Literature DB >> 25289255

HSL Attenuates the Follicular Oxidative Stress and Enhances the Hair Growth in ob/ob Mice.

Takeo Minematsu1, Yoshimi Nishijima1, Lijuan Huang1, Gojiro Nakagami1, Yasunori Ohta1, Sotaro Kurata1, Hiromi Sanada1.   

Abstract

SUMMARY: We demonstrated enhanced hair regeneration following topical administration of N-(3-oxododecanoyl)-l-homoserine lactone (HSL) in ob/ob mice. The ob/ob mice showed delayed hair regeneration (more than 6 wk) after depilation, which rapidly induced transition to anagen in the hair cycle in wild-type mice. Vehicle and HSL solutions were applied to the depilated dorsal skin of ob/ob mice. The depilated skin of the HSL-treated mice was fully covered with hair, whereas no macroscopic alteration was observed in vehicle-treated group by the fourth week after depilation. Oxidative stress was drastically decreased and the expression of the antioxidative enzymes PON1 and PON3 was increased in the HSL-treated skin with highly proliferative anagen follicles. These results suggest that HSL is a candidate therapeutic agent for alopecia in metabolic syndrome.

Entities:  

Year:  2013        PMID: 25289255      PMCID: PMC4174062          DOI: 10.1097/GOX.0000000000000000

Source DB:  PubMed          Journal:  Plast Reconstr Surg Glob Open        ISSN: 2169-7574


Alopecia markedly reduces a patient’s quality of life[1] and is thus an important topic in nursing science. Administrations of minoxidil and finasteride are the most established treatments for androgenetic alopecia at present.[2,3] However, their efficacy varies among individuals,[4] suggesting that some intrinsic factors affect the pathology and/or treatment of androgenetic alopecia. Recently, some researchers have identified an association between alopecia and metabolic syndrome (MS).[5] We and other researchers have shown elevated oxidative stress in the skin of patients with MS[6-8] and in the scalp of patients with alopecia areata.[9] Furthermore, reduced activity of paraoxonases (PONs, antioxidant enzymes) has been shown in patients with alopecia areata.[10] Therefore, we hypothesized that the administration of the substrate of PONs would attenuate oxidative stress and enhance progression in the hair cycle in the skin of MS model mice. In this study, we demonstrated the promoting effects of N-(3-oxododecanoyl)--homoserine lactone (HSL), a substrate of PONs, applied topically to the back of ob/ob mice on hair growth through the attenuation of oxidative stress.

MATERIALS AND METHODS

All animal experiments were approved by the Animal Research Committee of The University of Tokyo.

Depilation and HSL Treatment

We purchased 8-week-old male MS model (ob/ob) and wild-type (+/+) mice from Japan SLC (Hamamatsu, Japan). After removal of the hair from the dorsal skin using depilatory cream (day 0), 5 +/+ mice and 5 ob/ob mice were regularly monitored until the depilated area was mostly covered with hair. HSL (Sigma-Aldrich, St. Louis, Mo.) was dissolved in dimethyl sulfoxide at a concentration of 10 mM and diluted to 10 µM using a 30% glycerol solution. Glycerol solution supplemented with 0.1% dimethyl sulfoxide was used as a vehicle solution. HSL or vehicle solution (50 µl) was applied to the dorsal skin of the ob/ob mice the day after depilation. The animals treated with HSL or vehicle (5 animals in each treatment) were regularly monitored until day 28 or killed on day 21. Skin was removed from the center of the back and the skin from each mouse was divided into 2 pieces.

Histological Analysis

One piece of tissue was fixed with 4% paraformaldehyde and embedded in paraffin. Four-micrometer-thick serial sections were stained with hematoxylin and eosin for immunofluorescence using rabbit polyclonal anti-Ki67 antibody (Novus Biologicals, Littleton, Colo.) and immunohistochemistry using mouse anti-8OHdG monoclonal antibody (JaICA, Shizuoka, Japan).

Reverse Transcription-Polymerase Chain Reaction

Total RNA was extracted from the homogenate of the other piece of harvested tissue using an RNeasy Plus mini kit (Qiagen, Venlo, the Netherlands). Reverse transcription-polymerase chain reaction was performed using a QuantiTect Reverse Transcription kit (Qiagen), AmpliTaq Gold PCR Master Mix (Life Technologies, Carlsbad, Calif.), and specific primer pairs for the following genes: 18S ribosomal RNA (18S rRNA): forward, TCAAGAACGAAAGTCGGAGG; reverse, CCCTTCCGTCAATTCCTTTA Pon1: forward, TGTACCTACTGGTGGTAAAC; reverse, AAAAGCTCTCAGGTCCAATA Pon2: forward, GTAAACCACCCACAATTCAA; reverse, CCCAGTGTAGGTTCAAGTAT Pon3: forward, CCAAAAGAGGTCAAAGTTGT; reverse, GATCAACGGTCAAGTTATCC The target sequences were amplified by a standard 3-step protocol: preheating at 95°C for 10 minutes, 25 (18S rRNA) or 40 (other genes) cycles of denaturation (95°C for 15 s), annealing (60°C for 15 s) and extension (72°C for 30 s), and a final extension step at 72°C for 1 minute. The amplicons were separated by 2% agarose gel electrophoresis (50 V, 40 min), stained with SYBR Green I, and visualized under ultraviolet light.

