Ke Wu1, Marjorie A Hoy1. 1. Department of Entomology and Nematology, University of Florida, Gainesville, Florida, United States of America.
Abstract
Clathrin heavy chain has been shown to be important for viability, embryogenesis, and RNA interference (RNAi) in arthropods such as Drosophila melanogaster. However, the functional roles of clathrin heavy chain in chelicerate arthropods, such as the predatory mite Metaseiulus occidentalis, remain unknown. We previously showed that dsRNA ingestion, followed by feeding on spider mites, induced systemic and robust RNAi in M. occidentalis females. In the current study, we performed a loss-of-function analysis of the clathrin heavy chain gene in M. occidentalis using RNAi. We showed that ingestion of clathrin heavy chain dsRNA by M. occidentalis females resulted in gene knockdown and reduced longevity. In addition, clathrin heavy chain dsRNA treatment almost completely abolished oviposition by M. occidentalis females and the few eggs produced did not hatch. Finally, we demonstrated that clathrin heavy chain gene knockdown in M. occidentalis females significantly reduced a subsequent RNAi response induced by ingestion of cathepsin L dsRNA. The last finding suggests that clathrin heavy chain may be involved in systemic RNAi responses mediated by orally delivered dsRNAs in M. occidentalis.
Clathrin heavy chain has been shown to be important for viability, embryogenesis, and RNA interference (RNAi) in arthropods such as Drosophila melanogaster. However, the functional roles of clathrin heavy chain in chelicerate arthropods, such as the predatory mite Metaseiulus occidentalis, remain unknown. We previously showed that dsRNA ingestion, followed by feeding on spider mites, induced systemic and robust RNAi in M. occidentalis females. In the current study, we performed a loss-of-function analysis of the clathrin heavy chain gene in M. occidentalis using RNAi. We showed that ingestion of clathrin heavy chain dsRNA by M. occidentalis females resulted in gene knockdown and reduced longevity. In addition, clathrin heavy chain dsRNA treatment almost completely abolished oviposition by M. occidentalis females and the few eggs produced did not hatch. Finally, we demonstrated that clathrin heavy chain gene knockdown in M. occidentalis females significantly reduced a subsequent RNAi response induced by ingestion of cathepsin L dsRNA. The last finding suggests that clathrin heavy chain may be involved in systemic RNAi responses mediated by orally delivered dsRNAs in M. occidentalis.
Endocytosis, a crucial cellular process in all eukaryotes, is involved in the uptake of nutrients and control of the density of receptors on the cell surface [1], [2], [3]. Many endocytotic processes require protein-coated pits or vesicles, in which clathrin is a major component. Clathrin is involved in coating membranes that are endocytosed from plasma membranes and those that move between the trans-Golgi network and endosomes [4]. Three clathrin heavy chains (∼190 kDa each), each bound by a clathrin light chain, are joined at their carboxy termini to form a basic clathrin subunit. Multimerization of clathrin subunits form a polyhedral protein lattice that is found on clathrin-coated pits and vesicles.Genetic disruption of the clathrin heavy chain gene, which is conserved across eukaryotic species, has facilitated the study of clathrin function in many organisms. In single-cell organisms such as yeast, inactivation of the clathrin heavy chain gene resulted in slowed growth or lethality [5], [6]. The amoeba Dictyostelium discoideum exhibited reduced growth rates and reduced endocytosis following clathrin heavy chain ablation [7]. Disruption of the clathrin heavy chain gene in the protozoan Trypanosoma brucei resulted in lethality and essentially undetectable endocytosis [8]. A number of knockout and knockdown studies in mammalian cell cultures showed that repression of the clathrin heavy chain gene resulted in significantly reduced clathrin-mediated endocytosis of various cargos including transferrin [9], epidermal growth factor, and a LDL receptor chimera [10]. In vivo, Bazinet et al. [11] showed that several clathrin heavy chain mutants induced by ethyl methanesulfonate were lethal in Drosophila melanogaster. These mutants also displayed embryonic lethality, suggesting that the clathrin heavy chain gene was indispensable to embryonic development in this insect. Moreover, ablation of the clathrin heavy chain gene in the oocytes of Caenorhabditis elegans using RNA interference (RNAi) resulted in dead embryos and reduced yolk uptake [12]. These studies suggest that the highly conserved clathrin heavy chain protein plays an important role in the endocytotic process in many eukaryotes and is likely to be essential for viability and embryogenesis in multicellular organisms.Clathrin heavy chain has been implicated in the RNAi pathway in several species based on the results of several in vitro and in vivo studies. Clathrin heavy chain gene knockdown by RNAi reduced subsequent RNAi responses in Drosophila cell cultures, possibly by blocking the uptake of dsRNA through clathrin-mediated endocytosis (or receptor-mediated