RNA interference has emerged as a powerful strategy in cancer therapy because it allows silencing of specific genes associated with tumor progression and resistance. Mad2 is an essential mitotic checkpoint component required for accurate chromosome segregation during mitosis, and its complete abolition leads to cell death. We have developed an epidermal growth factor receptor (EGFR)-targeted chitosan system for silencing the Mad2 gene as a strategy to efficiently induce cell death in EGFR overexpressing human A549 non-small cell lung cancer cells. Control and EGFR-targeted chitosan nanoparticles loaded with small interfering RNAs (siRNAs) against Mad2 were formulated and characterized for size, charge, morphology, and encapsulation efficiency. Qualitative and quantitative intracellular uptake studies by confocal imaging and flow cytometry, respectively, showed time-dependent enhanced and selective intracellular internalization of EGFR-targeted nanoparticles compared to nontargeted system. Targeted nanoparticles showed nearly complete depletion of Mad2 expression in A549 cells contrasting with the partial depletion in the nontargeted system. Accordingly, Mad2-silencing-induced apoptotic cell death was confirmed by cytotoxicity assay and flow cytometry. Our results demonstrate that EGFR-targeted chitosan loaded with Mad2 siRNAs is a potent delivery system for selective killing of cancer cells.
RNA interference has emerged as a powerful strategy in cancer therapy because it allows silencing of specific genes associated with tumor progression and resistance. Mad2 is an essential mitotic checkpoint component required for accurate chromosome segregation during mitosis, and its complete abolition leads to cell death. We have developed an epidermal growth factor receptor (EGFR)-targeted chitosan system for silencing the Mad2 gene as a strategy to efficiently induce cell death in EGFR overexpressing humanA549 non-small cell lung cancer cells. Control and EGFR-targeted chitosan nanoparticles loaded with small interfering RNAs (siRNAs) against Mad2 were formulated and characterized for size, charge, morphology, and encapsulation efficiency. Qualitative and quantitative intracellular uptake studies by confocal imaging and flow cytometry, respectively, showed time-dependent enhanced and selective intracellular internalization of EGFR-targeted nanoparticles compared to nontargeted system. Targeted nanoparticles showed nearly complete depletion of Mad2 expression in A549 cells contrasting with the partial depletion in the nontargeted system. Accordingly, Mad2-silencing-induced apoptotic cell death was confirmed by cytotoxicity assay and flow cytometry. Our results demonstrate that EGFR-targeted chitosan loaded with Mad2 siRNAs is a potent delivery system for selective killing of cancer cells.
Lung cancer is the
most common cause of cancer-related deaths worldwide,
and non-small cell lung cancer (NSCLC) alone accounts for nearly 80%
of the fatalities.[1] One of the major causes
of poor clinical outcomes in NSCLC is the development of multidrug
resistance and metastatic dissemination to other parts of the body.
Refractory disease is the major contributor to the failure of chemotherapy
in NSCLC, and it often develops due to poor drug availability, reduced
residence time in the tumor, ineffective intracellular penetration,
dynamic tumor microenvironment, and other molecular mechanisms adapted
by cancer cells.[2,3] An alternative approach to develop
new targets to overcome multidrug resistance and augment the therapeutic
effects of existing drugs has therefore gained central interest in
the scientific community. RNA interference (RNAi) has emerged as a
powerful strategy for overcoming drug resistance in NSCLC because
it allows silencing of specific genes that could be associated with
multidrug resistance.[4] Small interfering
ribonucleic acids (siRNAs) allow the possible targeting of vital genes
in tumor cells, adapting it to specific tumor types and customizing
it to personalized therapy for subtle genotypic and phenotypic variations.
