| Literature DB >> 25341029 |
Federico Perini1, Luca Galluzzi2, Carmela Dell'Aversano3, Emma Dello Iacovo4, Luciana Tartaglione5, Fabio Ricci6, Martino Forino7, Patrizia Ciminiello8, Antonella Penna9.
Abstract
The dinoflagellate Alexandrium minutum is known for the production of potent neurotoxins affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). The aim of this study was to investigate the relationship between the toxin content and the expression level of the genes involved in paralytic shellfish toxin (PST) production. The algal cultures were grown both in standard f/2 medium and in phosphorus/nitrogen limitation. In our study, LC-HRMS analyses of PST profile and content in different Mediterranean A. minutum strains confirmed that this species was able to synthesize mainly the saxitoxin analogues Gonyautoxin-1 (GTX1) and Gonyautoxin-4 (GTX4). The average cellular toxin content varied among different strains, and between growth phases, highlighting a decreasing trend from exponential to stationary phase in all culture conditions tested. The absolute quantities of intracellular sxtA1 and sxtG mRNA were not correlated with the amount of intracellular toxins in the analysed A. minutum suggesting that the production of toxins may be regulated by post-transcriptional mechanisms and/or by the concerted actions of alternative genes belonging to the PST biosynthesis gene cluster. Therefore, it is likely that the sxtA1 and sxtG gene expression could not reflect the PST accumulation in the Mediterranean A. minutum populations under the examined standard and nutrient limiting conditions.Entities:
Mesh:
Substances:
Year: 2014 PMID: 25341029 PMCID: PMC4210898 DOI: 10.3390/md12105258
Source DB: PubMed Journal: Mar Drugs ISSN: 1660-3397 Impact factor: 5.118
Figure 1Intracellular GTX1/4 content in the Mediterranean A. minutum strains during the exponential and stationary growth phases (means ± SD, n = 3).
Figure 2The sxtA1 and sxtG gene expression in standard nutrient condition. Absolute quantification of sxtA1 (A) and sxtG mRNA (B) during the exponential and stationary phases of growth (means ± SD, n = 3). The sxtG expression was determined only in two strains of A. minutum (AMI2OL and AMIB5), the only ones for which the PCR amplification was confirmed with our specific primers using genomic DNA.
Figure 3Intracellular toxin content in the Mediterranean A. minutum strains during the exponential and stationary growth phases (means ± SD, n = 3) (A) and sxtA1 gene expression as mRNA copy per µg RNA−1 (B) under phosphorus limitation (means ± SD, n = 3). The sxtA1 gene expression was undetectable in the CBA57; thus, sxtA1 copy (µg RNA−1) values were omitted.
Figure 4Intracellular toxin content in the Mediterranean A. minutum strains during the exponential and stationary growth phases (means ± SD, n = 3) (A) and sxtA1 gene expression as mRNA copy per µg RNA−1 (B) under nitrogen limitation (means ± SD, n = 3). In the A. minutum AMIB5 strain, the sxtA1 expression was not detected in the stationary phase.
Precursor ion, formula, mass range, and collision energy (%), used in the chemical analyses, and limit of detection (LOD) and quantification (LOQ) measured.
| Toxin | Precursor Ion ( | Formula | Product Ion ( | Collision Energy (CE) % | LOD (ng/mL) | LOQ (ng/mL) |
|---|---|---|---|---|---|---|
| GTX1/4 | 332.1 | [M + H − SO3]+ | 314.1204 | 20 | 5/30 | 11/56 |
| STX | 300.1 | [M + H]+ | 282.1311 | 22 | 21 | 40 |
| B1 | 300.1 | [M + H − SO3]+ | 282.1311 | 22 | 43 | 86 |
| dcSTX | 257.1 | [M + H]+ | 239.1255 | 24 | 37 | 70 |
| GTX2/3 | 316.1 | [M + H − SO3]+ | 298.1254 | 21 | 40/30 | 78/60 |
| C1/2 | 316.1 | [M + H − 2SO3]+ | 298.1254 | 21 | 23/28 | 47/60 |
| NEO | 316.1 | [M + H]+ | 298.1254 | 21 | 9 | 18 |
| dcGTX2/3 | 273.1 | [M + H − SO3]+ | 255.1201 | 25 | 71/60 | 140/130 |
| dcNEO | 273.1 | [M + H]+ | 255.1201 | 25 | 70 | 140 |
Primers designed in this study or previously developed including optimized final concentrations for the real-time PCR assay.
| Primers | Sequences 5′→3′ | Concentration |
|---|---|---|
| sxtA1 alex. F | GCAGCGATGCTACTCCTACTACGT | 600 nM |
| sxtG F | Ccgggccgtgaaggat | 600 nM |
| Act a.min upp. | Agattgtgcgcgatgtcaagg | 400 nM |
| 5.8S 3′ | [ | 400 nM |
| β2M F | [ | 200 nM |