) is considered a highly heterogeneous type of NHL in its morphology, immunophenotypical, biological, and clinical aspects. Gene expression profile analysis has identified a germinal-center (GC) B-cell-like, an activated B-cell-like (ABC), and an intermediate type of DLBCL with different prognostic implications,. Burkitt’s lymphoma (BL) is an aggressive B-cell NHL, characterized by a high degree of proliferation of the malignant cells. The main diagnostic challenge in BL is to distinguish it from DLBCL,.B-cell chronic lymphocytic leukemia (CLL)/lymphoma 11 (BCL-11A) gene is associated with human malignant B cells, overexpression of which primarily occurs in B-cell lymphoma and B-cell leukemia-. A previous study has shown that a broad range of genes may be altered in B-cell lymphoma, including bone morphogenetic protein receptor, type II (BMPR2), E1A binding protein p300 (EP300), transforming growth factor-β (TGFβ2), tumor necrosis factor, and alpha-induced protein 3 (TNFAIP3) gene (also known as A20), by analyzing the global gene expression profile in the GCB-derived DLBCL cell line SUDHL6 after BCL11A downregulation (in press).Bone morphogenetic proteins (BMPs) are members of TGF-β superfamily of signaling molecules. Deregulation of BMPs signaling pathways has been reported in certain humancancers. BMPR2 has tumor-suppressive functions in mammary carcinoma and B-CLL,. BMPR2 was strongly expressed in acute promyelocytic leukemia, as well as in AML-M4 and multiple myeloma. However, the role of BMPs in B-lymphoma remains unknown. The EP300 gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It is important in the processes of cell proliferation and differentiation,. TNFAIP3 is a putative tumor suppressor gene in B-cell lymphomagenesis and the frequency of TNFAIP3 gene inactivation was observed in different subtypes of NHL.Although BMPR2, EP300, TGFβ2, and TNFAIPI3 have been studied in lymphoma or leukemia, no report has compared the expression of the four genes among B-lymphoma cells, the healthy control, and myeloid leukemia. In this study, quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to analyze the expression levels of BMPR2, EP300, TGFβ2, and TNFAIPI3 in B-lymphoma and myeloid leukemia cell lines.
Materials and methods
Cell lines
HumanB-lymphoma cell lines (DG-75, EB1, OCI-LY-3, and SUDHL6) were kindly provided by Prof. Ailin Guo (Institute of Pathology, Cornell University). HumanB-lymphoma cell lines (Daudi, Raji) and myeloid leukemia cell lines (HL-60, NB4, U937, and K562) were purchased from a cell bank in Shanghai, China. The cells were cultured at 37 °C in an atmosphere containing 5% CO2 in RPMI-1640 medium supplemented with penicillin (100 U/mL), streptomycin (0.1 mg/mL), and 10% fetal calf serum.Ten healthy volunteers served as control (seven males and three females, 22-62 years old; median age, 31 years). All procedures were conducted in accordance with the guidelines of Medical Ethics committees of the health bureau of Guangdong Province, PR China. Peripheral blood was collected by heparin anticoagulation. Peripheral blood mononuclear cells (PBMNCs) were separated with the use of the Ficoll-Hypaque gradient centrifugation method.
RNA extraction and cDNA synthesis
RNA was extracted using the Trizol kit (Invitrogen, Carlsbad, CA, USA) and reversely transcribed into the first-strand cDNA with the use of random hexamer primers and the reverse transcriptase Superscript II Kit (Invitrogen, USA), according to the manufacturer’s instructions. RNA purity and concentration was measured with a spectrophotometer. The integrity of RNA was checked on a 1% agarose gel. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene by qRT-PCR was used to determine the quality of the synthesized cDNA.
