Literature DB >> 25352738

Novel mutations in the TSPAN12 gene in Chinese patients with familial exudative vitreoretinopathy.

Yu Xu1, Lulin Huang2, Jing Li1, Qi Zhang1, Ping Fei1, Xiong Zhu2, Zhengfu Tai3, Shi Ma4, Bo Gong4, Yun Li5, Weizhou Zang6, Xianjun Zhu2, Peiquan Zhao1, Zhenglin Yang2.   

Abstract

PURPOSE: Familial exudative vitreoretinopathy (FEVR) is a group of inherited blinding eye diseases characterized by defects in the development of the retinal vessels. Recent studies have identified genetic variants in tetraspanin 12 (TSPAN12) as a cause of FEVR. The purpose of this study was to identify novel TSPAN12 mutations in Chinese patients with FEVR and to describe the associated phenotypes.
METHODS: Mutation screening was performed by directly sequencing PCR products of genomic DNA with primers designed to amplify the seven coding exons and adjacent intronic regions of the FEVR-causing gene TSPAN12. Clinical phenotypes of the patients with TSPAN12 mutations were documented. Wild-type and mutant TSPAN12 proteins were assayed for the Norrin-β-catenin signaling pathway with luciferase reporter assays.
RESULTS: Three novel heterozygous mutations in TSPAN12 were identified: c.566G>A (p.C189Y), c.177delC (p.Y59fsX67), and c.C254T (p.T85M). All three mutations involved highly conserved residues and were not present in 200 normal individuals. Ocular phenotypes included increased ramification of the peripheral retinal vessels, a peripheral avascular zone, inferotemporal dragging of the optic disc and macula, and retinal folds. The probands showed relatively severe retinopathy, whereas the other family members were often asymptomatic. In SuperTopFlash (STF) cell line transfection studies, C189Y, Y59fsX67, and T85M mutants failed to induce luciferase reporter activity in response to Norrin.
CONCLUSIONS: We found three novel TSPAN12 mutations in Chinese patients with autosomal dominant FEVR, and suggest that TSPAN12 mutations cause FEVR. The phenotypes associated with the TSPAN12 mutations showed extensive variation in disease severity among members of the same family, which implied the complexity of FEVR mutations and phenotypes.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25352738      PMCID: PMC4169774     

Source DB:  PubMed          Journal:  Mol Vis        ISSN: 1090-0535            Impact factor:   2.367


Introduction

Familial exudative vitreoretinopathy (FEVR, OMIM 133780, 305390, 605750, 601813, 613310) is a hereditary disorder with defects in the development of retinal vasculature [1]. A wide range of clinical manifestations have been found in patients with FEVR. Severely affected patients suffer from blindness during infancy, and manifest retinal folds or detachments. In contrast, mildly affected patients usually have no visual problems and do not need to undergo fluorescein angiography unless a severely affected family member is diagnosed. In the past two decades or so, four genes that cause FEVR have been identified: NDP (OMIM 300658, X-linked), LRP5 (OMIM 603506, dominant and recessive), FZD4 (OMIM 604579, dominant) [2-4], and TSPAN12 (OMIM 613138, dominant and recessive) [5-10]. All the proteins encoded by the FEVR genes have been found to participate in the Norrin-β-catenin signaling pathway [4-7]. In addition, another locus for autosomal dominant FEVR (adFEVR), EVR3, has been mapped to chromosomal locus 11p12-p13 [11]. In this study, three novel TSPAN12 mutations in patients with FEVR were identified, and we demonstrated that these three mutants failed to induce luciferase reporter activity in HEK293 transfection studies.