endocytosis) [13], [14]. A study in the desert locustSchistocerca gregaria showed that injections of dsRNA for the clathrin heavy chain gene attenuated a subsequent RNAi response in the midgut, suggesting that the clathrin-mediated endocytosis pathway may be involved in the RNAi response in the midgut of this insect [15]. A study in the tick Haemaphysalis longicornis showed that injections of dsRNA for a scavenger receptor reduced subsequent RNAi responses [16]. Because clathrin heavy chain is thought to be involved in all receptor-mediated endocytosis, this result suggests that clathrin heavy chain may play a role in the RNAi responses in ticks. Many arthropods initiate systemic RNAi responses following ingestion of dsRNAs (for a review, see [17]). However, it is unclear what role clathrin heavy chain plays in these RNAi responses.Metaseiulus ( = Typhlodromus or Galendromus) occidentalis (Nesbitt) (Arthropoda: Chelicerata: Arachnida: Acari: Phytoseiidae) is an agriculturally important biological control agent of plant-feeding pest mites such as Tetranychus urticae. Previously, pesticide-resistant strains of M. occidentalis were developed through laboratory selection and these genetically improved mites were applied in biological control programs [18], [19], [20]. Further genetic improvement can benefit from studies on the molecular components that are important for the viability and embryonic development in this species. These studies may be performed using reverse genetic tools such as RNAi. We recently showed that orally delivered dsRNA induced robust and systemic RNAi responses in M. occidentalis females, but only after spider mite prey was provided [21]. It is unknown whether clathrin heavy chain plays any role in the RNAi response in M. occidentalis.Due to the high degree of sequence homology of clathrin heavy chains across different species, we hypothesized that this protein is important for the viability and embryogenesis of M. occidentalis. We also hypothesized that clathrin heavy chain is involved in the RNAi responses in M. occidentalis following the ingestion of dsRNA. To test our hypotheses, we first identified a putative clathrin heavy chain gene in the M. occidentalis genome that was recently sequenced and annotated [Hoy, et al., unpublished]. We then conducted a loss-of-function analysis of the clathrin heavy chain gene in M. occidentalis females using RNAi. After clathrin heavy chain dsRNA was introduced into M. occidentalis females through ingestion, we evaluated possible gene knockdown and measured the effects of clathrin heavy chain dsRNA ingestion on the longevity and egg production of these females. The hatchability of the eggs produced by these females was evaluated as well. Finally, we evaluated the effects of clathrin heavy chain dsRNA delivery on a subsequent RNAi response mediated by ingestion of M. occidentaliscathepsin L dsRNA.
Materials and Methods
Colony sources and maintenance
The F10A inbred line was derived from the COS (Carbaryl-OP-Sulfur-resistant) colony [22], [23] by sibmating single pairs for 10 generations, as described previously [24]. The F10A colony was maintained and all experiments were performed at 22–23°C and a relative humidity (RH) of 45–55%, under a 16L:8D photoperiod. All stages of T. urticae were brushed on to paraffin-coated construction paper (75 mm×75 mm) resting on water-soaked cotton to serve as prey.Age-matched, mated females for loss-of-function and quantitative reverse transcription-PCR (qRT-PCR) analyses were produced as described previously [21]. Briefly, 20 females of unknown age were collected from the M. occidentalis F10A colony and placed on pinto bean (Phaseolus vulgaris) leaf discs (40 mm×60 mm) resting on water-soaked cotton that were infested with approximately 50 T. urticae females. These females were allowed to lay eggs for one day and were then removed. The eggs produced were allowed to hatch and develop. Seven days later, adult females and males emerged and were allowed to mate. Two days later, gravid (mated) females were collected individually and placed on pinto bean leaf discs (15 mm in diameter) that were infested with 4–5 T. urticae females. One day later, these females produced 1–2 eggs/female, indicating that they had mated.
Identification of putative clathrin heavy chain and cathepsin L genes in the Metaseiulus occidentalis genome
The amino-acid sequence of the D. melanogasterclathrin heavy chain (accession number: NP_477042.1) gene was used to search for putative homologs in the M. occidentalis genome database in GenBank using BLASTP. One hit (accession number XP_003740941.1) was annotated as clathrin heavy chain by the NCBI. Similarly, the amino-acid sequence of D. melanogastercysteine proteinase-1 (accession number NP_725347.1) was used to search for putative homologs of cysteine proteinase-1 in the M. occidentalis genome. One of the top hits (accession number: XP_003738729.1; BLASTP E value: 3e-126) was identified as a putative homolog of Drosophilacysteine proteinase-1 and was annotated as cathepsin L-like protein by the NCBI. BLASTP searches were conducted using the cutoff E value of 1e-5. All searches were performed with the BLAST default settings.
