Literature DB >> 25285537

The impact of spgM, rpfF, rmlA gene distribution on biofilm formation in Stenotrophomonas maltophilia.

Chao Zhuo1, Qian-yu Zhao1, Shu-nian Xiao1.   

Abstract

BACKGROUND: Stenotrophomonas maltophilia is emerging as one of the most frequently found bacteria in chronic pulmonary infection. Biofilm is increasingly recognized as a contributing factor to disease pathogenesis. In the present study, a total of 37 isolates of S. maltophilia obtained from chronic pulmonary infection patients were evaluated to the relationship between biofilm production and the relative genes expression.
METHODS: The clonal relatedness of isolates was determined by pulse-field gel electrophoresis. Biofilm formation assays were performed by crystal violet assay, and confirmed by Electron microscopy analysis and CLSM analysis. PCR was employed to learn gene distribution and expression.
RESULTS: Twenty-four pulsotypes were designated for 37 S. maltophilia isolates, and these 24 pulsotypes exhibited various levels of biofilm production, 8 strong biofilm-producing S. maltophilia strains with OD492 value above 0.6, 14 middle biofilm-producing strains with OD492 average value of 0.4 and 2 weak biofilm-producing strains with OD492 average value of 0.19. CLSM analysis showed that the isolates from the early stage of chronic infection enable to form more highly structured and multilayered biofim than those in the late stage. The prevalence of spgM, rmlA, and rpfF genes was 83.3%, 87.5%, and 50.0% in 24 S. maltophilia strains, respectively, and the presence of rmlA, spgM or rpfF had a close relationship with biofilm formation but did not significantly affect the mean amount of biofilm. Significant mutations of spgM and rmlA were found in both strong and weak biofilm-producing strains.
CONCLUSION: Mutations in spgM and rmlA may be relevant to biofilm formation in the clinical isolates of S. maltophilia.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25285537      PMCID: PMC4186781          DOI: 10.1371/journal.pone.0108409

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Stenotrophomonas maltophilia is a Gram-negative opportunistic pathogen in hospitalized or compromised patients [1], [2]. However, the role of this opportunistic pathogen as an innocent bystander or causative agent often remains unclear [3], [4] and little is known about its virulence factors [5], [6]. Biofilms, sessile structured bacterial communities exhibiting recalcitrance to antimicrobial compounds and persistence despite sustained host defenses, are increasingly recognized as a contributing factor to disease pathogenesis in the respiratory tract diseases associated with chronic bacterial infections [7]. S. maltophilia isolates are known to have the ability to form biofilms on both abiotic surfaces [8]–[10], and it is an intrinsic difference in biofilm formation among clinical isolates of S. maltophilia. The molecular mechanisms underlying biofilm formation in S. maltophilia have not been extensively studied. Recently, mutants for rmlA gene and rpfF gene are reported to decrease biofilm formation [11], [12]. Further, the spgM gene, encoding a bifunctional enzyme with both phosphoglucomutase (PGM) and phosphomannomutase activities, could be involved in biofilm-forming ability because of the homology with the algC gene that is responsible for the production of a PGM associated with LPS and alginate biosynthesis in P. aeruginosa [13]. However, it is still unclear that which gene mutation results in the change of biofilm formation among the three genes, and which key amino acid mutation determines the function changes of the protein. In this study, we examined a set of 24 clinical isolates of S. maltophilia for biofilm formation traits in order to find significant differences, and evaluated the relationship between biofilm production and the detection of rmlA, spgM, and rpfF genes.

Materials and Methods

Ethics Statement

This study protocol was approved by the Ethics Committee of The First Affiliated Hospital of Guangzhou Medical University. All subjects signed written informed consent prior to the study. Patient information was anonymized and de-identified prior to analysis.

Bacterial isolates and growth conditions

Overall, 37 S. maltophilia isolates and S. maltophilia ATCC13637 were investigated. All the strains collected from the sputa of patients attending the Guangzhou institute of respiratory diseases from 2010 to 2011. Among the 37 isolates, 4 sequential strains isolated from the same patient over a period of 2 years and 3 sequential strains isolated from another patient over a period of 1 year were investigated. The isolates were identified as S. maltophilia by biochemical tests using manual (API 20-NE System; BioMérieux, Marcy-L'Etoile, France) or automated (Vitek; BioMérieux) systems, then stored at −80°C until use when they were grown at 37°C in Mueller-Hinton agar (MHA; Oxoid) plates.