Real-time quantitative PCR with SYBR green I
The 2–ΔCt ×100% method could be used to analyze the relative changes in gene expression from real-time quantitative PCR experiments,. Before applying the method to detect gene expression level, the targeted genes and the GAPDH gene should be determined to have high amplification efficiency. Therefore, a validation experiment was conducted using template serial dilutions of the cell lines cDNA covering the five orders of magnitude, 0.0001, 0.001, 0.01, 0.1, and 1. Standard curves were generated by plotting the Ct values against the logarithm starting quantity of the series dilution of cDNA template. The slope and correlation coefficient (R2) were determined by linear regression analysis. Briefly, the primers were designed and synthesized (Invitrogen, USA). The following primer sequences used in PCR reactions were shown in . The total reaction volume is 20 μL. Reaction conditions started with enzyme activation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 80 °C for 5 s. At the end of each run, a melting curve was performed starting at 65 °C to 95 °C with an increase of 1 °C per 2 s to verify primer specificities. Each run was completed with a melting curve analysis to confirm the specificity of the amplification and the absence of primer dimmers. The qRT-PCR was repeated in at least three separate experiments. The PCR products were visualized and separated on 2% agarose gel electrophoresis.
Table 1
Primer sequences for real-time polymerase chain reaction
Primer
Sequence
Size (bp)
BMPR2-f
5’ GGCTGAACTTATGATGATTTGGGAA 3’
107
BMPR2-r
5’ CACGCCTATTATGTGACAGGTTGC 3’
EP300-f
5’ TCCGAGACATCTTGAGACGACAG 3’
107
EP300-r
5’ GGGTTGCTGGAACTGGTTATGG 3’
TGFβ2-f
5’ GTTCGATTTGACGTCTCAGCAAT 3’
107
TGFβ2-r
5’ CAATCCGTTGTTCAGGCACTCT
TNFAIP3-f
5’ CCACAAAGCCCTCATCGACAG 3’
109
TNFAIP3-r
5’ GTCACCGTTCGTTTTCAGCG 3’
GAPDH-f
5’ ACCCAGAAG ACTGTGGATGG 3’
114
GAPDH-r
5’ TTCAGCTCA GGG ATGACCTT 3’
Statistical analysis
Nonparametric test analysis of two independent samples was used for the relative expression levels of gene mRNA in different samples, whereas the Mann-Whitney U test was used for non-normally distributed data using the SPSS 13.0 statistical software. Differences were considered statistically significant at P<0.05.
Results
PCR product analysis
R2 values of standard curves for BMPR2, EP300, TGFβ2, and TNFAIP3 reactions are above 0.99. The amplification efficiencies of the four genes and the GAPDH control gene were above 95%. The high amplification efficiency of the four genes was consistent with that of the GAPDH reference gene. The PCR products from the GAPDH control gene and the four genes were confirmed using 2% gel electrophoresis (data not shown).
The expression levels of BMPR2, EP300, TGFβ2, and TNFAIP3 genes in B-lymphoma cell lines
Ten malignancy hematology cell lines (six B-malignancy cells and four myeloid cells) were assayed for RNA expression levels. B-malignancy cells include Burkitt’s lymphoma cell lines (EB1, Daudi, DG75, and Raji) and GCB DLBCL-derived cell lines (OCI-LY-3 and SUDHL6). The mRNA expression level for each of the four genes was normalized to the reference gene (GAPDH). The ∆Ct was calculated for all four genes. According to the relative qRT-PCR formula: 2–∆Ct ×100%, the relative expression level of TGFβ2 mRNA in cell lines from B-cell malignancies was significantly higher than that in the cells from the healthy control (P<0.05). On the other hand, the expression level of TNFAIP3 mRNA in B-malignant cells was significantly lower than that of the healthy control (P<0.05). As shown in , the median quantities of TGFβ2 and TNFAIP3 expression in these B-cell lines are 6.25% and 4.78%, respectively, whereas the relative median expression levels of the two genes in the healthy group are 0.12% and 164.74%. The relative expression levels of BMPR2 and EP300 mRNA indicated no significant difference between B-cell malignant cell lines and PBMNCs of the healthy group (P>0.05).