RESULTS

The hair-cycle phase is known to reach the second telogen phase in wild-type mice at the age of 8 weeks.[11] Depilation induced a rapid transition to anagen as shown by skin pigmentation by the first week and abundant hair regeneration by the fourth week in +/+ mice (Fig. 1A). Conversely, only slight pigmentation was observed and not until the sixth week after depilation in ob/ob mice (Fig. 1B).
Fig. 1.

Hair regeneration after depilation in 8-week-old wild-type mice (A) and ob/ob mice (B). Each panel shows 1 representative experiment of 5 replicates. Color chart: 1 cm2.

Hair regeneration after depilation in 8-week-old wild-type mice (A) and ob/ob mice (B). Each panel shows 1 representative experiment of 5 replicates. Color chart: 1 cm2. When the HSL solution was applied to the dorsal skin of ob/ob mice, pigmentation was observed by the third week and the regenerated hair fully covered the depilated skin by the fourth week, whereas no pigmentation or hair regeneration was observed in vehicle-treated ob/ob mice (Fig. 2A). Histological examination revealed that the elongated hair follicles reached the deeper layer of subcutaneous fat tissue, the dermal papilla was completely enclosed by the developed hair bulb, and hair shaft regeneration was observed in HSL-treated skin tissue (Fig. 2B). Immunofluorescence for Ki67 revealed activated cell proliferation in the inner and outer root sheaths of HSL-treated follicles (Fig. 2C).
Fig. 2.

Hair regeneration in vehicle-treated (Veh) and HSL-treated (HSL) ob/ob mice. A, Macroscopic images at 0, 3, and 4 weeks after treatment. Color chart: 1 cm2. B, Hematoxylin and eosin staining of skin tissue sections from the center of the back of animals in the vehicle-treated and HSL-treated groups. Bar: 500 μm. C, Immunofluorescence for Ki67 (arrows), proliferative marker, with DAPI counterstaining in the vehicle-treated (left panel) and HSL-treated groups (middle sagittal plane, right horizontal plane). Bar: 100 μm. D, Immunohistochemistry for 8OHdG (arrows), oxidative stress marker, with hematoxylin counterstaining in the sagittal (upper panels) and horizontal planes (lower panels) of skin tissue in the vehicle-treated (left panels) and HSL-treated groups (right panels). Bar: 50 μm. E, mRNA expression of Pon1, Pon2, and Pon 3 in the vehicle-treated and HSL-treated groups examined by RT-PCR. 18S rRNA was simultaneously detected as an internal control. Each panel shows 1 (A–D) or 3 (E) representative experiments of 5 replicates.

Hair regeneration in vehicle-treated (Veh) and HSL-treated (HSL) ob/ob mice. A, Macroscopic images at 0, 3, and 4 weeks after treatment. Color chart: 1 cm2. B, Hematoxylin and eosin staining of skin tissue sections from the center of the back of animals in the vehicle-treated and HSL-treated groups. Bar: 500 μm. C, Immunofluorescence for Ki67 (arrows), proliferative marker, with DAPI counterstaining in the vehicle-treated (left panel) and HSL-treated groups (middle sagittal plane, right horizontal plane). Bar: 100 μm. D, Immunohistochemistry for 8OHdG (arrows), oxidative stress marker, with hematoxylin counterstaining in the sagittal (upper panels) and horizontal planes (lower panels) of skin tissue in the vehicle-treated (left panels) and HSL-treated groups (right panels). Bar: 50 μm. E, mRNA expression of Pon1, Pon2, and Pon 3 in the vehicle-treated and HSL-treated groups examined by RT-PCR. 18S rRNA was simultaneously detected as an internal control. Each panel shows 1 (A–D) or 3 (E) representative experiments of 5 replicates. The level of oxidative stress was examined by immunohistochemistry for 8OHdG. A large number of follicular cells were positive for 8OHdG in the vehicle-treated ob/ob mice. HSL treatment drastically reduced the number of positive cells (Fig. 2D). Expression of Pon1 mRNA was slightly higher in HSL-treated samples than in vehicle-treated samples. Pon3 was expressed weakly in HSL-treated samples but was completely negative in vehicle-treated samples. Pon2 was stably expressed in both groups (Fig. 2E).