Methods

Patients and clinical examinations

This study adhered to the ARVO statement on human subjects and was approved by the Institutional Review Board of the Xinhua Hospital affiliated with the Shanghai Jiao Tong University School of Medicine and the Institutional Review Board of the Sichuan Academy of Medical Sciences and Sichuan Provincial People’s Hospital, China. The study complied with the guidelines of the Declaration of Helsinki and the Guidance of Sample Collection of Human Genetic Disease of the Ministry of Public Health of China. Informed consent was obtained from all participants in the study. 85 outpatients diagnosed as FEVR were recruited: 47 were male and 38 were female. The age of all participants ranged from 2 months to 14 years old. Their parents were also recruited in this study. All participants were in good health when they were recruited, except for the eye. For minors, written consent was obtained from their parents. All participants underwent careful ophthalmology examinations, and were diagnosed by a clinical ophthalmologist and a geneticist based mainly on the presence of retinal abnormalities in fundus photographs deemed typical of FEVR, which included an avascular peripheral retina together with exudative and/or sequelae of retinal traction, such as macular ectopia, retinal folds, and retinal detachment. Fundus fluorescein angiography (FFA) was performed in selected cases to confirm further the diagnosis. In the 200 normal matched controls, all individuals underwent an eye examination and no signs of eye diseases were observed. Venous blood samples were obtained from all subjects in EDTA Vacutainers.

Detection of TSPAN12 mutations

Genomic DNA samples were extracted from the peripheral blood of the subject patients using a whole blood DNA extraction kit (BioTeke, Beijing, China). Venous blood in EDTA vautainers was stored in 4 ºC and processed within 24 h after blood drawn. Genomic DNA samples were extracted blood DNA extraction kit following manufacture’s instruction (Bioteke). All patients had been confirmed beforehand as carrying no mutations in FZD4, LRP5, or NDP. To identify mutations in the coding exons of the TSPAN12 gene, oligonucleotide primers flanking the coding regions and neighboring intronic sequences were designed (Table 1). The exons of the TSPAN12 gene were analyzed via direct sequencing of the PCR products. PCR working conditions are as following: initial denature temperature 95 ºC for 3 min, followed by 33 cycles of reaction: template denature at 95 ºC for 15 s, annealing for 15 s at 59 ºC and extension at 72 ºC for 20 s. A final step of 7 min reaction extension at 72 ºC was applied to fill in the gaps of PCR product. Amplified products were purified using the QIAquick Gel Extraction Kit (Qiagen, Valencia, CA), and were sequenced with forward and reverse primers by the BigDye Terminator v3.1 Cycle Sequencing Kit (ABI Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. After sequence changes were detected in the probands, samples from the other family members were analyzed with direct sequencing.
Table 1

Primer sequences of TSPAN12.

ExonForward primer (5′>3′)Reverse primer (5′>3′)Amplicon length (bp)
2
GGTGAGATGTCCCGTGTTCT
TCAAAGGCATTTTAAGAAGGTCA
340
3
AATCCTGCAGTGAATGTTACG
AGGCGCACCTTAAGGAGAAT
314
4
TGCTATGTCTTGGGTGCATT
AAACGAAAGCGTCCCTTCTT
331
5
TGCCTCTGTTTTCTTGGTCA
TTCACCTTCTGCCATGATTG
367
6
CGAGTATGCGTGTGTACGTG
GAAGAAAAGCAGGCCATGAA
393
7
TTTGTGGTTTCTGAGGCTGA
TTTCTTCTGCTTCTCCCCATA
333
8ACAGATTGTTTGCTTTCATGCTTAGGTGTTATTTTATGGC505

Primer used for amplification and sequence analysis of human TSPAN12.

Primer used for amplification and sequence analysis of human TSPAN12.

Construction of expression plasmids

The cDNA encoding wild-type TSPAN12 (Origene, Rockville, MD) was subcloned in-frame into the pCMV-entryMyc-Flag vector (Origene) using SgfI and MluI sites. All mutations were introduced into the wild-type TSPAN12 cDNA by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). LRP5, FZD4, and Norrin expression vectors (generously provided by Dr. Jeremy Nathans of Johns Hopkins University) have been described previously [12]. The recombinant plasmids containing TSPAN12-Myc-Flag fusion constructs were first verified with DNA sequencing, and then prepared for transfection using Qiagen plasmid Maxi preparation kit (Qiagen).