Genetic relatedness by PFGE and cluster analysis

Pulsed-field gel electrophoresis (PFGE) analysis of XbaI-digested genomic DNA was performed to determine the genetic relatedness of S. maltophilia isolates using a CHEF-Mapper XA System (Bio-Rad Laboratories, Hercules, CA, USA) as described by Seifert [14]. The interpreting criteria were described by Tenover [15] combining UPGMA (unweighted pair group method with hierarchic averages) method, Isolates were assigned the same pulsetype if the value of Dice coefficient of similarity was >80% [16].

Biofilm formation assay

Overnight cultures in TSB were corrected with fresh TSB to an OD550 of 1.00 (corresponding to about 1×109 CFU/ml). Two-hundred microliters of 1∶100 diluted inoculum were dispensed to each well of a sterile flatbottom polystyrene tissue culture 96-wells microtiter and incubated at 37°C for 24 h. Biofilm biomass was then measured by crystal violet assay. Briefly, biofilm samples were fixed for 1 h at 60°C, stained for 5 min at RT with 200 µl Hucker-modified crystal violet, then rinsed in standing water and allowed to dry. Biofilm samples were stained with 250 µl of 33% glacial acetic acid for 15 min, and the optical density at 492 nm (OD492) was read. Considering a low cut-off (ODc) represented by 3×SD above the mean OD of control wells, strains were classified into the following categories: no biofilm producer (OD≤ODc), weak biofilm producer (ODc17]. The biofilm microstructure was detected by SEM and CLSM. SEM analyses were carried out with S. maltophilia strain S1219 and ATCC13637, selected because S1219 was the highest producer of slime among 24 strains considered. Biofilms were allowed to grow on cover slip, and fixed with 2.5% glutaraldehyde for at least 40 min. After being washed with PBS, the samples were then dehydrated in a series of aqueous ethanol solutions (50 to 100%). The specimens were mounted on aluminum stubs with conductive carbon cement, allowed to dry for 3 h, and then coated with 15-nm Au film with an agar automatic sputter coater. After processing, samples were observed with a QUANTA 200 scanning electron microscope in the high-vacuum mode at 15 kV. CLSM was performed as pervious report [18]. Briefly, Biofilm samples were fixed in 2.5% glutaraldehyde, and stained with FITC (fluorescein isothiocyanate). CLSM analysis was performed with an LSM 510 META laser scanning microscope attached to an Axioplan II microscope. The excitation wavelengths were 458 [Argon laser], and 543 nm [He-Ne laser], and emission wavelengths were 488 nm for FITC, respectively. Depth measurements were taken at regular intervals across the width of the device. To determine the structure of the biofilms, a series of horizontal (x-y) optical sections were taken throughout the full length of the biofilm. Confocal images of green (FITC) fluorescence were conceived using a track mode.

PCR-based genotyping for rmlA, spgM, and rpfF

Bacterial DNA was extracted and purified, then amplified and visualized on 2% agarose gel. PCR primers were respectively 5′ CGGAAAAGCAGAACATCG 3′ and 5′ GCAACTTGGTTTCAATCACTT 3′ (1222 bp) for rmlA, 5′ ATACCGGGGTGCGTTGAC 3′ and 5′ CATCTGCATGTGGATCTCGT 3′ (2750 bp) for spgM and, finally, 5′ CACGACAGTACAGGGGACC 3′ and 5′ GGCAGGAATGCGTTGG 3′ (1140 bp) for rpfF. All PCRs products were sequenced and BLAST in PUBMED. Furthermore, the three gene expression was performed with Reverse transcriptase PCR according to pervious report [18].

Statistical analysis

All assays were carried out in triplicate and repeated twice, and the results are presented as means±SDs. The Pearson's correlation coefficient was calculated to determine the association between two variables. All P-values were based on two-tailed tests of significance, and a significance level of 0.05 or 0.01 was used. Statistical analysis of results was conducted with statistical software SPSS17.0.

Results

Clonal relatedness of isolates

According to the patterns of PFGE isolates, 24 pulsotypes were designated for 37 S. maltophilia isolates. Besides 19 individual pulsotypes, the remaining 18 isolates were classified into 5 pulsotypes, designated types A, B, C, D and E (Figure 1). Three out of 4 sequential strains isolated from one patient belong to type A, and the remaining 1 strain belong to one individual pulsotype (type T). Three sequential strains isolated from another patient belong to the same clone—type C. All the strains with individual pulsotypes and the 7 sequential strains were applied in further analysis.
Figure 1

Dendrogram illustrating the percentage similarity of PFGE profiles in tested isolates of S. maltophilia.