Molecular therapy using siRNA has shown great potential in the treatment
of diseases such as cancer by silencing crucial genes.[4−6]The mitotic checkpoint thoroughly ensures that each new cell
receives
one copy of each chromosome from a dividing cell.[7,8] Many
cancer cells have a weaker mitotic checkpoint which accelerates the
rate of chromosome losses and gains, thereby acting as a driving force
for carcinogenesis.[7,8] However, total suppression of
the mitotic checkpoint activity is lethal, thus making it an attractive
therapeutic target for siRNA-mediated intervention.[7] In fact, several small molecules targeting the mitotic
checkpoint are already under clinical trials. Mad2 is one of the key
mitotic checkpoint regulators that sequester Cdc20, thereby inactivating
anaphase-promoting complex/cyclosome (APC/C), the complex responsible
for triggering anaphase.[8] Mad2 overexpression
has been associated with aneuploidy and tumorigenesis and reported
in various carcinomas such as liver cancer, breast cancer, soft-tissue
sarcoma, B-cell lymphoma, and NSCLC.[9−12] Decreased expression, but not
complete obliteration of mitotic checkpoint genes, has been associated
with resistance to anti-microtubule drugs and DNA-damaging agents.[13,14] In addition, low levels of Mad2have been correlated with cisplatin
resistance and high levels with sensitivity to the same drug.[15,16] Nonetheless, Mad2 knockdown has been shown to be catastrophic and
incompatible with cell viability.[17,18] RNAi-mediated
knockdown of Mad2 causes massive chromosome mis-segregation during
mitosis, and its null mutation in mice embryos causes early death
during embryogenesis.[19] The selectivity
and the catastrophic impact of Mad2 gene silencing
on cancer cells, therefore, would be a highly attractive alternative
therapy for cancer.The most challenging obstacle in siRNA therapn>eutics
is their efficient
delivery to the target cells. Some of the major difficulties include
poor pharmacokinetic properties, enzymatic degradation, cellular permeability
restrictions, endosomal trapping, off-target effects, and systemic
interferon responses.[20] Careful choice
of a suitable delivery vector, however, can aid in circumventing many
of these challenges and imparting significant benefit to RNAi as a
clinically viable therapeutic option.[21] An ideal delivery vector should fulfill certain criteria before
it can be used for therapeutic applications. Biocompatibility, biodegradability,
and non-immunogenicity are some of the key consideration while designing
a delivery system. We have recently demonstrated hyaluronic acid (HA)
derivative-based self-assembling vectors for delivery of siRNA-targeting
antiapoptotic genes, survivin and Bcl2, in the NSCLC tumor model.[22] HA is a
natural polymer with a backbone that imparts CD44 receptor-targeting
ability to the nanoparticles and could also be used for the synthesis
of different derivatives by easy chemical coupling reactions. A detailed
in vitro study demonstrated efficient delivery of the payload to the
A549humanNSCLC cells and subsequent knockdown of the target gene.
In vivo studies in subcutaneous A549 (wild-type, drug-sensitive) and
A549–DDP (cisplatin-resistant) NSCLC tumor-bearing mice further
demonstrated that this delivery approach could be used in combination
with cisplatin to obtain the synergy of antitumor activity and overcome
multidrug resistance.[23,24]Chitosan (CS) is a similar
natural polymer that has been extensively
studied for nucleic acid delivery in vitro and in vivo.[25−27] CS presents several advantages such as mucoadhesivity, biocompatibility,
biodegradability, and low cost of production. Most importantly, chitosan
can bind with polyanionic molecules such as DNA or siRNA by electrostatic
interaction due to the presence of protonated amine groups in the
backbone, leading to the formation of nanosized particles.[28] Besides, the amine backbone of CS allows for
chemical modifications such as attachment of poly(ethylene glycol)
(PEG) to impart stealth properties or functionalization with ligands
to target specific cancer cell types. Although there are no chitosan-based
vectors for in vivo administration of nucleic acids at the clinical
level, there are numerous publications that report their use as a
vaccine adjuvant for oral and intranasal peptide/vaccine delivery.[29−31] Similarly, chitosanhas been extensively used as a delivery vector
for anticancer therapeutic small molecules and nucleic acids, and
therefore, it serves as a promising candidate for siRNA administration
in vitro and in vivo.[32,33]In the present study, we
have designed an EGFR-targeted CS vector
for delivery of siRNA to selectively silence the Mad2 gene, thereby depleting the corresponding protein expression and
studying its impact in A549 cells. PEG and EGFR-binding peptide derivatives
of CS were synthesized, characterized, and used for assembling CS–siMad2
complexes of a size less than 250 nm and a net positive surface charge.