Luciferase assays

The SuperTopFlash (STF) reporter, in which firefly luciferase was driven by seven lymphoid enhancer factor/T-cell factor (LEF/TCF) consensus binding sites, was a kind gift from Dr. Jeremy Nathans (John Hopkins University, Baltimore, MD). This reporter plasmid was stably transfected into HEK 293 cells as reported previously to generate the STF cell line. In 24-well plates, 160 K STF cells/well were transfected with 800 ng DNA and 1.5 µl Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA). The DNA mix contained 200 ng of Norrin, 200 ng of FZD4, 200 ng of LRP5, 100 ng of pSV-β-galactosidase control vector and 100 ng of TSPAN12 plasmid (wild-type or mutation). Forty-eight hours after transfection, the cells were harvested and washed twice with PBS (1X; 120 mM NaCl, 20 mM KCl 10 mM NaPO4, 5 mM KPO4, pH 7.4), and the luciferase activities were measured with a Dual-Luciferase Assay Kit (Promega) according to the manufacturer’s instructions. Reporter activity was normalized to the coexpressed β-galactosidase activity in each well. Each test was performed in triplicate. The reporter assay was repeated three times, and a representative result was obtained.

Expression of TSPAN12 in Cos 7 cells

Cos 7 cells (American Type Culture Collection [ATCC], Manassas, VA) were cultured in DMEM (ATCC, Manassas, VA) with high glucose (HyClone) supplemented with 10% fetal bovine serum and 1% (vol/vol) penicillin/streptomycin at 37 °C in a 5% CO2 atmosphere. Cells were seeded in six-well plates (Corning Inc., Corning, NY) and transfected at 50% confluency with 1 μg of wild-type and mutant pCMV6-entry-TSPAN12 or empty vector using Lipofectimine 2000 (Invitrogen) according to the manufacturer’s instructions. After 48 h, the cells were washed with PBS, and fixed with 4% paraformaldehyde (PFA) for 15 min. Anti-Flag antibody was used to detect TSPAN12 expression using standard immunostaining method.

Results

Identification of novel TSPAN12 mutations and phenotypes

We identified three proband patients with FEVR in our clinic. To identify causative genes for FEVR, we sequenced all the exons and the flanking intonic sequences for four known FEVR genes: FZD4, LRP5, Norrin, and TSPAN12. Three novel mutations in the coding sequence of the TSPAN12 gene were found in these families, including c.566G>A (p.C189Y), c.177delC (Y59fsX67), and c.C254T (p.T85M; Figure 1).
Figure 1

Chromatograms and pedigrees of three families with familial exudative vitreoretinopathy. Three novel mutations were identified in TSPAN12. A: In Family A, the affected mother and son had the c.566G>A (p.C189Y) mutation. C: In Family B, the patient and her affected mother had the c.177delC (p.Y59fsX67) mutation. E: In Family C, the affected mother and son had the c.C254T (p.T85M) mutation. The columns from left to right display the pedigree and the sequence chromatograms of these patients (A, C, E) and the normal controls (B, D, F). Arrows indicate the positions of the altered nucleotides.

Chromatograms and pedigrees of three families with familial exudative vitreoretinopathy. Three novel mutations were identified in TSPAN12. A: In Family A, the affected mother and son had the c.566G>A (p.C189Y) mutation. C: In Family B, the patient and her affected mother had the c.177delC (p.Y59fsX67) mutation. E: In Family C, the affected mother and son had the c.C254T (p.T85M) mutation. The columns from left to right display the pedigree and the sequence chromatograms of these patients (A, C, E) and the normal controls (B, D, F). Arrows indicate the positions of the altered nucleotides. In Family A, we identified a missense mutation in exon 7, c.566G>A, segregating with the disease. This mutation led to the replacement of a cysteine by a tyrosine at codon 189 (p.C189Y; Figure 1), which involved a highly evolutionarily conserved residue (Figure 2A) from Homo sapiens to Danio rerio. The proband of the family was a 1-year-old boy with bilateral retinal folds affecting the macula (Figure 3). His mutation-carrying mother had normal vision but with areas of avascular zone and abnormal vessels in the peripheral retina (Figure 3).
Figure 2