Annotation of clathrin heavy chain domains and phylogenetic analysis
The conserved domains of clathrin heavy chain genes were identified by searching the conserved domain database of the NCBI (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) using default settings [25] with the amino-acid sequences of clathrin heavy chain homologs. An alignment of the deduced amino-acid sequences of clathrin heavy chain genes was conducted using MAFFT 7.147 [26] with the E-INS-i alignment algorithm and the BLUSUM 62 matrix. Model selection was done with ProtTest 3.2 [27] and according to the Akaike information criterion, the LG+I+G model was optimum for phylogenetic analysis. Finally, a maximum likelihood analysis was performed using RAxML 7.3.2 [28], bootstrapping with 1,000 replicates.
RNA extraction and cDNA synthesis
RNA from M. occidental females was extracted using RNAqueous-Micro kit (Part Number Am1931, Life Technologies, CA, USA) according to the manufacturer’s instructions. cDNA for cloning was made using the cloned AMV first-strand cDNA synthesis kit (cat. no. 12328-032, Invitrogen, CA, USA) according to the manufacturer’s instructions. Nine µl of RNA isolated from a pooled sample of M. occidentalis mites (20 females, 20 males, and 20 eggs, 20 nymphs and 20 larvae) were used in a 20-µl reverse transcription reaction containing the manufacturer’s recommended ingredients including Oligo(dT)20 primers. The reaction was performed in a thin-walled tube using a thermocycler (GeneAmp PCR system 9700, Applied Biosystems). The reaction was incubated at 50°C for 60 min, followed by incubation at 85°C for 5 min.cDNA for qRT-PCR was made using high-capacity cDNA reverse transcription kits (part number 4375575, Applied Biosystems, CA, USA) according to the manufacturer’s instructions. Thirteen µl of RNA from individual M. occidentalis females were used in a 20-µl reaction containing all ingredients. The reaction was incubated at 25°C for 10 min, then 37°C for 120 min, and 85°C for 5 min. Sixty µl of TE (10 mM Tris pH 7.5, 1 mM EDTA) was then added to the cDNA reaction (1:4 dilution). cDNA synthesized by both methods was stored at −20°C until use.
dsRNA synthesis
Primers with the T7 promoter sequence (TAATACGACTCACTATAGGGAG) added at the 5′ end were used to amplify fragments (∼500 bp) of clathrin heavy chain and cathepsin L genes that were later used for dsRNA synthesis. The sequences for the forward and reverse primers used to amplify clathrin heavy chain gene (accession number for putative mRNA: XM_003740893.1) fragments are “TAATACGACTCACTATAGGGAGCGGCACGATGTCGTCTATTT” and “TAATACGACTCACTATAGGGAGCTCCGAACACTCCAACTTCTC”, respectively. The sequences for the forward and reverse primers used to amplify cathepsin L gene (accession number for putative mRNA: XM_003738681.1) fragments are “TAATACGACTCACTATAGGGAGCAAGCTCGTCTCGCTTTCT” and “TAATACGACTCACTATAGGGAG CTGGTTCTCCTTGTTCCTCATC”, respectively. PCR products were amplified from 1 µl of cDNA prepared from a pooled sample of 20 M. occidentalis females, males, eggs, nymphs and larvae using procedures described previously [21]. Bands of the expected size (500 bp) were extracted and purified using a Gel Extraction kit (Qiagen, Valencia, California) according to the manufacturer’s protocol. Direct sequencing of the purified PCR products was performed at the Interdisciplinary Center for Biotechnology Research at the University of Florida using the primers used for PCR amplification. dsRNAs were synthesized from 1 µg of purified PCR products or control template provided by the MEGAscript RNAi kit (cat. No. AM1626, Life technologies, CA, USA) according to the manufacturer’s instructions. Sizes of purified dsRNAs were confirmed by gel electrophoresis in 1% agarose gel containing TBE buffer. Concentrations of purified dsRNAs were determined by a spectrophotometer (NanoDrop 1000, Thermo Scientific, USA). Purified dsRNAs were stored in elution buffer at 20°C until further use.
