Literature DB >> 25333874

Effects of light and covering behavior on PAX6 expression in the sea urchin Strongylocentrotus intermedius.

Chong Zhao1, Nanjing Ji2, Ping Sun2, Wenping Feng2, Jing Wei2, Yaqing Chang2.   

Abstract

We studied the diel expression pattern of PAX6 (a structural gene that is commonly involved in the eye development and photoreception of eye forming animals) and the effects of light and covering behavior on PAX6 expression in the sea urchin Strongylocentrotus intermedius. We confirmed that aphotic condition significantly reduced covering behavior in S. intermedius. The diel expression pattern of PAX6 was significantly different in S. intermedius under photic and aphotic conditions. The gene expression of PAX6 significantly deceased in covered S. intermedius both under natural light and in darkness. The present finding provides valuable insight into the probable link between covering and PAX6 expression of sea urchins. Further studies are required to investigate the detailed expression network of light detection involved genes in order to fully reveal the molecular mechanism of the light-induced covering behavior of sea urchins.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25333874      PMCID: PMC4204992          DOI: 10.1371/journal.pone.0110895

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The sea urchin is good model for studying the mechanisms of light detection and consequently light-induced behavioral and physiological responses of animals that lack specialized eyes [1]. However, it had remained poorly understood until the genome data of the sea urchin Strongylocentrotus purpuratus surprisingly revealed more opsin genes and typical “eye” genes (for example, PAX6) than previously thought [2]. Recently, it has been convincingly shown that the tube feet are photosensory organs, in which the strong expression of rhabdomeric opsin genes (for example, Opsin4) and PAX6, highlighted the photoreceptor function and development in the sea urchins S. purpuratus [3] and S. droebachiensis [4], respectively. PAX6 is a transcription factor gene commonly involved in eye development and photoreception of eye forming animals. PAX6 expression indicates conservation of the specification process of the photoreceptor cells (PRCs) consequently deploying as canonical eye genes in echinoids [3]. In addition, PAX6, as a developmental regulator of cell differentiation, directly regulates the expression of opsin genes. However, the responses of PAX6 expression to environmental and behavioral factors remain largely unknown in sea urchins. Lesser et al. (2011) [4] reported that gene expression of the rhabdomeric-like opsin in the tube feet was significantly different from different areas of the test of S. droebachiensis. This suggests that opsin gene expression is related with the amount of exposure of tube feet to light. To our knowledge, however, it is totally unknown whether PAX6 is expressed in sea urchins in aphotic condition. This greatly hampers our understanding of the complex biological functions of relevant genes in PRCs. Moreover, we know of no report on the relationship between the relevant expression of PRCs involved genes and the consequent light-induced behavioral response in sea urchins. Covering behavior refers to sea urchins using their tube feet and spines to move objects, such as shells, stones and algal fragments onto their dorsal surface in both shallow water [5] and the deep sea [6]. It has been well documented that covering behavior has evolved as a defensive adaptation against both UV radiation [5], [7], [8] and sunlight intensity [9]. In addition to light responsive functions, opsin genes have recently been shown to have a number of novel functions in Drosophila, such as temperature sensation [10] and mechanosensation [11]. It should be noted that covering behavior of sea urchins has been observed in the aphotic deep-sea [6], clearly indicating that light is not the only factor determining covering behavior in sea urchins. This raises an interesting question of whether covering behavior affects expression of PRCs involved genes in sea urchins under aphotic conditions. We hypothesized that covering behavior probably affects the the expression of PAX6 in sea urchins in both photic and aphotic conditions. The sea urchin Strongylocentrotus intermedius is distributed on intertidal and subtidal rocky bottoms in northern Pacific coastal waters of Hokkaido of Japan, Korea, Far East Russia and China [12]. We were motivated to investigate how light and covering behavior affect the expression of PAX6 in the sea urchin Strongylocentrotus intermedius. The main purposes of the present study are to investigate 1) whether PAX6 of S. intermedius is expressed under short-term aphotic condition; 2) the comparative diel expression patterns of PAX6 under short-term photic and aphotic conditions; 3) whether aphotic conditions significantly affect covering behavior; 4) whether covering behavior affects PAX6 expression under both short-term photic and aphotic conditions.

Results

PAX6 expression with exposure to natural sunlight and in darkness

Light intensity at the bottom of the tanks was highest at 12:00 and lowest from 21:00 to 3:00 (Fig. 1). The test diameter of all sea urchins used was 35.01±3.09 mm and did not differ significant among light conditions.
Figure 1

Natural light intensity at the bottom of the tanks during the diel cycle (N = 3, mean ± SE).