In vitro transfection efficiency was evaluated as a function of dose
and time, and subsequent silencing activity of the siRNA was confirmed
by qRT-PCR at the gene level and flow cytometry at the protein level.
Time-dependentcytotoxicity and apoptosis assessments were also carried
out to confirm the impact of Mad2 gene silencing
on the cells.
Experimental Methods
Materials
Two
types of chitosan were used in this study.
The low molecular weight n>an class="Chemical">chitosan (LMW CS) had a viscosity average
molecular weight of 50 kDa, and the degree of deacetylation was 75–85%;
a higher molecular weight chitosan (HMWCS) had a viscosity average
molecular weight of 60–120 kDa, and the degree of deacetylation
was 80%. LMW CS and acetic acid glacial were purchased from Sigma-Aldrich
Inc. (St. Louis, MO), and HMWCS was a kindly provided by KitoZyme
S.A. (Belgium). Fluorescent dye DyLight-488 NHS ester and succinimidyl-([N-maleimidopropionamido]ethylene glycol)ester (NHS-PEG-MAL)
were purchased from Thermo Scientific (Rockford, IL). Double-stranded
siRNAs against Mad2 and nontargeting (NT) siRNA sequence were purchased
from Santa Cruz Biotechnology Inc. Amine-reactive Alexa Fluor 488
was purchased from Invitrogen/Life Technologies (Carlsbad, CA), and
a Label IT siRNA tracker kit was procured from Mirus Corporation (Madison,
WI). Pico-Green fluorescence reagent for quantification of double-stranded
nucleic acid constructs was purchased from Invitrogen/Life Technologies
(Carlsbad, CA). For Mad2 protein quantification by flow cytometry,
the antibody monoclonal anti-Mad2 clone 17D10 was obtained from Sigma
(Sigma-Aldrich, St. Louis, MO), and the secondary antibody goat anti-mouse
conjugated with Alexa Fluor 568 was from Abcam (Abcam, Cambridge,
UK).
Synthesis of Chitosan Derivatives
Both types of chitosan
were dissolved in a 2% acetic acid solution at 2 mg/mL and reacted
overnight with 10% molar equiv of maleimide–poly(ethylene glycol)–N-hydroxysuccinimide (Mal–PEG2000–NHS)
to achieve CS–PEG–Mal. The next day, the solution was
purified by dialysis (molecular weight cutoff = 10 kDa) in water,
and one-half of the amount of chitosan-PEG-Mal was used for epidermal
growth factor receptor (EGFR)-binding peptide modification. This peptide
with the following sequence, YHWYGYTPQWVI-, was originally
synthesized by Zonghai Li and co-workers and has been demonstrated
to be the most efficient in targeting the EGFR receptor.[34] We have extensively used this peptide with inclusion of four glycine
spacer terminal cysteine residues to successfully demonstrate its
targeting capability in vitro as well as in vivo in various EGFR overexpressing
tumor cells.[35−41] The peptide was obtained from Tufts University. A 2-fold molar excess
of 17-amino acid EGFR-binding peptide was added to the nanoparticle
solution at 4 °C in nitrogen atmosphere overnight to allow the
cysteine group of the peptide to react with the maleimide group. The
solution was purified by dialysis (molecular weight cutoff = 10 kDa)
in water. Glacial acetic acid was added to the dialyzed nanoparticle
solution in order to achieve a 5% concentration and then freeze-dried
and stored at −20 °C until further use. Nontargeted chitosan
derivative was similarly prepared by reaction with mPEG2000-NHS followed by acetic acid addition, dialysis, and freeze-drying.