Ability of the isolates of S. maltophilia in forming biofilm

All the 24 isolates of S. maltophilia were able to form biofilm, and the biofilm forming ability varied greatly among strains tested (OD492 range: 0.18–1.4). Eight isolates had higher ability of biofilm-producing (OD492, mean ± SD: 0.808±0.310), 14 had middle (OD492, mean ± SD: 0.408±0.215) and 2 had lower (OD492, mean ± SD: 0.186±0.036) (Figure 2).
Figure 2

Histogram illustrating the ability of biofilm formation in tested isolates of S. maltophilia.

Scanning electron micrographs (SEM) of the S. maltophilia biofilm mode of growth on polystyrene surface over 24 h of incubation was shown in figure 3. The biofilm covered just 70% of the surface, growing in specific clusters of cells (microcolonies), and a dense network of cells deeply embedded in an extracellular matrix. Spectrophotometric results were confirmed by Confocal Laser Scanning Microscopy (CLSM) analysis in figure 4. The biofilm formed by Sm1219 strain resulting to be the most complex, revealing a multilayered cell structure (58–63 µm, depth) embedded in an abundant extracellular polymeric substance (EPS) compared with S. maltophilia ATCC13637. Moreover, CLSM analysis revealed that the biofilm structure of the S. maltophilia isogenic sequential strains was significantly different in various isolated time. The 3 isogenic sequential strains belong to type C pulsotype displayed different ability in biofilm-formation were isolated from 11 months among his hospitalization. The first and second isolates revealed stronger ability in biofilm-formation with 0.56 and 0.60 of OD492 values, and the third isolate had weak ability in biofilm-formation with OD492 values of 0.19. Similarly, the 4 isolates of the other patient shown that the first and second isolates belong to type A pulsotype presented moderate ability in biofilm-formation with OD492 values of 0.40 to 0.42, while the fourth belong to type A presented weaker ability in biofilm-formation with OD492 values of 0.28. The third isolates (individual pulsotype) shown weak ability in biofilm-formation with D492 values of 0.20. All the two groups displayed that the strain isolated in early stage shown strong or middle biofilm-producing while the weak biofilm-producing in late stage. CLSM analysis also showed more highly structured, multilayered biofilm in early stage.
Figure 3

SEM of the strain Sm1219 of S. maltophilia biofilm mode in 8 h (left) and 24 h (right).

Figure 4

CLSM of the strain Sm1219 of S. maltophilia biofilm mode in 8 h (up) and 24 h (down).

Different genotypes and gene mutation are associated to ability of biofilm formation

PCR-based typing of 24 S. maltophilia strains for spgM, rmlA, and rpfF genes showed an overall prevalence of 83.3%, 87.5%, and 50.0%, respectively. The presence of rmlA, spgM or rpfF had no close relationship with the ability of biofilm formation for each strain. However, considering the strain population as a whole, the presence of spgM and rpfF significantly improved biofilm formation. In particular, the strains with spgM+/rpfF+/rmlA+ genotype were easier to display strong or moderate biofilm-producer phenotype than the strains with spgM−/rpfF−/rmlA+ genotype which was frequently detected in weak biofilm-producer phenotype (Table 1). Correlation analysis showed that the gene expression of rmlA, spgM and rpfF detected in the clinical strains were not associated to strong or moderate biofilm producers (For rmlA, Pearson r = 0.32, P>0.05; For spgM, Pearson r = 0.36, P>0.05; For rpfF, Pearson r = 0.23, P>0.05) (data not shown). In addition, significant amio acid mutation in spgM encoding gene and rmlA encoding gene were found between some strains of the strong and the weak biofilm-producer phenotype (Figure 5).
Table 1

The relation of different genotypes and the ability of biofilm formation in Stenotrophomonas maltophilia isolates with individual pulsotype.