Figure 1
The relative expression levels of BMPR2, EP300, TGFβ2, and TNFAIP3 mRNA in B-lymphoma cell lines and myeloid leukemia cell lines. Results shown are the boxplots of the expression levels of the genes. Numbers 4, 7 (A) and 8, 10, 13, 14, 28 (B) represent singular value. The expression levels of TGFβ2 and TNFAIP3 mRNA were found to be significantly different between the B-lymphoma cell lines (A) and the healthy control (B) (P<0.05). The expression levels of BMPR2, EP300, and TNFAIP3 mRNA were revealed to be significantly different between the myeloid leukemia cell lines (C) and the healthy control (P<0.05).
The relative expression levels of BMPR2, EP300, TGFβ2, and TNFAIP3 mRNA in B-lymphoma cell lines and myeloid leukemia cell lines. Results shown are the boxplots of the expression levels of the genes. Numbers 4, 7 (A) and 8, 10, 13, 14, 28 (B) represent singular value. The expression levels of TGFβ2 and TNFAIP3 mRNA were found to be significantly different between the B-lymphoma cell lines (A) and the healthy control (B) (P<0.05). The expression levels of BMPR2, EP300, and TNFAIP3 mRNA were revealed to be significantly different between the myeloid leukemia cell lines (C) and the healthy control (P<0.05).In B-lymphoma cell lines, correlation analyses revealed that the expression of BMPR2 and TNFAIP3 (r=0.882, P=0.04) had significant positive relation.
The expression levels of BMPR2, EP300, TGFβ2, and TNFAIP3 genes in myeloid leukemia cells
The relative expression levels of BMPR2, EP300, and TNFAIP3 mRNA in cell lines from myeloid leukemia were significantly lower than those in the cells from the healthy people (P<0.05). As shown in , the median quantities of BMPR2, EP300, and TNFAIP3 expression in the myeloid leukemia cell lines are 0.10%, 0.56%, and 0.34%, respectively. Furthermore, the relative median expression levels of these genes in the healthy control are 2.04%, 19.05%, and 164.74%, respectively. The relative expression levels of TGFβ2 mRNA showed no significant difference between myeloid leukemia cell lines and the healthy control (P>0.05).
BMPR2, EP300, TGFβ2, and TNFAIP3 gene expression in B-malignant and myeloid leukemia cell lines
As shown in , the relative expression levels of BMPR2, EP300, and TNFAIP3 mRNA in the cell lines from B-cell malignancy were significantly higher than those cell lines from myeloid leukemia (P<0.05), whereas the relative expression levels of TGFβ2 mRNA showed no significant difference between B-cell malignant cell lines and myeloid leukemia cell lines (P>0.05).
Discussion
In this study, BMPR2, EP300, TGFβ2, and TNFAIP3 mRNA expression were determined by qRT-PCR using SYBR Green I dye. Results showed that the high amplification efficiency of these genes was consistent with that of GAPDH, suggesting that the 2–∆Ct ×100% method can be used in quantifying the relative expression levels of the gene mRNA. This study revealed the expression of TGFβ2 and TNFAIP3 mRNA in B-malignant cells were significantly different from those of the healthy control. Meanwhile, the expression levels of BMPR2, EP300, and TNFAIP3 mRNA in myeloid leukemia cells were significantly lower than those of healthy people.Deregulated or aberrant TGF-β signaling has been strongly implicated in the pathogenesis of humansolid tumors, while less is known about the role of this pathway in lymphoma pathogenesis. TGF-β has either a tumor-suppressing or tumor-promoting function depending on cellular context. Moreover, TGF-β is overexpressed in chronic lymphocytic leukemia. TGF-β functions as an autocrine growth inhibitor in chronic lymphocytic leukemia B-cells. In the study of Ho et al., TGFβ2 was expressed in normal B-cell differentiation of the germinal center, especially from the follicular center cell stage to the postfollicular plasma cell stage. However, there was no expression of TGF-β in specimens from patients with neoplastic NHL. In this study, the expression level of TGFβ2 mRNA in PBMNCs from the healthy control is almost lacking. The expression level of TGFβ2 