The degree of substitution value of PEG on chitosan was estimated
by NMR analysis. For each sample, 4 mg of the lyophilized product
was dissolved in 0.7 mL of D2O and characterized by 400
MHz 1H NMR spectroscopy (Varian, Inc. CA).
Preparation
and Characterization of siRNA-Encapsulated Chitosan
Nanoparticles
Mad2 and scrambled siRNA duplexes were encapn>sulated
in CS–PEG derivatives in a molar ratio between nitrogen residues
from chitosan per nucleic acid phosphate (N/P ratio) of 25/1, 50/1,
75/1, and 100/1 CS–PEG, dissolved in water (1 mg/mL), and siRNA
dissolved in nuclease-free water was slowly added under magnetic stirring.
The solution was incubated for 30 min at room temperature to facilitate
CS–PEG and siRNA complexation and nanoparticle self-assembly
prior to use. EGFR-targeted CS–siRNA nanoparticles were prepared
using a 1:1 ratio of CS–PEG2000–peptide and
mPEG2000–CS by the same procedure as described above.The formed self-assembled nanoparticles were characterized for
size, surface charge, morphology, encapsulation efficiency, and stability
of the siRNA payload. Particle size, surface charge, and polydispersity
index (PDI) of freshly prepared siRNA-loaded chitosan (CS–siRNA)
nanoparticles were measured using a ZetaSizer Nano ZS (Malvern Instruments,
Worcestershire, UK). Each sample was analyzed in triplicate at 25
°C, and the size and zeta-potential were reported as means ±
SD. The encapsulation efficiency was determined using a Quant-iT Pico-Green
reagent (Life Technologies, Carlsbad, CA) using a microplate reader
(Bio-Tek Instruments, Winooski, VT). A standard curve based on fluorescence
emission generated from the binding of Pico-Green to known concentration
of double-stranded siRNA was created, and the loading in nanoparticles
was determined by subtracting the calculated amount of free siRNA
from the initial amount added. Encapsulation efficiency was defined
as the ratio percent of siRNA encapsulated in nanoparticles to the
total siRNA added.The morphological characterization of n>an class="Chemical">CS–siRNA
nanoparticles
was carried out under transmission electron microscopy (TEM) using
a JEOL JEM-1000 transmission electron microscope (JEOL, Tokyo, Japan).
Ten microliters of nanoparticle was dropped on a Formvar-coated copper
grid and allowed to stand for 1 min; excess fluid was drained using
a Whatman filter paper, and the sample was negatively stained with
1.5% uranyl acetate (1 min) prior to its visualization. The dark staining
of siRNA by uranyl acetate offers a high contrast compared to chitosan
that can help ascertain the loading of genes in polymeric nanosystems.
Stability of Chitosan–siRNA Nanoparticles
Stability
of chitosan–siRNA nanopn>articles against RNase digestion was
investigated. Chitosan–siRNA nanoparticles in an amount equivalent
to 2 μg of siRNA were tested. The nanoparticles were prepared
as previously described and in a N/P ratio of 50/1. Each set of particles
was in phosphate buffer at pH 7.4 and was subjected to four different
conditions: no treatment; incubated for 10 min with 5 μL of
heparin (1000 U/mL) for displacing the siRNA from the chitosan nanoparticles;
incubated with 4 μL of RNase A (20ug/mL) for 30 min at 37 °C;
and incubation with incubation 4 μL of RNase A (20ug/mL) for
30 min at 37 °C followed by heat inactivation of the enzyme and
incubation for 10 min with 5 μL of heparin (1000 U/mL). Resulting
mixtures were applied to a 4% E-Gel (Invitrogen, Carlsbad, CA), and
electrophoresis was carried for 15 min using the E-Gel iBase system.