dsRNA ingestion
Ingestion of dsRNA was performed as described previously [21]. Briefly, 10–20 age-matched F10A mated females were starved for 24 h and then placed on a parafilm disc (22 mm in diameter) resting on water-soaked cotton at 22–23°C, 45–55% RH and 16L:8D photoperiod. Ten µl of solution containing 350 ng dsRNA/µl in 20% sucrose (Sigma) and with 3% blue food dye (McCormick, MD, USA) was applied to the parafilm disc. Both sucrose solution and blue food dye were boiled for 10 min to eliminate potential contamination by nucleases before use. F10A females were allowed to feed on the dsRNA/sucrose solution for 48 h. Ingestion was confirmed by the presence of intense blue color in the gastric caecae. During the current experiment, it took “starved” F10A females between 2–12 hrs to start ingesting the dsRNA/20% sucrose solution by which time the dsRNA/sucrose droplets had lost volume due to evaporation. The dsRNA/sucrose droplets kept losing volume up to 16 hrs, indicating that sucrose concentrations in the droplets reached a saturated level. A lower concentration (i.e. 10%) of sucrose was evaluated for feeding experiments previously and dsRNA/10% sucrose droplets experienced a greater loss of volume than dsRNA/20% sucrose droplets (data not shown). Therefore, to maintain the dsRNA concentrations at a more consistent level during the feeding period, 20% sucrose solutions were used for subsequent feeding experiments. Efforts to reduce the loss of dsRNA/20%sucrose volume by conducting feeding experiments in a high relative humidity chamber (∼90% RH, ∼23°C) only resulted in more variability in the amounts of food dye (a marker for ingested dsRNA/sucrose) present in different females (data not shown). Therefore, feedings of dsRNA were performed using the conditions specified above. Only females with blue dye within the caecae were used for further analyses. Less than 10% of the females were lost due to runoff. Mated females deposited no eggs during the starvation and dsRNA ingestion periods, consistent with the fact that M. occidentalis is an obligatory predator that requires feeding on prey to oviposit.
Loss-of-function analysis
To measure the effects of clathrin heavy chain gene knock down on viability and embryogenesis, females of M. occidentalis that ingested control dsRNA in sucrose, clathrin heavy chain dsRNA in 20% sucrose, and TE in sucrose were collected individually and placed, with a virgin male, on a bean leaf disc (22 mm in diameter) on water-soaked cotton that had been infested for 24 h with 10 T. urticae females (in order to produce prey eggs). Ingestion of prey was indicated by an increase in female body size and gradual disappearance of blue color from the gastric caecae [data not shown]. Oviposition started ∼48 h after the spider mite diet was provided. The eggs produced by the M. occidentalis females were counted and collected every day with a fine sable-hair brush and transferred individually to a new bean leaf disc (22 mm in diameter) containing 4 T. urticae females per M. occidentalis egg. The hatch rate of eggs deposited by M. occidentalis females, as well as the day of death for each female, was recorded. For the analysis of clathrin heavy chain gene knockdown, 2 days after being provided with spider mite prey, 4 M. occidentalis females that were fed with control or clathrin heavy chain dsRNA were collected and total RNA from individual females was extracted. qRT-PCR was performed subsequently to determine the clathrin heavy chain mRNA levels.To evaluate the effects of clathrin heavy chain gene knockdown on subsequent RNAi responses, 40 age-matched F10A females were divided into 2 groups that were fed clathrin heavy chain or control dsRNAs, as described above. These females were provided T. urticae prey for 2 days and then starved for 1 day. Half of the females from each group were provided with control dsRNA and the other half were provided with cathepsin L dsRNA for 2 days. All females were then provided with T. urticae prey for 2 days before being collected for RNA extractions and subsequent qRT-PCR. Approximately 50% of females survived the assay period.
qRT-PCR analysis
qRT-PCR analysis was performed in a similar manner as described previously [21]. The sequences for the forward and reverse primers used for the qRT-PCR of clathrin heavy chain gene are “GGAGCACTACACGGATCTTTAC” and “AGTGAGTCTTCAACCGAAAGG”, respectively. The sequences for the forward and reverse primers used for the qRT-PCR of cathepsin L gene are “CTTCAGACGTCAGCTGTTCTAC” and “GAACTCCTCGCTGGTCATATC”, respectively. The sequences for the forward and reverse primers used for the qRT-PCR of actin gene (internal control; accession number for putative mRNA: XM_003742554.1) are “ACATCAAGGAGAAGCTCTGC” and “CCTCGGGACAACGGAAAC”, respectively. The primers were validated using standard curves based on serial dilutions of cDNA to determine the primer annealing efficiencies. One no-template control was included in each experiment to check for possible contamination. qRT-PCR (in technical triplicates) was performed in a 20-µL reaction volume containing 1 µL of cDNA, 0.5 µL of forward and reverse primers (8 µM each), 10 µl of SYBR select master mix (Applied Biosystems), and 8 µl of nuclease-free H2O. To minimize potential variations in qRT-PCR reactions, the qRT-PCR master mix was made by combining primers, SYBR select master mix, and nuclease-free water, followed by a brief vortexing of the mixture. qRT-PCR was performed in a Step-One Real-Time PCR system (Applied Biosystems). Two linked profiles, (1) one cycle of 50°C for 2 min and 95°C for 2 min, and (2) 40 cycles consisting of denaturation at 95°C for 15 s and annealing/extension at 60°C for 60 s, were used. Four to 6 biological replicates were performed for each data point. All the results corresponded to relative quantification using the M. occidentalis actin gene as an internal control using the 2−ΔΔCt method [29]. Specifically, the Ct for each target (e.g. clathrin heavy chain gene) was subtracted by the Ct of actin gene from each sample (e.g. control dsRNA or clathrin heavy chain dsRNA) to produce ΔCt. The ΔCt from the control was then averaged to produce a mean ΔCt of the control. Then the mean ΔCt of the control was subtracted from individual ΔCt values from control or clathrin heavy chain dsRNA treated mites, to yield the ΔΔCt. Then ΔΔCt was used to produce the 2−ΔΔCt estimates. The specificity of qRT-PCR was confirmed by melting-curve analyses after each reaction. In pilot experiments, the stability of 4 reference genes, actin, TFIID, GAPDH, and RPS18 was evaluated in samples that received different dsRNAs. The actin gene was identified as the most stable reference gene with the use of BestKeeper [30] [data not shown].