Protein sequence alignment of human TSPAN12 with its orthologs. The conserved amino acid residues are shaded. The orthologs are from the following species: Homo sapiens (NP_036470), Pan troglodytes (XP_001142754), Musmusculus (NP_766595), Rattus norvegicus (NP_001015026), Bos taurus (NP_001039977), Equus caballus (XP_001502093), Canis lupus familiaris (XP_855095), Monodelphis domestica (XP_001364876), Gallus gallus (NP_001007850), Taeniopygia guttata (XP_002192381), Ornithorhynchus anatinus (XP_001516347), and Danio rerio (NP_957446). A: The residue of the missense mutation p.C189Y is highly conserved. B: The residue of the missense mutation p.T85M is also highly conserved.

Figure 3

Fundus photographs of Family A with familial exudative vitreoretinopathy. A and B: Fundus photographs of the proband from Family A (individual II:1 in Figure 1), showing a retinal fold and a dragged macula. C and D: The unaffected father without the mutation has normal fundi. E and F: Fundus photographs of the asymptomatic mother with the c.566G>A mutation show normal posterior fundi. G and H: The mother has areas of avascularity and abnormal vessels in the peripheral retina.

Protein sequence alignment of human TSPAN12 with its orthologs. The conserved amino acid residues are shaded. The orthologs are from the following species: Homo sapiens (NP_036470), Pan troglodytes (XP_001142754), Musmusculus (NP_766595), Rattus norvegicus (NP_001015026), Bos taurus (NP_001039977), Equus caballus (XP_001502093), Canis lupus familiaris (XP_855095), Monodelphis domestica (XP_001364876), Gallus gallus (NP_001007850), Taeniopygia guttata (XP_002192381), Ornithorhynchus anatinus (XP_001516347), and Danio rerio (NP_957446). A: The residue of the missense mutation p.C189Y is highly conserved. B: The residue of the missense mutation p.T85M is also highly conserved. Fundus photographs of Family A with familial exudative vitreoretinopathy. A and B: Fundus photographs of the proband from Family A (individual II:1 in Figure 1), showing a retinal fold and a dragged macula. C and D: The unaffected father without the mutation has normal fundi. E and F: Fundus photographs of the asymptomatic mother with the c.566G>A mutation show normal posterior fundi. G and H: The mother has areas of avascularity and abnormal vessels in the peripheral retina. We identified one base pair deletion in exon 4, c.177delC, in the proband of Family B and her asymptomatic mother. This mutation resulted in a frameshift followed by premature termination at codon 67 (p.Tyr59fsX67; Figure 1), which also involved highly evolutionarily conserved residues (Figure 2C) from Homo sapiens to Danio rerio. The proband was a 2-year-old girl with a complaint of esotropia. Fundus examination showed typical falciform retinal folds across the fovea in both eyes (Figure 4). Her father had normal fundi, but her mother had typical fundus changes in FFA examination, including increased ramification of the peripheral retinal vessels and an avascular zone in the peripheral retina, though she had normal visual acuity of 1.0 in both eyes and had no vision complaints (Figure 4).
Figure 4

Fundus photographs of Family B with familial exudative vitreoretinopathy. A and B: Fundus photographs of the proband from Family B (individual II:1 in Figure 1), showing the retinal vessels drawn up in a retinal fold that is obscuring the macula. C and D: The unaffected father has normal fundi. E and F: Fundus photographs of the asymptomatic mother with the c.177delC mutation show normal posterior fundi. G and H: The mother has increased vessel branching in the equatorial area and an avascular zone on the peripheral retina.