Diel patterns of gene expression of PAX6 were significantly different between the S. intermedius under natural light and dark conditions (P<0.001, Fig. 2). PAX6 of S. intermedius in darkness showed a stable relative expression of about 1 during the diel cycle. Relative gene expression of PAX6 of S. intermedius showed a generally inverse relationship to intensity of natural light in the diel cycle, although the p was not significant (P = 0.071). In this pattern, PAX6 reached lowest level of relative gene expression at 12:00, when the light intensity was highest in the diel cycle (1808.67±20.70 lx), and significantly increased to the highest level of about 6 at 6:00, when the light intensity was very low (123.73±5.02 lx).
Figure 2

Relative expression of PAX 6 in tube feet of Strongylocentrotus intermedius under different light conditions during a diel cycle (N = 3, mean ± SE).

Different letters above the line refer to significant difference in the group of light.

Relative expression of PAX 6 in tube feet of Strongylocentrotus intermedius under different light conditions during a diel cycle (N = 3, mean ± SE).

Different letters above the line refer to significant difference in the group of light.

PAX6 expression and covering behavior

The mean test diameter of the experimental sea urchins was 40.08±2.38 mm and did not differ significantly among experimental groups (P>0.05). The number of shells used for covering was significantly higher in S. intermedius under natural light than in darkness (P = 0.029, Fig. 3).
Figure 3

Number of shells used for covering by Strongylocentrotus intermedius under photic (Y) or aphotic (N) conditions (N = 16, mean ± SE).

Relative expression of PAX6 significantly decreased in covered S. intermedius both under natural light and in darkness (P = 0.012, Fig. 4). However, light did not significantly affect the gene expression of PAX6 (P = 0.745).
Figure 4

Effect of covering behavior on relative expression of PAX 6 in Strongylocentrotus intermedius under photic and aphotic conditions.

Y: covering material present. N: covering material not present. (N = 4, mean ± SE).

Effect of covering behavior on relative expression of PAX 6 in Strongylocentrotus intermedius under photic and aphotic conditions.

Y: covering material present. N: covering material not present. (N = 4, mean ± SE).

Discussion

Light detection by the tube feet of sea urchins involves the arrangement of the ossicles, which function as a light collector [4]. These ossicles are perforated and lined with pigment cells that express PAX6 proteins that are universally involved in the development of eyes in the organisms with eye structures [4]. Understanding the biological functions of PAX6 in sea urchins remains basically unknown although its pattern of expression has been clearly described [3], [4]. While there is no direct evidence that PAX6 expression is involved in the light detection of sea urchins, PAX6 was clearly demonstrated to regulate structural genes involved photoreception in the fruitfly Drosophila melanogaster [13]. Thus, it is important to investigate the potential relationship between light condition and PAX6 gene expression in sea urchins. To our knowledge, the present study is the first investigation on the diel expression pattern of genes involved in light detection in sea urchins. The pattern of expression of PAX6 in sea urchins under natural light showed a general inverse relationship with the natural light intensity in the diel cycle although the p value was not significant. As PAX6 is a direct regulator of the expression of opsin genes in many species [14], a reasonable explanation for the diel pattern of PAX6 expression is that it translates into the regulation of opsin genes, although we did not measure the expressions of opsin genes in the present study. This opinion is consistent with the previous study by Lesser et al. (2011) [4] of a significant inverse relationship between gene expression of rhabdomeric-like opsin and tube feet position of the test, which involves a difference in exposure to natural light. However, when we put sea urchins in constant darkness, the PAX6 expression showed a significantly different diel pattern. These results convincingly indicate PAX6 expression in tube feet of sea urchins is light dependent, although the biological functions remain largely unknown. In the sea urchin Hemicentrotus pulcherrimus, Ooka et al. (2010) [15] reported the expression of encephalopsin in the tube feet significantly decreased under dark condition, which is consistent with our result. Thus, it would be very interesting to investigate the expression patterns of opsins and PAX6 in the sea urchins living in the deep sea [6]. Light has been well documented to be an important factor affecting the covering behavior of sea urchins [7], [8], [9], [16]. In the present study, we found the number of shells used for covering was significantly higher in S. intermedius under natural light than in darkness. This result agrees with the finding of Dumont et al. (2007) [7] that sea urchins covered themselves significantly more with exposure to natural light than in darkness. This confirms that light can significantly induce covering behavior in a number of sea urchin species, although covering behavior also exists under aphotic conditions [6]. A generally accepted explanation of this phenomenon is that covering behavior is a protective process against light radiation [9]. However, the molecular neural process of the light-induced covering behavior in sea urchins remains totally unknown. Lesser et al. (2011) [4] hypothesized the light sensitive genes could function in behavioral responses (for example, covering behavior) to light exposure. This raises an interesting question of whether covering behavior significantly affects PAX6 expression of sea urchins in photic and aphotic conditions. In the present study, we found that covering behavior significantly reduced gene expression of PAX6 in S. intermedius under natural light. As covering behavior, as generally accepted, has a protective function against light radiation, covered sea urchins should detect less light than uncovered sea urchins. However, the diel pattern result of the PAX6 expression showed that expression of PAX6 significantly increased in sea urchins when light intensity decreased. It is unreasonable to suppose that covering behavior does not protect sea urchins against light radiation because covered sea urchins have their test covered and tube feet retracted. This is supported by our further finding that the PAX6 expression of S. intermedius also significantly decreased in covered sea urchins in darkness. These results clearly indicate that the significant effect of covering behavior on PAX6 expression is not light dependent under the experimental conditions. It also highlights that PAX6 of sea urchins probably plays complex and novel biological roles, which have been well documented in vertebrates. For example, Kim et al (2014) [17] found that PAX6 expression played an important role in glutamatergic neuronal differentiation, which effectively regulated the autism-like behavior of rats, whose parents were prenatally exposed to valproic acid. These results suggest that there is probably a novel link between PAX6 expression and covering in sea urchins, especially in the species existing in aphotic deep seas [6]. Further studies are required to investigate the detailed expression network of relevant genes involved in light detection, in order to completely reveal to the molecular mechanism of the light-enhanced covering behavior of sea urchins. In conclusion, we confirmed that aphotic condition significantly reduced covering behavior in S. intermedius. The diel expression pattern of PAX6 was significantly different in S. intermedius under short-term photic and aphotic conditions. The gene expression of PAX6 significantly deceased in covered S. intermedius both under short-term natural light and in darkness. The present study enriches our understanding about the responses of PAX6 expression to light and covering behavior in sea urchins. To be noted, however, the present study did not measure the protein level of PAX6. This should be investigated in the future.