Statistical analysis
The means and standard errors of means (SEM) were analyzed by analysis of variance (ANOVA) (JMP 8; SAS Institute, Cary, NC), and means were separated using Tukey’s HSD test (P<0.05). For one-to-one comparisons, means and SEM were analyzed by ANOVA and means were separated by Student’s t test.
Results and Discussion
Identification of a putative clathrin heavy chain gene in the Metaseiulus occidentalis genome
The putative M. occidentalisclathrin heavy chain gene encodes a protein with 1686 amino acids, which is similar to the lengths of clathrin heavy chains from other species (Table 1). Moreover, the deduced M. occidentalisclathrin heavy chain protein sequence shares 70–85% identities with homologs from Caenorhabditis elegans, Homo sapiens, D. melanogaster and T. urticae. Figure 1A shows a comparison of the conserved domains in the clathrin heavy chain homologs of M. occidentalis, T. urticae, D. melanogaster, and Homo sapiens. The deduced M. occidentalisclathrin heavy chain protein has all the conserved domains found in the homologs of the other three species listed. The numbers and the relative positions of domains such as clathrin heavy chain linker, clathrin-H-link, and regions in clathrin and VPS are identical among all homologs listed. The number and relative positions of the clathrin propeller repeats show a slight variation among the listed homologs. Taken together, these data suggest that clathrin heavy chain genes are highly conserved at both the amino-acid sequence as well as the domain-composition levels across diverse species. Figure 1B shows the result of a phylogenetic analysis on clathrin heavy chain homologs based on an alignment of their amino-acid sequences (Fig. S1). The M. occidentalisclathrin heavy chain clusters with its homologs from other acarines (Arthropoda: Chelicerata) such as the tick Ixodes scapularis and the two-spotted spider miteT. urticae. As expected, clathrin heavy chains from insects (Arthropoda: Mandibulata) and mammals cluster with their respective groups.
Table 1
A list of clathrin heavy chain proteins in selected species.
Species
GenBankaccession number
Protein length(in amino acids)
Percentage identityto M. occidentalis clathrinheavy chain protein
Metaseiulus occidentalis
XP_003740941.1
1686
100
Tetranychus urticae
tetur01g04320*
1687
85
Tetranychus urticae
tetur03g00330*
1698
84
Ixodes scapularis
XP_002406240.1
1616
83
Apis mellifera
XP_623111
1678
82
Anopheles gambiae
XP_311856.3
1676
82
Tribolium castaneum
XP_967829.1
1684
82
Drosophila melanogaster
NP_477042.1
1678
80
Homo sapiens
NP_004850.1
1675
80
Mus musculus
NP_001003908.1
1675
80
Caenorhabditis elegans
NP_499260.1
1681
70
*Identifier for BOGAS database (http://bioinformatics.psb.ugent.be/orcae/overview/Tetur).
Percentage identity was determined by BLASTP searches.
Figure 1
Domain structure and phylogenetic tree of clathrin heavy chain proteins of M. occidentalis and selected species.
(A) Schematic structures of predicted clathrin heavy chain (CHC) proteins from the mites M. occidentalis (Mo) and T. urticae (Tu), the insect D. melanogaster (Dm), and the mammal Homo sapiens (Hs). Names and pfam ID of conserved domains are shown in brackets. (B) Phylogenetic analysis of predicted clathrin heavy chain proteins from selected species (Mo = M. occidentalis, Tu = T. urticae, Is = I. scapularis, Am = A. mellifera, Ag = An. gambiae, Tc = T. castaneum, Dm = D. melanogaster, Hs = H. sapiens, Ms = M. musculus, Ce = C. elegans). The tree was generated using a maximum likelihood approach [28] with bootstrap support values shown at the nodes. The tree was rooted using the clathrin heavy chain of the nematode C. elegans (Ce_CHC). The scale bar represents the numbers of substitutions per site.
Domain structure and phylogenetic tree of clathrin heavy chain proteins of M. occidentalis and selected species.