Fundus photographs of Family B with familial exudative vitreoretinopathy. A and B: Fundus photographs of the proband from Family B (individual II:1 in Figure 1), showing the retinal vessels drawn up in a retinal fold that is obscuring the macula. C and D: The unaffected father has normal fundi. E and F: Fundus photographs of the asymptomatic mother with the c.177delC mutation show normal posterior fundi. G and H: The mother has increased vessel branching in the equatorial area and an avascular zone on the peripheral retina. In Family C, a missense mutation c.C254T (p.T85M) segregating with the disease was identified (Figure 1). This mutation led to the change in a threonine residue to a methionine at codon 85 (p.T85M), which is extremely conserved from Homo sapiens to Danio rerio. (Figure 1, Figure 2B). The proband was a 7-year-old boy with dragged disc in his left eye (Figure 5). There was pigment deposit in his right retina. His mutation-carrying mother had normal vision but had areas of avascular peripheral retina. All three mutations cosegregated with the disease phenotype of the respective families, and were not detected in 200 ethnically matched control individuals.
Figure 5

Fundus photographs of Family C with familial exudative vitreoretinopathy. A and B: Fundus photographs of the proband from Family C (individual II:1 in Figure 1), showing a retinal fold and a dragged macula. C and D: The mother has areas of avascularity and abnormal vessels in the peripheral retina.

Fundus photographs of Family C with familial exudative vitreoretinopathy. A and B: Fundus photographs of the proband from Family C (individual II:1 in Figure 1), showing a retinal fold and a dragged macula. C and D: The mother has areas of avascularity and abnormal vessels in the peripheral retina.

Defective Norrin signaling mediated by mutant TSPAN12 proteins in vitro

To determine the effect of the TSPAN12 mutants on its biologic activity in Norrin/β-catenin signaling, we performed luciferase assays in STF cells using wild-type and three mutant TSPAN12 cDNAs. c.177delC, c.566G>A, and c.C254T were introduced into TSPAN12 with the site-direct mutagenesis method. Our in vitro analyses suggested that compared to wild-type TSPAN12, all three TSPAN12 mutants failed to induce luciferase reporter activity in STF cells in response to Norrin (Figure 6). Western blot analysis indicated that the T85M and Y59fsX67 mutant proteins were not stable (Figure 7). The C189Y mutant expression level was compatible to that of the wild-type (Figure 7 and Figure 8).The results suggest that the three TSPAN12 mutations identified in our study are pathogenic, and are consistent with the notion that defective Norrin/TSPAN12 signaling underlies FEVR.
Figure 6

Luciferase assays with the SuperTopFlash cell line transfected with the indicated plasmids. SuperTopFlash (STF) cells/well were transfected with 800 ng DNA (200 ng of Norrin, 200 ng of FZD4, 200 ng of LRP5, 100 ng of pSV-β-galactosidase control vector, and 100 ng of TSPAN12 plasmid [wild-type or mutation]) and 1.5 µl Lipofectamine 2000 transfection reagent. Forty-eight hours after transfection, the cells were harvested and washed twice with PBS. Luciferase activities were measured with a dual-luciferase assay kit. Reporter activity was normalized to the coexpressed β-galactosidase activity in each well. Each test was performed in triplicate. The reporter assay was repeated three times, and a representative result was obtained.

Figure 7

Western blot analysis by SDS-PAGE of the TSPAN12 mutants. Total protein (10 μg) isolated from cell lysates from luciferase assays was mixed with sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) loading buffer and subjected to SDS-PAGE and western blot analysis using anti-Flag antibody to detect TSPAN12 and FZD4 expression. Beta-actin was used as the loading control. The expression level of TSPAN12 C189Y was compatible with that of the wild-type. However, the T85M and Y59fs mutant proteins were not stable.

Figure 8

Immunofluorescence staining of the TSPAN12 C189Y mutant. Cos 7 cells were transfected either with human wild-type or mutant TSPAN12 cloned into the pCMV6-entry vector, or empty vector. Cells were washed with PBS after 48 h and fixed with 4% PFA for 15 min. Mouse monoclonal anti-Flag antibody and Alexa Fluor 594 goat anti-mouse immunoglobulin (IgG) secondary antibody were used to detect TSPAN12 expression with the standard immunostaining method. Red channel, TSPAN12; blue channel, 4',6-diamidino-2-phenylindole (DAPI) for nuclei staining.