In each gel, free siRNA was applied as a reference. The experiments
were performed in triplicate. The resulting gel was imaged on ChemiDoc
System (Bio Rad, Waltham, MA) using the software Quantity One.
Cell Culture
and Transfection
A549n>an class="Species">humanlung carcinoma
cell lines from the American Type Culture Collection (ATCC, Rockville,
MD) were cultured at 37 °C in 5% CO2 environment in
DMEM/F12 medium from Life Technologies (Carlsbad, CA). NIH-3T3mouse
embryo fibroblast cell lines were also purchased from ATCC and cultured
in DMEM (Life Technologies, Carlsbad, CA). Both cell culture media
were supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin
(100 U/mL) (Thermo Fisher Scientific, Waltham, MA). Human pulmonary
alveolar epithelial cells (HPAEpiC) were purchased from ScienCell
Research Laboratories and cultured in alveolar epithelial cell medium
as recommended by the supplier.
Approximately 80 000
cells per well were seeded in a 6-well plate culture for 24 h prior
to experiments to achieve apn>proximately 75% confluence for transfection,
and the transfection conditions were followed according to the description
in Malmo et al.[42] Briefly, fresh nanopn>articles
were assembled in water as described above and diluted with an equal
volume of Opti-MEM (Life Technologies, Carlsbad, CA), supplemented
with 270 mM mannitol (Sigma-Aldrich, St. Louis, MO) and 20 mM HEPES
(Sigma-Aldrich, St. Louis, MO). Preceding the addition of the nanoparticles,
the cells were washed and briefly incubated with Hank’s balanced
salt solution, HBSS (Life Technologies, Carlsbad, CA), at 37 °C
and 5% CO2. Next, the HBSS solution was removed and the
nanoparticles were added to each well. The transfection solution was
removed after 6 h of incubation at 37 °C and 5% CO2 and replaced by regular growth media supplemented with 10% FBS and
penicillin/streptomycin (100 U/mL).
Qualitative Analysis of
Cellular Trafficking by Confocal Microscopy
Fluorescence
confocal microscopy studies were performed in order
to assess the qualitative cellular internalization of the nanopn>articles.
Cells (200 000 cells/well) were seeded on coverslips in 6-well
plates and were allowed to attach for 24 h. After incubation for specific
periods of time, cells were washed with cold phosphate buffered saline
(PBS, pH 7.4), fixed with 4% paraformaldehyde for 20 min, washed with
cold PBS, and stained with the fluorescent DNA-binding dye Hoechst
33342 (Invitrogen, Carlsbad, CA) (1 μg/mL) for 5 min. The cells
were finally washed with cold PBS, and the coverslip was inverted
on a glass slide in mounting medium. Microscopy images were acquired
using an LSM 700 confocal microscope (Carl Zeiss, Gottingen, Germany)
equipped with 40× and 63× objectives. For each image, representative
focus planes are shown. The images were obtained using a 405 nm (5
mW) laser for Hoechst 33258 (417–477 nm emission), a 488 nm
(10 mW) laser for Alexa Fluor 488 labeled chitosan (500–550
nm emission), and a 639 nm (5 mW) laser for Cy5-siMad2 (600–650
nm). Digital images were analyzed using the NIH Image-J software.
All setting parameters for fluorescence detection and image analyses
were held constant to allow consistency in imaging of the sample for
comparison.
Quantitative Cellular Uptake Studies by Flow
Cytometry
CS was conjugated with n>an class="Chemical">amine-reactive dye Alexa
Fluor 488 (Life Technologies,
Carlsbad, CA). In order to achieve this modification, the amine-reactive
dye Alexa Fluor 488 was dissolved in DMSO (1 mg/mL) and added to an
aqueous solution of chitosan (1 mg/mL) and incubated overnight. On
the following day, the conjugate was purified by dialysis (molecular
weight cutoff = 10 kDa) in PBS pH 7.4 and freeze-dried. Simultaneously,
siRNA against Mad2 (siMad2) was labeled with Cy5 dye using the Label
IT siRNA tracker kit (Mirus Corporation, Madison, WI) according to
the manufacturer’s specifications. For flow cytometry, 200 000
cells/well cells were seeded in 6-well plates and left to attach for
24 h. Cells were then transfected with fluorescently labeled siRNA
(Cy5-siMad2) encapsulated in Alexa Fluor 488 labeled chitosan. After
specific times, the transfection solution was removed, the cells were
washed with PBS and prepared for analysis by flow cytometry.