mRNA in the cell lines from B-malignancies was significantly higher than those in the cells from the healthy control. Furthermore, TGF-β functions as either suppressing or promoting the effect on tumors need to be investigated. TNFAIP3 inactivation has been reported in various B-cell lymphomas. In GCB DLBCL, the expression of TNFAIP3 was lower than that in ABC DLBCL. Meanwhile, Paik et al. observed that TNFAIP3 deletion was in similar frequencies in GCB and non-GCB/ABC DLBCL using fluorescence in situ hybridization. These contradictory observations may reflect the diversified roles of TNFAIP3 in DLBCL. These results showed that the expression level of TNFAIP3 mRNA in B-malignant cells was significantly lower than that of the healthy control, suggesting possible deletion of TNFAIP3 gene in the B-lymphoma cells, which is in accordance with previous observations. More so, TNFAIP3 gene was expressed at lower levels in GCB DLBCL cell lines than in Burkitt’s lymphoma cell lines.EP300 mutations were recently identified as a major pathogenetic mechanism shared by common forms of B-cell NHLs. By contrast, the findings in this study demonstrate that the expression levels of BMPR2 and EP300 mRNA had no significant difference between B-cell malignant cell lines and PBMNCs of the healthy people.Results indicate that the expression levels of BMPR2, EP300, and TNFAIP3 mRNA in myeloid leukemia cell lines were significantly lower than those of healthy people or B-malignant cell lines. BMPR2, EP300, and TNFAIP3 mRNA have been observed to be almost absent in myeloid leukemia cell lines. This observation indicates that the expression patterns of BMPR2, EP300, and TNFAIP3 in B-cell lymphoma may be significantly different from myeloid leukemia cell lines. Although the median quantity of TGFβ2 expression in B-lymphoma cell lines is obviously higher than that of the myeloid leukemia cell lines, no statistically significant difference is observed. This finding might denote a large variance of TGFβ2 expression level (three orders of magnitude) in the B-lymphoma cell lines. Additionally, in the different B-lymphocyte malignant cell lines, the expression levels of BMPR2, EP300, TGFβ2, and TNFAIP3 mRNA were quite different, which may be related to the heterogeneity of B-cell lymphoma.Little is known about the expression correlation between BMPR2 and TNFAIP3 genes in B-cell lymphoma. This study showed that the expression of BMPR2 and TNFAIP3 had a significant positive relation in B-lymphoma cell lines. These results indicate that a positively correlated expression pattern may be a feature in B-cell lymphoma. However, increasing the number of samples for validating the expression relation of the two genes is needed.In conclusion, the expression patterns of BMPR2, EP300, TGFβ2, and TNFAIP3 genes were characterized in B-lymphoma cells. Meanwhile, the differential expression pattern needs to increase the sample numbers to be further studied in B-cell malignancies. In addition, further biological studies are needed to determine if TGFβ2 and TNFAIP3 are therapeutic targets for B-cell lymphoma.
Authors: Philip Owens; Michael W Pickup; Sergey V Novitskiy; Anna Chytil; Agnieszka E Gorska; Mary E Aakre; James West; Harold L Moses Journal: Proc Natl Acad Sci U S A Date: 2011-05-16 Impact factor: 11.205
Authors: Justyna Dzietczenia; T Wróbel; B Jaźwiec; G Mazur; A Butrym; R Poręba; K Kuliczkowski Journal: Int J Lab Hematol Date: 2010-12 Impact factor: 2.877
Authors: Christine P Hans; Dennis D Weisenburger; Timothy C Greiner; Randy D Gascoyne; Jan Delabie; German Ott; H Konrad Müller-Hermelink; Elias Campo; Rita M Braziel; Elaine S Jaffe; Zenggang Pan; Pedro Farinha; Lynette M Smith; Brunangelo Falini; Alison H Banham; Andreas Rosenwald; Louis M Staudt; Joseph M Connors; James O Armitage; Wing C Chan Journal: Blood Date: 2003-09-22 Impact factor: 22.113
Authors: Bin Yin; Ruud Delwel; Peter J Valk; Margaret R Wallace; Mignon L Loh; Kevin M Shannon; David A Largaespada Journal: Blood Date: 2008-10-23 Impact factor: 22.113