Materials and Methods

Sea urchins

A batch of S. intermedius was transported from Dalian Haibao Fisheries Company to Key Laboratory of Mariculture & Stock Enhancement in North China's Sea, Ministry of Agriculture, Dalian Ocean University on July 15, 2013. They were maintained in tanks and fed kelp ad libitum for 10 days to acclimate the natural cycle until used in the experiment. Natural sunlight and darkness were set up as the two light conditions. The intensity of natural sunlight was measured at the bottom of the tank during the diel cycle with an underwater irradiance meter. The tanks of the darkness group were covered with black plastic cloth to exclude light. Nine sea urchins were haphazardly collected from both light conditions at 0:00, 3:00, 6:00, 9:00, 12:00, 15:00, 18:00 and 21:00 hours on July 25 and 26, 2013. They were placed into containers with seawater to relax and extend their tube feet. There was no exposure to light except for quick samplings of urchin in darkness under very dim artificial light. Tube feet from the aboral portion of the test were quickly collected in from each individual. Tube feet from three individuals were combined and immediately frozen in liquid nitrogen and stored at −80°C until analysis. The same conditions were set up as in the above section. Twenty shells of the small bivalve Patinopecten yessoensis (shell length: 21.38±1.28 mm, shell height: 19.88±1.60 mm, shell weight: 0.29±0.07 g) were used as potential covering material and distributed evenly on the bottoms of the eight experiments tanks (55 cm×44 cm×37 cm). Eight similar tanks without covering material were set up as controls. The experiment began at 9:00, and ended at 12:00 on September 18, 2013. The number of shells used for covering was recorded 3 hours after the beginning of the experiment. The tube feet were collected as in the above section.

Total RNA extraction and cDNA synthesis

Total RNA was extracted from the tube feet of S. intermedius with the RNAsimple total RNA kit (TIANGEN, China) following the manufacturer instructions. The concentration and quality were determined using the NanoPhotometer (Implen GmbH, Germany) and agarose gels electrophoresis. First stand cDNA was synthesized using the RT reagent Kit (TaKaRa, Japan) according to the manufacturer instructions.

PAX6 expression measurement by quantitative Real-time PCR

The expression of PAX6 mRNA in S. intermedius was studied by quantitative Real-time PCR (qRT-PCR). The gene-specific primers were designed based on the cloned cDNA fragment of S. intermedius PAX6 (KF733999) using Primer Premier 5 software (Table 1). 18S ribosomal RNA was used as the reference gene [18]. The qRT-PCR was carried out in a 20 µL volume including 10 µL of 2×SYBR Green Master mix (TaKaRa, Japan), 0.4 µL ROX Reference Dye II, 0.4 µM of each primer, 1 µL of 1∶3 diluted cDNA and 7 µL ddH2O using the Applied Biosystem 7500 Real-time system (Applied Biosystem, USA). The qRT-PCR profile was as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 32 s. At the end of each PCR reaction melting curve analysis of amplication products was preformed to confirm amplification specificity. The relative mRNA levels of the target genes were calculated as 2−ΔΔCT method [19].
Table 1

PCR primers used in the study.