Luciferase assays with the SuperTopFlash cell line transfected with the indicated plasmids. SuperTopFlash (STF) cells/well were transfected with 800 ng DNA (200 ng of Norrin, 200 ng of FZD4, 200 ng of LRP5, 100 ng of pSV-β-galactosidase control vector, and 100 ng of TSPAN12 plasmid [wild-type or mutation]) and 1.5 µl Lipofectamine 2000 transfection reagent. Forty-eight hours after transfection, the cells were harvested and washed twice with PBS. Luciferase activities were measured with a dual-luciferase assay kit. Reporter activity was normalized to the coexpressed β-galactosidase activity in each well. Each test was performed in triplicate. The reporter assay was repeated three times, and a representative result was obtained. Western blot analysis by SDS-PAGE of the TSPAN12 mutants. Total protein (10 μg) isolated from cell lysates from luciferase assays was mixed with sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS–PAGE) loading buffer and subjected to SDS-PAGE and western blot analysis using anti-Flag antibody to detect TSPAN12 and FZD4 expression. Beta-actin was used as the loading control. The expression level of TSPAN12 C189Y was compatible with that of the wild-type. However, the T85M and Y59fs mutant proteins were not stable. Immunofluorescence staining of the TSPAN12 C189Y mutant. Cos 7 cells were transfected either with human wild-type or mutant TSPAN12 cloned into the pCMV6-entry vector, or empty vector. Cells were washed with PBS after 48 h and fixed with 4% PFA for 15 min. Mouse monoclonal anti-Flag antibody and Alexa Fluor 594 goat anti-mouse immunoglobulin (IgG) secondary antibody were used to detect TSPAN12 expression with the standard immunostaining method. Red channel, TSPAN12; blue channel, 4',6-diamidino-2-phenylindole (DAPI) for nuclei staining.

Discussion

In our study, three novel TSPAN12 mutations were detected in three families with FEVR, but not in 200 normal individuals. The clinical signs and symptoms showed variations among the patients with TSPAN12 mutations, from mild avascular peripheral retina with retinal degeneration to severe bilateral retinal folds. Our data suggest variable expressivity of FEVR: The probands manifested relatively severe retinopathy, whereas the other family members had normal vision and were often asymptomatic, as had been reported in cases carrying mutations in FZD4 or LRP5 [4,13-15]. Our results are consistent with the data reported by Kashani et al. [16]. These family members might develop advanced FEVR later on, which could deteriorate to vision loss. Therefore, it is necessary to screen immediate family members of the patients with FEVR with retina angiography and clinical treatment. The location of three novel TSPAN12 mutations identified in our study reveals their pathogenic nature (Figure 9). The c.177delC mutation in exon 4 caused a frameshift with a premature termination at condon 67, resulting in truncated proteins that might not be synthesized because of nonsense-mediated decay of the messenger ribonucleic acid. The highly conserved cysteine residue at position 189 among tetraspanin family members plays a role in the formation of disulfide bridges, and is located in the large extracellular loop between the third and fourth transmembrane region. This extracellular loop is known to harbor most of the protein–protein interaction sites described for tetraspanins [17]. Thus, the substitution of a tyrosine residue for the cysteine at position 189 disrupts one of these interactions and, therefore, may have significant functional consequences, such as the interaction with the FZD4/LRP5/Norrin protein complex. Furthermore, the 189th cysteine is next to another TSPAN12 mutation G188R, a known FEVR mutation [6]. T85M is likely to bring about the change in the second transmembrane domain, as the other three known FEVR mutations (L101H, C105R, A237P) in the transmembrane domain do.
Figure 9

Diagram showing 9 known TSPAN12 mutations and three novel mutations identified in this study. The novel mutations are red.