Time-dependent cellular uptake and EGFR targeting of CS–siRNA
nanoparticles were quantitatively analyzed using a Becton Dickinson
FACS-Calibur 4 Color flow cytometer (BD Biosciences, Franklin Lakes,
NJ). The obtained data were analyzed and visualized using the Cell
Quest software (BD Biosciences, Franklin Lakes, NJ). After being incubated
with nanoparticles for specific time periods, the cells were washed
with PBS (Life Technologies, Carlsbad, CA), trypsinized, resuspended
in ice-cold PBS supplemented with 5% FBS, and kept on ice until the
time of analysis. The relative amounts of intracellular siMad2 were
evaluated in the FL-2 channel. The percentage of cellular uptake was
calculated on the basis of the geometric mean (Gm) using the following
formula:where Gmexp is the Gm of cells
in the different experimental conditions and Gmctrl is
the Gm of cells in the control condition, without treatment. The data
presented are the mean fluorescent signals from 10 000 events.
Assessment of EGFR-Specific Cellular Internalization
In
order to confirm that entry of peptide-modified CS–siRNA
nanoparticles into cells is mediated by EGF receptor targeting, competitive
inhibition study was performed in A549 cells. The cells were pretreated
for 1 h with EGFR-binding peptide (50 μg/mL) prior to exposure
with nanoparticle treatment. Simultaneously, the uptake study also
used an EGFR non-overexpressing cell line, NIH-3T3. Fluorescently
labeled siRNA, purchased from Qiagen (Venlo, The Netherlands), was
loaded into chitosan nanoparticles and was incubated with cells for
15 min. Cells were washed with 1× PBS and harvested as described
previously for flow cytometric analysis of cellular uptake. The amount
of EGFR on A549 and NIH-3T3 was determined by direct immunofluorescence
assay via 488 nm labeled EGFR antibody. Briefly, cells from both cell
lines were harvested and washed with ice cold PBS, 10% FBS, 1% sodium
azide, and resuspended in 3% BSA/PBS solution. The 488 nm labeled
EGFR antibody was added to a final concentration of 20 μg/mL.
After a 2 h incubation, cells were washed with ice cold PBS, 10% FBS,
1% sodium azide, and resuspended in the same solution followed by
flow cytometric analysis.
Determination of In Vitro Gene-Silencing
Efficiency
In vitro gene silencing was assessed by qRT-PCR.
Cells were transfected
with differentsiMad2 concentrations and incubation periods as described
above. At the time of analysis, cells were collected and total RNA
was extracted using a GeneJET RNA purification kit (Thermo Scientific,
Tewksbury, MA) according to the manufacturer’s recommendations.
RNA concentration was determined by spectrophotometry using NanoDrop
2000c (Thermo Scientific, Tewksbury, MA). For each sample, 0.5 μg
of total RNA was used for cDNA synthesis, and the reverse transcription
reaction was performed with a Verso cDNA synthesis kit (Thermo Scientific,
Tewksbury, MA) according to the manufacturer’s instructions.Real-time polymerase cn>an class="Chemical">hain reaction (qPCR) was performed with the
LightCycler 480 SYBR Green I Master kit (Roche, Basel, Switzerland),
and housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH)
was used as the endogenous control. The sequences of the primers used
in this work were as follows: Mad2 forward (GTGGAACAACTGAAAGATTGGT),
Mad2 reverse (GTCACACTCAATATCAAACTGC),
GAPDH forward (ACAGTCAGCCGCATCTTC),
and GAPDH reverse (GCCCAATACGACCAAATCC).
