Literature DB >> 25309837

Primers for low-copy nuclear genes in Metrosideros and cross-amplification in Myrtaceae.

Yohan Pillon1, Jennifer Johansen1, Tomoko Sakishima1, Srikar Chamala2, W Brad Barbazuk2, Elizabeth A Stacy1.   

Abstract

PREMISE OF THE STUDY: Primers were developed to amplify low-copy nuclear genes in Hawaiian Metrosideros (Myrtaceae). • METHODS AND
RESULTS: Data from a pooled 454 Titanium run of the partial transcriptomes of four Metrosideros taxa were used to identify the loci of interest. Ten exon-primed intron-crossing (EPIC) markers were amplified and sequenced directly with success in Metrosideros, as well as in a representative selection of Myrtaceae, including Syzygium, Psidium, and Melaleuca for most of the markers. The loci amplified ranged between 500 and 1100 bp, and up to 117 polymorphic sites were observed within an individual gene alignment. Two introns contained microsatellites in some of the species. •
CONCLUSIONS: These novel primer pairs should be useful for phylogenetic analysis and population genetics of a broad range of Myrtaceae, particularly the diverse fleshy-fruited tribes Syzygieae and Myrteae.

Entities:  

Keywords:  Hawai‘i; Metrosideros; Myrtaceae; next-generation sequencing; phylogeny; single nuclear genes

Year:  2014        PMID: 25309837      PMCID: PMC4189496          DOI: 10.3732/apps.1400049

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


The genus Metrosideros Banks ex Gaertn. (Myrtaceae) is an emblematic genus of trees of the Pacific islands, being present on most high Pacific islands where it is particularly abundant in mountain and ridge vegetation. In Hawai‘i, ‘ōhi‘a lehua (M. polymorpha Gaudich.) is an ecologically dominant tree with high intraspecific diversity (eight varieties) and four satellite species that is emerging as a model for studies of speciation in trees (Stacy et al., 2014). Low levels of variation in plastid (Percy et al., 2008) and ribosomal (Wright et al., 2000) DNA sequences and the occurrence of homoplasy in nuclear microsatellites (Harbaugh et al., 2009) have hampered understanding of Metrosideros’ evolutionary history. Single-copy nuclear DNA sequences are likely to provide the necessary intermediate level of variation to improve understanding of the evolution of Metrosideros. Metrosideros is part of a larger clade (BKMMST; Biffin et al., 2010) that comprises Backhousieae, Kanieae, Myrteae, Metrosidereae, Syzygieae, Tristanieae, and Cloezia Brongn. & Gris. This clade encompasses considerable morphologic diversity within the Myrtaceae family, including the two fleshy-fruited groups. The first group is the tribe Syzygieae, chiefly the genus Syzygium P. Browne ex Gaertn. (ca. 1000 species) including clove (S. aromaticum (L.) Merr. & L. M. Perry) and mountain apple (S. malaccense (L.) Merr. & L. M. Perry). The second group, Myrteae, comprises ca. 47 genera, including the large Eugenia L. (ca. 1100 species) and guava (Psidium guajava L.). Whether these two tribes are sister groups, and therefore whether fleshy fruits evolved once or twice in Myrtaceae, is still unclear. Therefore, phylogenetically useful markers are desirable for this entire group to answer such questions and to resolve systematic issues.