Diagram showing 9 known TSPAN12 mutations and three novel mutations identified in this study. The novel mutations are red. In addition, in our STF cell line transfection studies, the defective luciferase reporter activity mediated by the mutant TSPAN12 proteins revealed that Y59fsX67, C189Y, and T85M mutations in TSPAN12 led to a decrease in Norrin/FZD4/LRP5 signaling, which further suggested these three mutations were pathogenic. In conclusion, our study has identified three novel TSPAN12 mutations causing autosomal dominant FEVR. The findings provide additional evidence that mutations in TSPAN12 are causative in patients with FEVR, and TSPAN12 is crucial for the development of the retinal vessels.
  17 in total

1.  Reduced bone mineral density and hyaloid vasculature remnants in a consanguineous recessive FEVR family with a mutation in LRP5.

Authors:  L M Downey; H M Bottomley; E Sheridan; M Ahmed; D F Gilmour; C F Inglehearn; A Reddy; A Agrawal; J Bradbury; C Toomes
Journal:  Br J Ophthalmol       Date:  2006-09       Impact factor: 4.638

2.  Familial exudative vitreoretinopathy.

Authors:  V G Criswick; C L Schepens
Journal:  Am J Ophthalmol       Date:  1969-10       Impact factor: 5.258

3.  Next-generation sequencing of a 40 Mb linkage interval reveals TSPAN12 mutations in patients with familial exudative vitreoretinopathy.

Authors:  Konstantinos Nikopoulos; Christian Gilissen; Alexander Hoischen; C Erik van Nouhuys; F Nienke Boonstra; Ellen A W Blokland; Peer Arts; Nienke Wieskamp; Tim M Strom; Carmen Ayuso; Mauk A D Tilanus; Sanne Bouwhuis; Arijit Mukhopadhyay; Hans Scheffer; Lies H Hoefsloot; Joris A Veltman; Frans P M Cremers; Rob W J Collin
Journal:  Am J Hum Genet       Date:  2010-02-12       Impact factor: 11.025

4.  Mutations in TSPAN12 cause autosomal-dominant familial exudative vitreoretinopathy.

Authors:  James A Poulter; Manir Ali; David F Gilmour; Aine Rice; Hiroyuki Kondo; Kenshi Hayashi; David A Mackey; Lisa S Kearns; Jonathan B Ruddle; Jamie E Craig; Eric A Pierce; Louise M Downey; Moin D Mohamed; Alexander F Markham; Chris F Inglehearn; Carmel Toomes
Journal:  Am J Hum Genet       Date:  2010-02-12       Impact factor: 11.025

5.  Mutations in the TSPAN12 gene in Japanese patients with familial exudative vitreoretinopathy.

Authors:  Hiroyuki Kondo; Shunji Kusaka; Aki Yoshinaga; Eiichi Uchio; Akihiko Tawara; Kenshi Hayashi; Tomoko Tahira
Journal:  Am J Ophthalmol       Date:  2011-02-19       Impact factor: 5.258

6.  Complexity of the genotype-phenotype correlation in familial exudative vitreoretinopathy with mutations in the LRP5 and/or FZD4 genes.

Authors:  Minghui Qin; Hideyuki Hayashi; Kenji Oshima; Tomoko Tahira; Kenshi Hayashi; Hiroyuki Kondo
Journal:  Hum Mutat       Date:  2005-08       Impact factor: 4.878

7.  TSPAN12 regulates retinal vascular development by promoting Norrin- but not Wnt-induced FZD4/beta-catenin signaling.

Authors:  Harald J Junge; Stacey Yang; Jeremy B Burton; Kim Paes; Xiao Shu; Dorothy M French; Mike Costa; Dennis S Rice; Weilan Ye
Journal:  Cell       Date:  2009-10-16       Impact factor: 41.582

8.  Appearance of new tetraspanin genes during vertebrate evolution.

Authors:  Antonio Garcia-España; Pei-Jung Chung; Indra Neil Sarkar; Eric Stiner; Tung-Tien Sun; Rob Desalle
Journal:  Genomics       Date:  2008-02-21       Impact factor: 5.736

9.  A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

Authors:  Z Y Chen; E M Battinelli; A Fielder; S Bundey; K Sims; X O Breakefield; I W Craig
Journal:  Nat Genet       Date:  1993-10       Impact factor: 38.330

10.  Novel TSPAN12 mutations in patients with familial exudative vitreoretinopathy and their associated phenotypes.

Authors:  Huiqin Yang; Xueshan Xiao; Shiqiang Li; Guiying Mai; Qingjiong Zhang
Journal:  Mol Vis       Date:  2011-04-29       Impact factor: 2.367

View more
  11 in total

1.  Ultra-wide-field scanning laser ophthalmoscopy assists in the clinical detection and evaluation of asymptomatic early-stage familial exudative vitreoretinopathy.

