| Literature DB >> 25278846 |
Eric R Strickland1, Sarah A Woller2, Sandra M Garraway2, Michelle A Hook1, James W Grau2, Rajesh C Miranda1.
Abstract
Uncontrollable nociceptive stimulation adversely affects recovery in spinally contused rats. Spinal cord injury (SCI) results in altered microRNA (miRNA) expression both at, and distal to the lesion site. We hypothesized that uncontrollable nociception further influences SCI-sensitive miRNAs and associated gene targets, potentially explaining the progression of maladaptive plasticity. Our data validated previously described sensitivity of miRNAs to SCI alone. Moreover, following SCI, intermittent noxious stimulation decreased expression of miR124 in dorsal spinal cord 24 h after stimulation and increased expression of miR129-2 in dorsal, and miR1 in ventral spinal cord at 7 days. We also found that brain-derived neurotrophic factor (BDNF) mRNA expression was significantly down-regulated 1 day after SCI alone, and significantly more so, after SCI followed by tailshock. Insulin-like growth factor-1 (IGF-1) mRNA expression was significantly increased at both 1 and 7 days post-SCI, and significantly more so, 7 days post-SCI with shock. MiR1 expression was positively and significantly correlated with IGF-1, but not BDNF mRNA expression. Further, stepwise linear regression analysis indicated that a significant proportion of the changes in BDNF and IGF-1 mRNA expression were explained by variance in two groups of miRNAs, implying co-regulation. Collectively, these data show that uncontrollable nociception which activates sensorimotor circuits distal to the injury site, influences SCI-miRNAs and target mRNAs within the lesion site. SCI-sensitive miRNAs may well mediate adverse consequences of uncontrolled sensorimotor activation on functional recovery. However, their sensitivity to distal sensory input also implicates these miRNAs as candidate targets for the management of SCI and neuropathic pain.Entities:
Keywords: BDNF; IGF; microRNA; spinal cord injury; uncontrollable nociception
Mesh:
Substances:
Year: 2014 PMID: 25278846 PMCID: PMC4166958 DOI: 10.3389/fncir.2014.00117
Source DB: PubMed Journal: Front Neural Circuits ISSN: 1662-5110 Impact factor: 3.492
Number of subjects (n) per condition.
| Treatment | 1 h | 1 day | 7 days |
|---|---|---|---|
| Sham operated | 4 | 4 (d and v) | 4 (d and v) |
| Contused-unshocked | 6 | 6 (d and v) | 6 (d and v) |
| Contused-shocked | 6 | 6 (d and v) | 6 (d and v) |
Primer sequences.
| mRNA Primers | Forward | Reverse |
|---|---|---|
| BDNF | TGGACATATCCATGACCAGAAA | CACAATTAAAGCAGCATGCAAT |
| IGF-1 | CCGCTGAAGCCTACAAAGTC | GGGAGGCTCCTCCTACATTC |
| GAPDH | AGTATGTCGTGGAGTCTACTG | TGGCAGCACCAGTGGATGCAG |
| hsa-miR-1/#204344 | UGGAAUGUAAAGAAGUAUGUAU | MIMAT0000416 |
| hsa-miR-21-5p/#204230 | UAGCUUAUCAGACUGAUGUUGA | MIMAT0000076 |
| hsa-miR-124-3p/#204319 | UAAGGCACGCGGUGAAUGCC | MIMAT0000422 |
| hsa-miR-129-2-3p/# 204026 | AAGCCCUUACCCCAAAAAGCAU | MIMAT0004605 |
| hsa-miR-146a-5p/# 204688 | UGAGAACUGAAUUCCAUGGGUU | MIMAT0000449 |
| U6 snRNA/# 203907 | ||
Pearson’s product–moment correlations for miRNA expression.
| miR1 | miR21 | miR124 | miR129-2 | miR146a | |
|---|---|---|---|---|---|
| Pearson correlation | 0.282* | 0.575** | 0.349** | 0.589** | |
| Sig. (two-tailed) | |||||
| Pearson correlation | 0.163 | -0.155 | 0.691** | ||
| Sig. (two-tailed) | |||||
| Pearson correlation | 0.742** | 0.394** | |||
| Sig. (two-tailed) | |||||
| Pearson correlation | 0.021 | ||||
| Sig. (2-tailed) | |||||
Pearson’s product–moment correlations between miRNA expression and the expression of Igf1 and BDNF mRNA transcripts.
| miR1 | miR21 | miR124 | miR129-2 | miR146a | |
|---|---|---|---|---|---|
| Pearson correlation | 0.069 | 0.332** | -0.289* | -0.164 | 0.154 |
| Sig. (two-tailed) | |||||
| Pearson correlation | 0.402** | -0.235 | 0.469** | 0.415** | 0.173 |
| Sig. (two-tailed) | |||||