METHODS AND RESULTS

We obtained a pooled, partial transcriptome library from leaf and floral buds (fixed in the field in RNAlater [QIAGEN, Germantown, Maryland, USA] and stored at −80°C) of four Hawaiian Metrosideros taxa: M. rugosa A. Gray (O‘ahu), M. tremuloides (A. Heller) P. Knuth (O‘ahu), M. polymorpha var. incana (H. Lév.) H. St. John (Big Island of Hawai‘i), and M. polymorpha var. newellii (Rock) H. St. John (Big Island). Total RNA was isolated with the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany), and mRNA were poly A selected using the Dynabeads mRNA Purification Kit (Life Technologies, Carlsbad, California, USA). cDNA libraries were prepared and normalized following the Roche-FLX Titanium cDNA Rapid Library Preparation Method Manual (Roche, Basel, Switzerland). RNA isolation, cDNA synthesis, and 454 sequencing were done at the University of Arizona Genetics Core Laboratory. The 454 run provided 715,065 reads with an average length of 401 bp. Adapters, ribosomal RNA, and low-quality and low-complexity sequences were removed/trimmed using SeqClean (http://sourceforge.net/projects/seqclean/), and each taxon was assembled separately by the TGI Clustering tools (TGICL; Pertea et al., 2003) using default settings. We searched for single-copy genes reported by Duarte et al. (2010) in the Metrosideros transcriptome through BLAST searches. We designed primers flanking each side of one intron for about 80 genes with Primer3 (Rozen and Skaletsky, 2000), setting the optimal annealing temperature to 60°C (minimum 59°C, maximum 61°C) and Max Poly X to 3, and using default settings for other parameters. We report here loci that should be of potential use for phylogenetic studies in Myrtaceae, i.e., loci with relatively long amplicons (>500 bp) and successful amplifications across a range of species. We tested the primers on a single accession of M. polymorpha var. glaberrima (H. Lèv.) H. St. John, P. guajava, Syzygium sandwicense (A. Gray) Müll. Berol., and Melaleuca quinquenervia (Cav.) S. T. Blake. Three tribes of the BKMMST clade were thus represented, including the two fleshy-fruited tribes, and also the more distantly related tribe Melaleuceae. Fresh or frozen leaves were homogenized with Lysing Matrix A tubes in the FastPrep-24 instrument for 40 s at 4.0 m/s (MP Biomedicals, Santa Ana, California, USA). DNA was extracted from the lysate using a NucleoSpin Plant II Kit (Macherey-Nagel, Düren, Germany). Extracted DNA was precipitated with 100% ethanol and 3 M sodium acetate (pH 5.2), vacuum dried, washed with 70% ethanol, and resuspended in elution buffer (Macherey-Nagel). The nuclear regions were amplified using the following mix: 11.3 μL of H2O, 4 μL of GoTaq 5× Buffer (Promega Corporation, Madison, Wisconsin, USA), 2 μL of MgCl2 25 mM, 1 μL of bovine serum albumin (BSA) 10 mg/mL, 0.4 μL of dNTP 1.25 mM, 0.2 μL of each primer 10 μΜ, 0.1 μL of GoTaq Flexi DNA polymerase 5 U/μL (Promega), and 0.8 μL of DNA template. The following amplification program was used: 2 min at 94°C, 38 cycles of 1 min at 94°C, 1 min at 63°C, 1 min at 72°C (1 min 30 s when the fragment exceeded 1000 bp), and a final extension of 5 min at 72°C. PCR products were sequenced directly at the Core Genetics Laboratory at the University of Hawai‘i Hilo. DNA sequences were aligned with MUSCLE within MEGA 6.06 (Tamura et al., 2013). We identified 10 genes that were successfully amplified in Metrosideros as well as Syzygium, Psidium, or Melaleuca; six worked in all four genera tested (Table 1). Direct sequencing was straightforward with a single exception. For one locus, MeNu61, the accession of Melaleuca appears to be heterozygous with the presence of two alleles differing by at least one indel; we could not obtain a clear direct sequence and did not attempt cloning. Alignment was straightforward in most genes, but somewhat difficult for MeNu18 and partly ambiguous for Psidium in MeNu47 because of a large indel. The cumulative number of polymorphic sites per gene across the four genera was high (>80) for most genes. We also identified microsatellites, e.g., (CT)13 and (CT)19 in MeNu18 for M. polymorpha and S. sandwicense, respectively, and (TAAA)11 in MeNu79 for P. guajava. The levels of variation and usefulness of these microsatellites remain to be tested.
Table 1.

Characterization of 10 single-copy nuclear markers designed to amplify in Metrosideros and fleshy-fruited Myrtaceae. Statistics on polymorphism are given for markers successfully sequenced in a sampling including all four of Metrosideros polymorpha var. glaberrima, Syzygium sandwicense, Psidium guajava, and Melaleuca quinquenervia.