(A) Schematic structures of predicted clathrin heavy chain (CHC) proteins from the mites M. occidentalis (Mo) and T. urticae (Tu), the insect D. melanogaster (Dm), and the mammalHomo sapiens (Hs). Names and pfam ID of conserved domains are shown in brackets. (B) Phylogenetic analysis of predicted clathrin heavy chain proteins from selected species (Mo = M. occidentalis, Tu = T. urticae, Is = I. scapularis, Am = A. mellifera, Ag = An. gambiae, Tc = T. castaneum, Dm = D. melanogaster, Hs = H. sapiens, Ms = M. musculus, Ce = C. elegans). The tree was generated using a maximum likelihood approach [28] with bootstrap support values shown at the nodes. The tree was rooted using the clathrin heavy chain of the nematode C. elegans (Ce_CHC). The scale bar represents the numbers of substitutions per site.*Identifier for BOGAS database (http://bioinformatics.psb.ugent.be/orcae/overview/Tetur).Percentage identity was determined by BLASTP searches.
Clathrin heavy chain dsRNA delivery reduced longevity, oviposition, and embryogenesis
As shown in Fig. 2, oral delivery of clathrin heavy chain dsRNA into M. occidentalis females resulted in approximately 90% reduction in clathrin heavy chain mRNA levels when compared to controls (clathrin heavy chain vs. control, P<0.0001, t test). Females treated with clathrin heavy chain dsRNA exhibited survival rates about half of those that received control dsRNA or TE buffer (clathrin heavy chain dsRNA vs. control dsRNA or TE, P<0.0001, ANOVA, Tukey-Kramer HSD). Egg production was greatly reduced in females treated with clathrin heavy chain dsRNA. Half of the females did not produce any eggs and the other half produced only one egg per female. In contrast, all control females produced 24–27 eggs/female. Of the few eggs produced by females treated with clathrin heavy chain dsRNA none hatched, in contrast to 100% hatch rates for eggs produced by control females. The differences in the longevity and oviposition of M. occidentalis females that received control dsRNA or TE buffer were not significant. The egg hatch rates in both control groups were not significantly different.
Figure 2
The effects of oral delivery of clathrin heavy chain dsRNA on survival and egg production of M. occidentalis females. Egg hatch rates and gene knockdown efficiency were also evaluated.
(A) and (B) The effects of clathrin heavy chain dsRNA delivery on survival and oviposition of females, respectively. N = 10 for each treatment group. One-way ANOVA results for days of survival and number of eggs are F = 20.55; P<0.0001, F = 57.71; P<0.0001, respectively. Bars labeled with different letters are significantly different (Tukey’s HSD test, P<0.0004). (C) The effect of clathrin heavy chain dsRNA delivery on egg hatch rates. N = 10, 10, and 5 for TE buffer group, control dsRNA group, and clathrin heavy chain dsRNA group, respectively. (D) The effect of clathrin heavy chain dsRNA delivery on the mRNA levels of the clathrin heavy chain gene. N = 4 for each group. Clathrin heavy chain mRNA levels in control females were scaled to 1. Student’s t test result for the comparison of relative clathrin heavy chain mRNA levels between control dsRNA- and clathrin heavy chain dsRNA-treated mites is P<0.0001.
The effects of oral delivery of clathrin heavy chain dsRNA on survival and egg production of M. occidentalis females. Egg hatch rates and gene knockdown efficiency were also evaluated.
(A) and (B) The effects of clathrin heavy chain dsRNA delivery on survival and oviposition of females, respectively. N = 10 for each treatment group. One-way ANOVA results for days of survival and number of eggs are F = 20.55; P<0.0001, F = 57.71; P<0.0001, respectively. Bars labeled with different letters are significantly different (Tukey’s HSD test, P<0.0004). (C) The effect of clathrin heavy chain dsRNA delivery on egg hatch rates. N = 10, 10, and 5 for TE buffer group, control dsRNA group, and clathrin heavy chain dsRNA group, respectively. (D) The effect of clathrin heavy chain dsRNA delivery on the mRNA levels of the clathrin heavy chain gene. N = 4 for each group. Clathrin heavy chain mRNA levels in control females were scaled to 1. Student’s t test result for the comparison of relative clathrin heavy chain mRNA levels between control dsRNA- and clathrin heavy chain dsRNA-treated mites is P<0.0001.These results support our hypothesis that clathrin heavy chain is essential for the viability and oviposition rate of M. occidentalis adult females and embryonic development. The results from the current study, and those from previous studies on D. melanogaster and C. elegans
[11], [12], suggest that this highly conserved protein is likely essential for viability and embryonic development in multicellular organisms, including some arthropods (Table 1).