Primer namesSequence (5′→3′)Purpose
PAX6-F CTACGAGACGGGGAGCATA For PAX6 qRT-PCR
PAX6-R CCCTCTTGTAGTGGGCAAT
18S-F GTTCGAAGGCGATCAGATAC For qRT-PCR
18S-R CTGTCAATCCTCACTGTGTC

Statistical analysis

Diel patterns of relative expression of PAX6 and effect of covering behavior were analyzed by two-way ANOVA. The number of shells used for covering in the two treatments was tested by one-way ANOVA. Correlations between intensity of light and PAX6 expression were analyzed in both males and females using Pearson correlation analysis. All analyses were performed with SPSS 13.0 statistical software. A probability level of P<0.05 was considered statistically significant.
  12 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  Spatiotemporal expression pattern of an encephalopsin orthologue of the sea urchin Hemicentrotus pulcherrimus during early development, and its potential role in larval vertical migration.

Authors:  Shioh Ooka; Tomoko Katow; Shunsuke Yaguchi; Junko Yaguchi; Hideki Katow
Journal:  Dev Growth Differ       Date:  2010-01-07       Impact factor: 2.053

3.  Sea urchin tube feet are photosensory organs that express a rhabdomeric-like opsin and PAX6.

Authors:  Michael P Lesser; Karen L Carleton; Stefanie A Böttger; Thomas M Barry; Charles W Walker
Journal:  Proc Biol Sci       Date:  2011-03-30       Impact factor: 5.349

4.  Drosophila auditory organ genes and genetic hearing defects.

Authors:  Pingkalai R Senthilan; David Piepenbrock; Guvanch Ovezmyradov; Björn Nadrowski; Susanne Bechstedt; Stephanie Pauls; Margret Winkler; Wiebke Möbius; Jonathon Howard; Martin C Göpfert
Journal:  Cell       Date:  2012-08-31       Impact factor: 41.582

5.  Direct regulation of rhodopsin 1 by Pax-6/eyeless in Drosophila: evidence for a conserved function in photoreceptors.

Authors:  G Sheng; E Thouvenot; D Schmucker; D S Wilson; C Desplan
Journal:  Genes Dev       Date:  1997-05-01       Impact factor: 11.361

6.  Unique system of photoreceptors in sea urchin tube feet.

Authors:  Esther M Ullrich-Lüter; Sam Dupont; Enrique Arboleda; Harald Hausen; Maria Ina Arnone
Journal:  Proc Natl Acad Sci U S A       Date:  2011-05-02       Impact factor: 11.205

7.  Function of rhodopsin in temperature discrimination in Drosophila.

Authors:  Wei L Shen; Young Kwon; Abidemi A Adegbola; Junjie Luo; Andrew Chess; Craig Montell
Journal:  Science       Date:  2011-03-11       Impact factor: 47.728

8.  [MYP gene expressions at transcription level in different stages of gonad of sea urchin Strongylocentrotus intermedius and hybrids].

Authors:  Zun-Chun Zhou; Zhen-Min Bao; Ying Dong; Li-Mei Wang; Chong-Bo He; Wei-Dong Liu
Journal:  Yi Chuan       Date:  2008-11

9.  Role of Pax genes in eye evolution: a cnidarian PaxB gene uniting Pax2 and Pax6 functions.

Authors:  Zbynek Kozmik; Michael Daube; Erich Frei; Barbara Norman; Lidia Kos; Larry J Dishaw; Markus Noll; Joram Piatigorsky
Journal:  Dev Cell       Date:  2003-11       Impact factor: 12.270

10.  Pax6-dependent cortical glutamatergic neuronal differentiation regulates autism-like behavior in prenatally valproic acid-exposed rat offspring.

Authors:  Ki Chan Kim; Dong-Keun Lee; Hyo Sang Go; Pitna Kim; Chang Soon Choi; Ji-Woon Kim; Se Jin Jeon; Mi-Ryoung Song; Chan Young Shin
Journal:  Mol Neurobiol       Date:  2013-09-13       Impact factor: 5.590

View more
  1 in total

1.  MITF: an evolutionarily conserved transcription factor in the sea urchin Paracentrotus lividus.

Authors:  Roberta Russo; Marco Chiaramonte; Nadia Lampiasi; Francesca Zito
Journal:  Genetica       Date:  2019-10-17       Impact factor: 1.082

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.