LocusPrimer sequence (5′–3′)Total/intron length, bp (+range)Total no. of polymorphic sites (no. within exons)Nucleotide diversityPutative Arabidopsis homologPutative product
MeNu5F: ATTCCAGCATCTTTGGGTGT913/726 (+7)failed in Psidium and SyzygiumAt5g52560protein with UTP:sugar 1-phosphate uridylyltransferase activity
R: CATCCGGATAACCAGTTGCT
MeNu13F: CAGCCAGTCGATCGAAGATT587/516 (+5)failed in Psidium and SyzygiumAt1g15220protein with oxidoreductase activity present in the inner membrane of mitochondria
R: GGATCTCATCGCGAATCAAC
MeNu18F: TAGTGTAGATGCGGCGACAA521/408 (+118)95 (2)0.13148At1g75200flavodoxin family protein / radical SAM domain-containing protein
R: GCTGCTGCTTGTCCTTGAGT
MeNu21F: GGTCAGAGATGAATGGATGGA794/716 (+39)failed in PsidiumAt2g45990unknown protein
R: GCATCAGGAACTCCTGGGTA
MeNu39F: AGGCCCTTATATGGGTGGAG557/383 (+25)82 (11)0.06847At5g57300S-adenosyl-l-methionine-dependent methyltransferases superfamily protein
R: GGCTCAGTTCAAGGCATAGG
MeNu47F: GAGGGTTGGGACTGGATTG801/746 (+316)112 (0)0.07340At1g09010glycoside hydrolase family 2 protein
R: CATCCCATATGCCAGTATTACG
MeNu61F: GGGCCTCTCCCTATTGTGTT682/546 (+65)heterozygote in MelaleucaAt1g74640alpha/beta-Hydrolases superfamily protein
R: ACTGGATTGCCTTCTCGTTG
MeNu62F: TAGAGGCACCCTCGAAGAAG606/447 (+410)97 (15)0.09018At1g77930Chaperone DnaJ-domain superfamily  protein
R: ATAAGCCACTCCATCCATGC
MeNu79F: GGGACCAATATGCTTTCACG746/633 (+378)failed in MelaleucaAt2g36810ARM repeat superfamily protein
R: CCACTTTCCGCAGCATTTAT
MeNu92F: TTGGTGTCGCTCAAGGAAAT930/831 (+338)117 (2)0.06883At3g15080Polynucleotidyl transferase, ribonuclease  H-like superfamily protein
R: GGGCGAACAAATTCATCGTA
Characterization of 10 single-copy nuclear markers designed to amplify in Metrosideros and fleshy-fruited Myrtaceae. Statistics on polymorphism are given for markers successfully sequenced in a sampling including all four of Metrosideros polymorpha var. glaberrima, Syzygium sandwicense, Psidium guajava, and Melaleuca quinquenervia.

CONCLUSIONS

The 10 markers described here should be useful for investigations of the relationships within the BKMMST clade of Myrtaceae that includes all of the fleshy-fruited Myrtaceae. The level of polymorphism is promising for population genetic studies as well as for the resolution of phylogenetic relationships among genera of the tribe Myrteae and among species of large genera such as Syzygium or Psidium. They may also be useful in more distantly related Myrtaceae as indicated by their successful amplification in Melaleuca. Their usefulness at broader scales (e.g., across the entire family) may be limited by difficulty in alignment and homoplasy. Finally, they may facilitate discovery of microsatellites for population genetic studies in Myrtaceae.
Appendix 1.

Locality, voucher information, and GenBank accession numbers for MeNu5, MeNu13, MeNu18, MeNu21, MeNu39, MeNu47, MeNu61, MeNu62, MeNu79, and MeNu92. Voucher specimens are deposited at the National Tropical Botanical Garden, Kalaheo, Kauai, Hawai‘i (PTBG).