NO. strainsPulsotypesOD492 valuesDegree of BFspgMrpfFrmlA
57-9110G0.17weak+
11931E0.20weak+
1150# C0.19weak+
1562* T0.20weak+
11757* A0.28moderate+++
20B0.44moderate+++
997I0.36moderate+
1251* A0.40moderate+++
1474* A0.42moderate+++
1452M0.38moderate+
15-2850L0.32moderate++
168K0.40moderate++
10544D0.50moderate+++
701044Q0.40moderate++
251S0.31moderate++
707344R0.42moderate+
701F0.53moderate+++
140J0.56moderate++
1479O0.37moderate+++
421# C0.56moderate++
535# C0.60strong++
13N0.62strong+++
997V0.63strong++
11337W0.65strong+++
10275H0.68strong++
11367U0.68strong++
7342H1.20strong+++
1219P1.40strong+++

BF: Biofilm;

+: Gene expression in the S. maltophilia isolate;

−: No gene expression in S. maltophilia.

*: Four sequential strains isolated from one patient.

: Three sequential strains isolated from another patient.

Figure 5

Analysis of rmlA amino acid mutation in isolates with vary ability of biofilm forming.

BF: Biofilm; +: Gene expression in the S. maltophilia isolate; −: No gene expression in S. maltophilia. *: Four sequential strains isolated from one patient. : Three sequential strains isolated from another patient.

Discussion

A significant feature of S. maltophilia is its ability to form biofilms on surfaces including Teflon, glass, and plastics and on host tissues and biofilms have been estimated to be associated with 65% of hospital-acquired infections [26]. However, it is not yet known whether there are any variations in biofilm formation among clonally diverse clinical isolates of S. maltophilia, and there are any relationships between biofilm forming ability and mutation or expression of biofilm-relative genes such as spgM, rmlA, and rpfF gene, although it was reported that the spgM mutant formed more biofilm than that formed by the parental strain on polystyrene microtiter wells and the rmlA and rmlC mutants produced significantly more biofilm on glass than that produced by the wild type [12], [25]. So, this study is designed to clarify these problems by analysis of morphology and genotype for biofilm-producing S. maltophilia. Firstly, microtiter colorimetric assay for biofilm formation showed a wide range of biofilm formation ability, from biofilm-deficient phenotypes to those producing structurally complex biofilms. Morover, the images corresponded to three-dimensional reconstructions obtained from CLSM exhibited the native multicellular structures of biofilm in various forming ability, and CLSM analysis also showed that isolates from the early periods of chronic infection were able to form uniform flat biofilms or highly structured, multilayered and exopolysaccharide matrix-encased biofilms. On the contrary, isolates recovered from the late phase of chronic infection showed a significant reduction in adherence, lacking ability to form a mature biofilm. The variations in biofilm formation among the same or different patient may contribute to survival environment change of the bacteria. It was reported that he reduced efficiency in forming biofilm could be the consequences of S. maltophilia adaptation to a stressed environment such as CF lung [19]–[21], and oxidative stress and anaerobic conditions existed in COPD patient were also the risk factors to cause biofilm-producer reduced [22], and the similar support was found in P.aeruginosa [23]. In the present study we also focused our efforts on the relationship between biofilm formation and the presence of rpfF, rmlA and spgM genes. Overall, our results revealed the presence of spgM and rpfF significantly improved biofilm formation. The result was identified with Pompilio'report, which showed that spgM gene played a central role in biofilm formation of S. maltophilia, whose presence is significantly associated to a strong biofilm formation [9]. However, there were no regular mutation of spgM and rmlA gene between the strong and the weak biofilm formation in this study. Especially, 10 sites of amino acid mutation in spgM were found between the different phenotypes. spgM gene was shown to encode a bifunctional enzyme with both PGM and phosphomannomutase activities, an analysis of S. maltophilia spgM transposon insertion mutant strain JB12-23 showed that it formed more biofilm than that formed by its parental wild-type strain [13]. Unfortunately, it is uncertain that which site mutation in spgM might play a key role in the function change of SpgM by these reports. Similarly, the situation also appeared in rmlA gene. In this study, the rmlA genes shown more mutation sites than spgM gene among the clinical isolates with the three kinds of ability in biofilm formation, and only 15% amino acid sequences keep the homology between strong and weak ability groups. These results in this study may provide a clue for further study. This study has several limitations. Firstly, it is difficult for us to observe dynamically the biofilm development of one strain such as adherence and twitching motility like previous report [23], [24], since the devices commonly used for the confocal study of biofilms, such as flow-cells, capillary tubes or glass coverslides, may be relatively expensive, which caused it difficult to observe dynamically the biofilm development of one strain such as adherence and twitching motility. Furthermore, we failed to analyze the relationship between ability of biofilm formation and key mutation of rmlA and spgM genes due to many variations in the amino acid sequence of the rmlA and spgM genes respectively. We try to find other better methods to understand the impact of these genes distribution on biofilm formation in S. maltophilia in further study. In conclusion, the results showed that clinical strains of S. maltophilia significantly differ in some phenotype and genotype in biofilm formation, and also added new insight and expand previous knowledge concerning the relative genes.
  26 in total