Clathrin heavy chain gene knockdown severely impaired a subsequent RNAi response
To investigate whether clathrin heavy chain gene knockdown affected subsequent systemic RNAi responses, M. occidentalis females were fed with control or clathrin heavy chain dsRNA first (pretreatments or first ingestion). These females were then provided with spider mite prey, which is required to initiate gene knockdown after ingestion of dsRNA [21]. Next, these females were fed control or cathepsin L dsRNA (second ingestion; for a detailed description of the experimental design, see Table S1). Cathepsin L gene knockdown was chosen as a marker for measuring systemic RNAi potency because the cathepsin L gene could be efficiently knocked down (for details, see below and Fig. 3B, Control + Cathepsin vs. Control + Control). In addition, cathepsin L gene knockdown had no discernible effect on the viability of M. occidentalis females [Wu and Hoy, unpublished]. Therefore, the use of cathepsin L knockdown as a marker for RNAi potency likely ensured more mites survived the subsequent assays. Fig. 3A illustrates the relative clathrin heavy chain mRNA levels in the treatment groups. The clathrin heavy chain mRNA levels in Control + Cathepsin mites were not significantly different from those in Control + Control mites, indicating that cathepsin L dsRNA treatment had no effect on clathrin heavy chain mRNA level. In contrast, clathrin heavy chain mRNA levels in Clathrin + Control mites were 13.6% of those of Control + Control mites, indicating that clathrin heavy chain dsRNA induced a robust gene knockdown (i.e. knockdown efficiency of 86.4%). Similarly, clathrin heavy chain mRNA levels in Clathrin + Cathepsin mites were 11.3% of those of Control + Cathepsin mites, indicating that the robust gene knockdown induced by clathrin heavy chain dsRNA was not affected by the subsequent feeding of cathepsin L dsRNA.
Figure 3
The effects of clathrin heavy chain gene knockdown on a subsequent RNAi response as measured by cathepsin L knockdown in M. occidentalis females.
(A) The effects of different treatment combinations on the relative mRNA levels of clathrin heavy chain (mean + SEM). Ingestion of clathrin heavy chain dsRNA resulted in a reduction of clathrin heavy chain mRNA levels in Clathrin + Control and Clathrin + Cathepsin mites. (B) The effect of different treatment combinations on the relative mRNA levels of cathepsin L (mean + SEM). Clathrin heavy chain dsRNA pretreatment reduced subsequent RNAi responses as evaluated by gene knockdown of cathepsin L. For clathrin heavy chain and cathepsin L mRNAs comparisons: One-way ANOVA, F = 470.10, P<0.0001 and F = 49.16, P<0.0001, respectively, Tukey-Kramer HSD lettering for all comparisons. The mRNA levels of clathrin heavy chain and cathepsin L in Control + Control group are scaled to 1. Different letters denote significant differences.
The effects of clathrin heavy chain gene knockdown on a subsequent RNAi response as measured by cathepsin L knockdown in M. occidentalis females.
(A) The effects of different treatment combinations on the relative mRNA levels of clathrin heavy chain (mean + SEM). Ingestion of clathrin heavy chain dsRNA resulted in a reduction of clathrin heavy chain mRNA levels in Clathrin + Control and Clathrin + Cathepsin mites. (B) The effect of different treatment combinations on the relative mRNA levels of cathepsin L (mean + SEM). Clathrin heavy chain dsRNA pretreatment reduced subsequent RNAi responses as evaluated by gene knockdown of cathepsin L. For clathrin heavy chain and cathepsin L mRNAs comparisons: One-way ANOVA, F = 470.10, P<0.0001 and F = 49.16, P<0.0001, respectively, Tukey-Kramer HSD lettering for all comparisons. The mRNA levels of clathrin heavy chain and cathepsin L in Control + Control group are scaled to 1. Different letters denote significant differences.Fig. 3B shows the relative mRNA levels of cathepsin L in the different treatment groups. In mites pretreated with control dsRNA, subsequent cathepsin L dsRNA treatment induced a 96.4% gene knockdown (Control + Control vs Control + Cathepsin). In mites pretreated with clathrin heavy chain dsRNA, subsequent cathepsin L dsRNA treatment only achieved a modest 52.5% gene knockdown (Clathrin + Control vs. Clathrin + Cathepsin). Taken together, these results indicate that clathrin heavy chain dsRNA pretreatment greatly reduced systemic RNAi potency as assayed by cathepsin L dsRNA gene knockdown. These findings support our hypothesis that clathrin heavy chain plays an important role in the systemic RNAi response in M. occidentalis. We included the Clathrin + Control group as a control on which the calculation of the reporter gene knockdown efficiency in clathrin heavy chain dsRNA-treated mites was based to control for any effect the clathrin heavy chain dsRNA pretreatment might have had on the expression of the cathepsin L gene. Indeed, clathrin heavy chain dsRNA treatment, by itself (Clathrin + Control mites), reduced the cathepsin L mRNA levels by 40%, when compared to Control + Control mites, indicating that clathrin heavy chain gene knockdown likely had a broad- spectrum effect that affected the transcriptional regulation of other genes.In our assays, clathrin heavy chain dsRNA pretreatment did not completely abolish the subsequent RNAi response mediated by cathepsin L dsRNA. This is likely due to an incomplete clathrin heavy chain knockdown (∼87%, Fig. 3A). In addition, clathrin heavy chains are known to be relatively stable [31]; therefore it was possible that a significant amount of clathrin heavy chain remained when cathepsin L dsRNA uptake occurred, thus resulting in a modest, though significant, cathepsin L gene knockdown (Clathrin + Cathepsin mites vs. Clathrin + Control mites, Fig. 3B).We previously showed that ingestion of dsRNA elicited robust and systemic RNAi responses in M. occidentalis