Two microliters of the cDNA was used to evaluate Mad2 expression levels.
qPCR steps included a preincubation step for 5 min at 95 °C,
followed by 40 cycles of three steps: 10 s at 95 °C, 20 s at
60 °C, and 30 s at 72 °C. The threshold cycle (Ct) values were generated automatically by the LightCycler
480 software, version 1.5, and the comparative method for mRNA level
quantification was calculated according to the following formulas:Normalized target gene expression level =
2(−ΔΔ, where Ct is the threshold cycle.
Determination of Mad2 Protein Expression Levels by Flow Cytometry
Cell suspensions from different treatments were collected and fixed
with 4% formaldehyde for 10 min at room temperature. After being pelleted,
the cells were permeabilized with a 0.3% Triton-X solution for 7 min
at room temperature. After blocking nonspecific antigens with a PBS
solution containing 10% FBS, we incubated the cells for 2 h in the
primary antibody solution, 4 μg/mL mouse anti-Mad2 in PBS. After
three washing steps with PBS, cells were stained with secondary antibody,
anti-mouse conjugated with Alexa 568, in a concentration of 2 μg/mL
in PBS for 30 min. After two washing steps, cells were resuspended
in 500 μL of PBS and analyzed by flow cytometry.
Cell Viability
Analysis
The toxicity of the siRNA-loaded
and blank nanopn>articles was assessed using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide) assay. Cells were seeded in 96-well plates at a density of
2500 cells/well and were allowed to attach overnight. Then, the cells
were washed, and 100 μL of the nanoparticle solution was added
to each well (n = 8), incubated at 37 °C for
6 h, and followed by replacement of the solution with complete growth
medium. At the specific time points, the medium was renewed with fresh
complete medium containing 100 μL of 0.5 mg/mL MTT (Sigma-Aldrich,
St. Louis, MO). Two hours after incubation, the medium was replaced
by dimethyl sulfoxide (DMSO) to stop the reaction and lyse the cells.
Untreated A549 served as a negative control. Absorbance of the solution
was measured at 560 nm, and the IC50 was calculated using
GraphPad Prism software.
Results
Characterization of siRNA-Encapsulated
CS Nanoparticles
The grafting of Mal–PEG2000–NHS onto chitosan
was confirmed by 1H NMR spectroscopy, and the degree of
PEG modification was found to be approximately 10% for both LMW and
HMW derivatives (Supporting Information, Figure SI 1). NMR spectra of Mal–PEG2000–NHS
show characteristic peaks for methylene protons between 3.5 and 3.7
ppm and a distinct peak at 6.9 for the protons corresponding to the
ring protons of the maleimide functional group. The peaks related
to the protons on carbon at the α position to the carboxylic
group and NHS group are present between 2.5 and 3.0 ppm (Figure SI 1A). The peaks corresponding to protons
on the chitosanpolymer backbone span between 1.8 and 5.0 ppm, and
thus several peaks between PEG and CS overlap in that region (Figure SI 1C). Chitosan derivatives were characterized
by a new signal at δ = 2.40 ppm, which was attributed to the
oxyethylene group present in the copolymer. The unique peak for the
maleimide group at 6.9 from Mal–PEG–NHS and for CS at
2 ppm was used to calculate the total PEG modification on the CS backbone
(Figure SI 1D), which was found to be
10%. Further reaction of the PEG–CS derivatives with the EGFR-binding
peptide leads to the disappearance of the maleimide peak at 6.9 and
the peaks in the range of 6.8–7.3 ppm corresponding to the
protons from peptide appears (Figure SI 1B), confirming the successful formation of EGFR-binding peptide-modified
PEG–CS for both low (Figure SI 1E) and high (Figure SI 1F) molecular weight