1.  The biofilm architecture of sixty opportunistic pathogens deciphered using a high throughput CLSM method.

Authors:  A Bridier; F Dubois-Brissonnet; A Boubetra; V Thomas; R Briandet
Journal:  J Microbiol Methods       Date:  2010-04-28       Impact factor: 2.363

2.  Differential biofilm formation and motility associated with lipopolysaccharide/exopolysaccharide-coupled biosynthetic genes in Stenotrophomonas maltophilia.

Authors:  Tzu-Pi Huang; Eileen B Somers; Amy C Lee Wong
Journal:  J Bacteriol       Date:  2006-04       Impact factor: 3.490

3.  Adhesion of Stenotrophomonas maltophilia to mouse tracheal mucus is mediated through flagella.

Authors:  Ayaid Khadem Zgair; Sanjay Chhibber
Journal:  J Med Microbiol       Date:  2011-03-17       Impact factor: 2.472

Review 4.  Stenotrophomonas maltophilia: an emerging global opportunistic pathogen.

Authors:  Joanna S Brooke
Journal:  Clin Microbiol Rev       Date:  2012-01       Impact factor: 26.132

5.  Role of excessive inflammatory response to Stenotrophomonas maltophilia lung infection in DBA/2 mice and implications for cystic fibrosis.

Authors:  Giovanni Di Bonaventura; Arianna Pompilio; Roberta Zappacosta; Francesca Petrucci; Ersilia Fiscarelli; Cosmo Rossi; Raffaele Piccolomini
Journal:  Infect Immun       Date:  2010-03-22       Impact factor: 3.441

6.  Factors associated with adherence to and biofilm formation on polystyrene by Stenotrophomonas maltophilia: the role of cell surface hydrophobicity and motility.

Authors:  Arianna Pompilio; Raffaele Piccolomini; Carla Picciani; Domenico D'Antonio; Vincenzo Savini; Giovanni Di Bonaventura
Journal:  FEMS Microbiol Lett       Date:  2008-08-04       Impact factor: 2.742

7.  Diffusible signal factor-dependent cell-cell signaling and virulence in the nosocomial pathogen Stenotrophomonas maltophilia.

Authors:  Yvonne Fouhy; Karl Scanlon; Katherine Schouest; Charles Spillane; Lisa Crossman; Matthew B Avison; Robert P Ryan; J Maxwell Dow
Journal:  J Bacteriol       Date:  2007-04-27       Impact factor: 3.490

8.  Pseudomonas aeruginosa biofilms in the respiratory tract of cystic fibrosis patients.

Authors:  Thomas Bjarnsholt; Peter Østrup Jensen; Mark J Fiandaca; Jette Pedersen; Christine Rønne Hansen; Claus Bøgelund Andersen; Tacjana Pressler; Michael Givskov; Niels Høiby
Journal:  Pediatr Pulmonol       Date:  2009-06

9.  Phenotypic and genotypic characterization of Stenotrophomonas maltophilia isolates from patients with cystic fibrosis: genome diversity, biofilm formation, and virulence.

Authors:  Arianna Pompilio; Stefano Pomponio; Valentina Crocetta; Giovanni Gherardi; Fabio Verginelli; Ersilia Fiscarelli; Giordano Dicuonzo; Vincenzo Savini; Domenico D'Antonio; Giovanni Di Bonaventura
Journal:  BMC Microbiol       Date:  2011-07-05       Impact factor: 3.605

10.  The complete genome, comparative and functional analysis of Stenotrophomonas maltophilia reveals an organism heavily shielded by drug resistance determinants.

Authors:  Lisa C Crossman; Virginia C Gould; J Maxwell Dow; Georgios S Vernikos; Aki Okazaki; Mohammed Sebaihia; David Saunders; Claire Arrowsmith; Tim Carver; Nicholas Peters; Ellen Adlem; Arnaud Kerhornou; Angela Lord; Lee Murphy; Katharine Seeger; Robert Squares; Simon Rutter; Michael A Quail; Mari-Adele Rajandream; David Harris; Carol Churcher; Stephen D Bentley; Julian Parkhill; Nicholas R Thomson; Matthew B Avison
Journal:  Genome Biol       Date:  2008-04-17       Impact factor: 13.583

View more
  17 in total

1.  Characterisation of hydrocarbon degradation, biosurfactant production, and biofilm formation in Serratia sp. Tan611: a new strain isolated from industrially contaminated environment in Algeria.