[21]. One discovery from that study was that M. occidentalis females did not initiate RNAi responses after ingesting dsRNA in 20% sucrose for 3 days unless the dsRNA/sucrose solution was replaced by T. urticae prey. It is possible that components in the spider mite prey are required to initiate an RNAi response in M. occidentalis. Another possibility, not necessarily mutually exclusive with the first one, is that factors in the dsRNA +20% sucrose inhibit RNAi responses, possibly at the dsRNA uptake step. Hypertonic media (e.g., 0.45 M sucrose in normal media) have been shown to inhibit receptor-mediated endocytosis by blocking the formation of clathrin-coated pits in mammalian cell cultures [32]. This inhibition could be reversed by the removal of high-concentration sucrose [32]. The 20% sucrose concentration in our dsRNA solution is equivalent to 0.58 M. Before they were fed dsRNA in sucrose, M. occidentalis females were starved for 24 h, which likely reduced the liquid content in their guts, as indicated by the flattening of their bodies [Wu and Hoy, unpublished]. Therefore, it was possible that sucrose concentrations remained high in the guts of M. occidentalis females after they ingested dsRNA in 20% sucrose solution and high concentrations of sucrose could have blocked the clathrin-mediated endocytosis of dsRNA by the gut cells. After replacing the dsRNA in sucrose with T. urticae prey, the sucrose concentrations in the guts of M. occidentalis likely decreased and the clathrin-mediated endocytosis of dsRNA likely became derepressed. Thus, our previous observation is consistent with the notion that the clathrin heavy chain is involved in systemic RNAi responses in M. occidentalis. However, it is not clear whether clathrin heavy chain is involved in the initial uptake of dsRNA by cells in the gut lumen and/or in the subsequent uptake in the peripheral tissues. Finally, because the knockdown of clathrin heavy chain apparently induced a general deleterious effect on M. occidentalis, we cannot exclude the possibility that the subsequently reduced RNAi response might be a result of a nonspecific/toxic effect that was caused by the knockdown of this important protein.Our finding that clathrin heavy chain may be involved in RNAi in M. occidentalis, together with similar results from D. melanogaster and S. gregaria
[13], [14], [15], lends support to the hypothesis that clathrin heavy chain may be involved in RNAi responses in all arthropods. Two scavenger receptors were identified that were responsible for the majority of dsRNA uptake in D. melanogasterS2 cells [14]. It is likely that scavenger receptors also play a role in the RNAi machinery in M. occidentalis. Future studies are needed to identify the receptors involved in the RNAi response in M. occidentalis.In summary, we show that the conserved clathrin heavy chain is critical for survival and egg production in adult females of M. occidentalis, as well as viability of the few embryos produced. Clathrin heavy chain also may be involved in the systemic RNAi response in this mite. The current study represents, to our knowledge, only the second study in which a detailed loss-of-function analysis has been performed on clathrin heavy chain in a multicellular organism in vivo. Our findings support the notion that this protein is important for the survival, embryonic development, and, possibly, RNAi responses in multicellular organisms.A multiple sequence alignment file (in FASTA format) of the deduced amino-acid sequences of clathrin heavy chain (CHC) genes from the mites M. occidentalis (Mo), I. scapularis (Is) and T. urticae (Tu), the insects T. castaneum (Tc), A. mellifera (Am), An. gambiae (Ag) and D. melanogaster (Dm), and the mammals H. sapiens (Hs) and M. musculus (Mm), and the nematode C. elegans (Ce).(DOCX)Click here for additional data file.The experimental design for the study on the effects of clathrin heavy chain gene knockdown on subsequent RNAi responses in Metaseiulus occidentalis.(DOCX)Click here for additional data file.
Authors: Marjorie A Hoy; Robert M Waterhouse; Ke Wu; Alden S Estep; Panagiotis Ioannidis; William J Palmer; Aaron F Pomerantz; Felipe A Simão; Jainy Thomas; Francis M Jiggins; Terence D Murphy; Ellen J Pritham; Hugh M Robertson; Evgeny M Zdobnov; Richard A Gibbs; Stephen Richards Journal: Genome Biol Evol Date: 2016-06-27 Impact factor: 3.416