Authors:  Jiao Lyu; Qi Zhang; Shi-Yuan Wang; Yi-Ye Chen; Yu Xu; Pei-Quan Zhao
Journal:  Graefes Arch Clin Exp Ophthalmol       Date:  2016-07-14       Impact factor: 3.117

2.  Genotype-phenotype associations in familial exudative vitreoretinopathy: A systematic review and meta-analysis on more than 3200 individuals.

Authors:  Xiaona Wang; Jun Chen; Hui Xiong; Xuhui Yu
Journal:  PLoS One       Date:  2022-07-13       Impact factor: 3.752

3.  Structure and function of the retina of low-density lipoprotein receptor-related protein 5 (Lrp5)-deficient rats.

Authors:  John L Ubels; Cheng-Mao Lin; David A Antonetti; Monica Diaz-Coranguez; Cassandra R Diegel; Bart O Williams
Journal:  Exp Eye Res       Date:  2022-02-06       Impact factor: 3.770

4.  Norrin restores blood-retinal barrier properties after vascular endothelial growth factor-induced permeability.

Authors:  Mónica Díaz-Coránguez; Cheng-Mao Lin; Stefan Liebner; David A Antonetti
Journal:  J Biol Chem       Date:  2020-02-21       Impact factor: 5.157

5.  Pathogenic variants and associated phenotypic spectrum of TSPAN12 based on data from a large cohort.

Authors:  Wenmin Sun; Xueshan Xiao; Shiqiang Li; Xiaoyun Jia; Panfeng Wang; Qingjiong Zhang
Journal:  Graefes Arch Clin Exp Ophthalmol       Date:  2021-04-27       Impact factor: 3.117

6.  Detection of FZD4, LRP5 and TSPAN12 Genes Variants in Malay Premature Babies with Retinopathy of Prematurity.

Authors:  Siti Zulaikha Nashwa Mohd Khair; Abdul Salim Ismail; Zunaina Embong; Abdul Aziz Mohamed Yusoff
Journal:  J Ophthalmic Vis Res       Date:  2019 Apr-Jun

7.  Prenatal diagnosis of familial exudative vitreoretinopathy and Norrie disease.

Authors:  Jingjing Liu; Jing Zhu; Jiyun Yang; Xiang Zhang; Qi Zhang; Peiquan Zhao
Journal:  Mol Genet Genomic Med       Date:  2018-11-25       Impact factor: 2.183

8.  Mutation spectrum of the Norrie disease pseudoglioma (NDP) gene in Indian patients with FEVR.

Authors:  Ganeswara Rao Musada; Subhadra Jalali; Anjli Hussain; Anupama Reddy Chururu; Pramod Reddy Gaddam; Subhabrata Chakrabarti; Inderjeet Kaur
Journal:  Mol Vis       Date:  2016-05-16       Impact factor: 2.367

9.  Mutation spectrum of the FZD-4, TSPAN12 AND ZNF408 genes in Indian FEVR patients.

Authors:  Ganeswara Rao Musada; Hameed Syed; Subhadra Jalali; Subhabrata Chakrabarti; Inderjeet Kaur
Journal:  BMC Ophthalmol       Date:  2016-06-17       Impact factor: 2.209

Review 10.  Complex genetics of familial exudative vitreoretinopathy and related pediatric retinal detachments.

Authors:  Hiroyuki Kondo
Journal:  Taiwan J Ophthalmol       Date:  2015-06-06
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.