Authors:  Annela Semai; Frédéric Plewniak; Armelle Charrié-Duhaut; Amalia Sayeh; Lisa Gil; Céline Vandecasteele; Céline Lopez-Roques; Emmanuelle Leize-Wagner; Farid Bensalah; Philippe N Bertin
Journal:  Antonie Van Leeuwenhoek       Date:  2021-02-15       Impact factor: 2.271

2.  Evaluation of antibacterial activity of five biocides and the synergistic effect of biocide/EDTA combinations on biofilm-producing and non-producing Stenotrophomonas maltophilia strains isolated from clinical specimens in Iran.

Authors:  Raana Kazemzadeh Anari; Farhad Nikkhahi; Amir Javadi; Mehdi Bakht; Mohammad Rostamani; Fatemeh Zeynali Kelishomi; Safar Ali Alizadeh
Journal:  BMC Microbiol       Date:  2022-10-21       Impact factor: 4.465

3.  Taxonomic position, antibiotic resistance and virulence factor production by Stenotrophomonas isolates from patients with cystic fibrosis and other chronic respiratory infections.

Authors:  Ad C Fluit; Jumamurat R Bayjanov; María Díez Aguilar; Rafael Cantón; Stuart Elborn; Michael M Tunney; Jelle Scharringa; Barry J Benaissa-Trouw; Miquel B Ekkelenkamp
Journal:  BMC Microbiol       Date:  2022-05-12       Impact factor: 4.465

4.  Genetic Adaptation of Achromobacter sp. during Persistence in the Lungs of Cystic Fibrosis Patients.

Authors:  Winnie Ridderberg; Signe Maria Nielsen; Niels Nørskov-Lauritsen
Journal:  PLoS One       Date:  2015-08-27       Impact factor: 3.240

5.  Effects of Fluoroquinolones and Azithromycin on Biofilm Formation of Stenotrophomonas maltophilia.

Authors:  Aihua Wang; Qinqin Wang; Timothy Kudinha; Shunian Xiao; Chao Zhuo
Journal:  Sci Rep       Date:  2016-07-13       Impact factor: 4.379

6.  Characterization of Phenotypic and Genotypic Diversity of Stenotrophomonas maltophilia Strains Isolated From Selected Hospitals in Iran.

Authors:  Narjess Bostanghadiri; Zohreh Ghalavand; Fatemeh Fallah; Abbas Yadegar; Abdollah Ardebili; Samira Tarashi; Abazar Pournajaf; Jalal Mardaneh; Saeed Shams; Ali Hashemi
Journal:  Front Microbiol       Date:  2019-05-29       Impact factor: 5.640

Review 7.  Quorum Sensing Signaling and Quenching in the Multidrug-Resistant Pathogen Stenotrophomonas maltophilia.

Authors:  Pol Huedo; Xavier Coves; Xavier Daura; Isidre Gibert; Daniel Yero
Journal:  Front Cell Infect Microbiol       Date:  2018-04-24       Impact factor: 5.293

8.  Clinical and Molecular Epidemiology of Stenotrophomonas maltophilia in Pediatric Patients From a Chinese Teaching Hospital.

Authors:  Zhongliang Duan; Juanxiu Qin; Cui Li; Chunmei Ying
Journal:  Front Cell Infect Microbiol       Date:  2020-08-11       Impact factor: 5.293

9.  Antioxidant, Antimicrobial and Antibiofilm Activity of Coriander (Coriandrum sativum L.) Essential Oil for Its Application in Foods.

Authors:  Miroslava Kačániová; Lucia Galovičová; Eva Ivanišová; Nenad L Vukovic; Jana Štefániková; Veronika Valková; Petra Borotová; Jana Žiarovská; Margarita Terentjeva; Soňa Felšöciová; Eva Tvrdá
Journal:  Foods       Date:  2020-03-04

10.  The Toxin-Antitoxin Systems of the Opportunistic Pathogen Stenotrophomonas maltophilia of Environmental and Clinical Origin.

Authors:  Laurita Klimkaitė; Julija Armalytė; Jūratė Skerniškytė; Edita Sužiedėlienė
Journal:  Toxins (Basel)       Date:  2020-10-01       Impact factor: 4.546

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.