TaxonLocalityVoucher no.GenBank accession no.
Metrosideros polymorpha var. glaberrima (H. Lèv.) H. St. JohnHawai‘i, KukuiopaeJohansen et al. 55KJ940982, KJ940984, KJ883158, KJ940986, KJ883162, KJ883166, KJ883172, KJ883173, KJ940989, KJ883177
Psidium guajava L.Hawai‘i (introduced)Pillon 1432−, −, KJ883159, −, KJ883164, KJ883168, KJ883171, KJ883175, KJ940991, KJ883180
Syzygium sandwicense (A. Gray) Müll. Berol.O‘ahu, KuliououJohansen 60−, −, KJ883161, KJ940987, KJ883165, KJ883167, KJ883170, KJ883174, KJ940990, KJ883179
Melaleuca quinquenervia (Cav.) S. T. BlakeHawai‘i (introduced)Pillon 1430KJ940983, KJ940985, KJ883160, KJ940988, KJ883163, KJ883169, −, KJ883176, −, KJ883178
  9 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  TIGR Gene Indices clustering tools (TGICL): a software system for fast clustering of large EST datasets.

Authors:  Geo Pertea; Xiaoqiu Huang; Feng Liang; Valentin Antonescu; Razvan Sultana; Svetlana Karamycheva; Yuandan Lee; Joseph White; Foo Cheung; Babak Parvizi; Jennifer Tsai; John Quackenbush
Journal:  Bioinformatics       Date:  2003-03-22       Impact factor: 6.937

3.  Evolution of exceptional species richness among lineages of fleshy-fruited Myrtaceae.

Authors:  Ed Biffin; Eve J Lucas; Lyn A Craven; Itayguara Ribeiro da Costa; Mark G Harrington; Michael D Crisp
Journal:  Ann Bot       Date:  2010-05-11       Impact factor: 4.357

4.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

5.  Riding the Ice Age El Nino? Pacific biogeography and evolution of Metrosideros subg. Metrosideros (Myrtaceae) inferred from nuclear ribosomal DNA.

Authors:  S D Wright; C G Yong; J W Dawson; D J Whittaker; R C Gardner
Journal:  Proc Natl Acad Sci U S A       Date:  2000-04-11       Impact factor: 11.205

6.  Identification of shared single copy nuclear genes in Arabidopsis, Populus, Vitis and Oryza and their phylogenetic utility across various taxonomic levels.

Authors:  Jill M Duarte; P Kerr Wall; Patrick P Edger; Lena L Landherr; Hong Ma; J Chris Pires; Jim Leebens-Mack; Claude W dePamphilis
Journal:  BMC Evol Biol       Date:  2010-02-24       Impact factor: 3.260

7.  Progressive island colonization and ancient origin of Hawaiian Metrosideros (Myrtaceae).

Authors:  Diana M Percy; Adam M Garver; Warren L Wagner; Helen F James; Clifford W Cunningham; Scott E Miller; Robert C Fleischer
Journal:  Proc Biol Sci       Date:  2008-07-07       Impact factor: 5.349

8.  Incipient radiation within the dominant Hawaiian tree Metrosideros polymorpha.

Authors:  E A Stacy; J B Johansen; T Sakishima; D K Price; Y Pillon
Journal:  Heredity (Edinb)       Date:  2014-05-14       Impact factor: 3.821

9.  Genetic structure of the polymorphic metrosideros (Myrtaceae) complex in the Hwaiian islands using nuclear microsatellite data.

Authors:  Danica T Harbaugh; Warren L Wagner; Diana M Percy; Helen F James; Robert C Fleischer
Journal:  PLoS One       Date:  2009-03-04       Impact factor: 3.240

  9 in total
  1 in total

1.  MarkerMiner 1.0: A new application for phylogenetic marker development using angiosperm transcriptomes.

Authors:  Srikar Chamala; Nicolás García; Grant T Godden; Vivek Krishnakumar; Ingrid E Jordon-Thaden; Riet De Smet; W Brad Barbazuk; Douglas E Soltis; Pamela S Soltis
Journal:  Appl Plant Sci       Date:  2015-04-06       Impact factor: 1.936

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.