DISCUSSION

This study identified HSL as a novel reagent able to promote hair growth in a mouse model of MS. The findings suggest that attenuation of oxidative stress was a mechanism by which HSL treatment enhanced hair growth. HSL is an interbacterial signaling molecule in Pseudomonas quorum sensing, which is a regulatory system that induces the expression of virulence genes depending on bacterial density.[12] PONs protect against bacterial infection by degrading HSL.[13] Pon2 is dominantly expressed in a wide range of tissues, and Pon1 and Pon3 are mainly expressed in the liver and secreted into the serum.[14] We found that Pon1 was expressed in the skin of MS mice, probably owing to the response to the elevated oxidative stress in MS skin.[6-8] HSL administration slightly increased the expression of Pon1 and Pon3 in the skin of ob/ob mice. However, elevation in expression of Pon1 and Pon3 was not enough to explain the drastic reduction in oxidative stress in hair follicles of ob/ob mice. Further studies to examine PON enzyme activities and the expression of other antioxidative enzymes are required. Because HSL is a small lipid-soluble molecule (approximately 300 Da), it can be delivered topically and noninvasively to the skin.[15] HSL is a potential novel therapeutic agent for alopecia in MS.
  15 in total

1.  Paraoxonase 2 acts as a quorum sensing-quenching factor in human keratinocytes.

Authors:  Maren Simanski; Sarah Babucke; Leo Eberl; Jürgen Harder
Journal:  J Invest Dermatol       Date:  2012-04-26       Impact factor: 8.551

2.  A multicenter, randomized, placebo-controlled, double-blind clinical trial of a novel formulation of 5% minoxidil topical foam versus placebo in the treatment of androgenetic alopecia in men.

Authors:  Elise A Olsen; David Whiting; Wilma Bergfeld; Jeffrey Miller; Maria Hordinsky; Rita Wanser; Paul Zhang; Bruce Kohut
Journal:  J Am Acad Dermatol       Date:  2007-08-29       Impact factor: 11.527

3.  Aging-like skin changes induced by ultraviolet irradiation in an animal model of metabolic syndrome.

Authors:  Tomoko Akase; Takashi Nagase; Lijuan Huang; Ai Ibuki; Takeo Minematsu; Gojiro Nakagami; Yasunori Ohta; Tsutomu Shimada; Masaki Aburada; Junko Sugama; Hiromi Sanada
Journal:  Biol Res Nurs       Date:  2011-03-28       Impact factor: 2.522

4.  Reversal of androgenic alopecia by minoxidil: lack of effect of simultaneously administered intermediate doses of cyproterone acetate.

Authors:  A J Vermorken
Journal:  Acta Derm Venereol       Date:  1983       Impact factor: 4.437

5.  Human and murine paraoxonase 1 are host modulators of Pseudomonas aeruginosa quorum-sensing.

Authors:  Egon A Ozer; Alejandro Pezzulo; Diana M Shih; Carlene Chun; Clement Furlong; Aldons J Lusis; Everett P Greenberg; Joseph Zabner
Journal:  FEMS Microbiol Lett       Date:  2005-10-05       Impact factor: 2.742

6.  Skin fragility in obese diabetic mice: possible involvement of elevated oxidative stress and upregulation of matrix metalloproteinases.

Authors:  Ai Ibuki; Tomoko Akase; Takashi Nagase; Takeo Minematsu; Gojiro Nakagami; Motoko Horii; Hiroshi Sagara; Takashi Komeda; Masayuki Kobayashi; Tsutomu Shimada; Masaki Aburada; Kotaro Yoshimura; Junko Sugama; Hiromi Sanada
Journal:  Exp Dermatol       Date:  2011-12-16       Impact factor: 3.960

7.  Aging-like skin changes in metabolic syndrome model mice are mediated by mineralocorticoid receptor signaling.

Authors:  Takashi Nagase; Tomoko Akase; Hiromi Sanada; Takeo Minematsu; Ai Ibuki; Lijuan Huang; Mayumi Asada; Kotaro Yoshimura; Miki Nagase; Tsutomu Shimada; Masaki Aburada; Gojiro Nakagami; Junko Sugama
Journal:  Aging Cell       Date:  2012-11-16       Impact factor: 9.304

8.  Serum paraoxonase activity and oxidative status in subjects with alopecia areata.

Authors:  Serap Gunes Bilgili; Halil Ozkol; Ayse Serap Karadag; Hatice Uce Ozkol; Ayse Seker; Omer Calka; Mehmet Aslan
Journal:  Cutan Ocul Toxicol       Date:  2013-04-16       Impact factor: 1.820

9.  Hair growth effects of oral administration of finasteride, a steroid 5 alpha-reductase inhibitor, alone and in combination with topical minoxidil in the balding stumptail macaque.

Authors:  A R Diani; M J Mulholland; K L Shull; M F Kubicek; G A Johnson; H J Schostarez; M N Brunden; A E Buhl
Journal:  J Clin Endocrinol Metab       Date:  1992-02       Impact factor: 5.958

10.  Antioxidant enzymes and lipid peroxidation in the scalp of patients with alopecia areata.

Authors:  Ahmet Akar; Ercan Arca; Hakan Erbil; Cemal Akay; Ahmet Sayal; A Riza Gür
Journal:  J Dermatol Sci       Date:  2002-08       Impact factor: 4.563

View more
  1 in total

Review 1.  Oxidative stress and alopecia areata.

Authors:  B E Prie; V M Voiculescu; O B Ionescu-Bozdog; B Petrutescu; L Iosif; L E Gaman; V G Clatici; I Stoian; C Giurcaneanu
Journal:  J Med Life       Date:  2015
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.