CS. NMR analysis could not be used to calculate the exact concentration
for EGFR modification on Mal–PEG–CS. However, since
the PEG modification was found to be 10% and because the concentration
of EGFR-binding peptide used for the grafting to the maleimide group
was 2-fold higher, we assume that 100% of maleimide groups were modified.The mPEG and pepn>tide–PEG derivatives of LMW and HMWCS were
complexed with Mad2 siRNA to form the nontargeted (NT-LMW and NT-HMW)
and EGFR-targeted (T-LMW and T-HMW) nanoparticles, respectively. We
first optimized the siRNA loading efficiency of CS derivatives as
a function of N/P ratio. The siRNA loading was found to be nearly
100% for the formulations with N/P ratio of 50/1, 75/1, and 100/1
(Figure SI 2A). However, the subsequent
size and charge analysis of these formulations demonstrated that CS–siRNA
complexes at a N/P ratio of 50/1 give not only optimum loading but
also adequate size (<300 nm) for gene delivery application (Figure SI 2B,C) and were therefore used for all further
experiments. The sizes of the four chitosan/siRNA nanoparticles were
measured by dynamic light scattering and were found to be in the range
of 100–250 nm (Table 1). The nanoparticles
formed with LMW CS were characteristically smaller in size compared
to those formed using the corresponding HMWCS polymer, suggesting
that the polymer chain length plays a role in the size of the nanoparticle
assembly. Most importantly, addition of EGFR-binding peptide to the
polymer leads to a significant increase in the nanoparticle size.
This could be due to the change in the net positive charge of the
chitosan, leading to a decrease in the particle packing density, although
the ability to bind and encapsulate siRNA remains the same. That indeed
appears to be true since the zeta-potential measurement for the NT-LMW
nanoparticle was 33.6 ± 3.5 mV, which decreased to 28.3 ±
2 mV for the T-LMW nanoparticles, suggesting a net decrease in positive
charge. The zeta-potential of the HMWCS–siRNA nanoparticles
also showed a similar trend confirming that peptide modification reduces
the net positive charge of CS, thereby affecting its interaction with
negatively charged siRNA and rendering a larger size for targeted
nanoparticles. The PDI values for the chitosan nanoparticles decreased
with the addition of the EGFR peptide for both chitosan molecular
weights.
Table 1
Particle Size, Polydispersity Index,
Zeta-Potential, and siRNA Encapsulation Efficiency of Chitosan/siRNA
Nanoparticles at a NP Ratio of 50
chitosan
chitosan
deacetylation degree (%)
size (nm)
± SD
PDI ±
SD
zeta-potential
(mV) ± SD
encapsulation
efficiency (%)
NT-LMW
75–85
106.8 ± 2.1
0.551 ± 0.10
+35.6 ± 3.5
105.1 ± 4
T-LMW
75–85
227.3 ± 1.8
0.362 ± 0.02
+28.3 ± 2.0
99.5 ± 2.4
NT-HMW
78
173.1 ± 1.3
0.672 ± 0.03
+42.8 ± 2.4
101.6 ± 2.3
T-HMW
78
257.1 ± 3.1
0.421 ± 0.01
+13.9 ± 2.9
97.5 ± 3.3
In order to analyze if the change in the net charge of CS leads
to a change in siRNA loading efficiency of the targeted formulations,
siRNA encapsulation efficiency of all the formulations was assessed.
The siRNA loading efficiencies of all the nanoparticle systems were
found to be 100% irrespective of the difference in CS composition
or molecular weight. This observation confirmed that even though the
presence of the peptide affects the assembly of the nanoparticle,
it does not have any impact on the loading efficiency and peptide-modified
PEG–CS could still encapsulate siRNA efficiently despite the
charge compensation.Transmission electronic microscopy was
used to examine the morphologies
of the differentCS–siRNA nanoparticle formulations (Figure 1). The images of nontargeted CS–siRNA nanoparticles
demonstrate a more linear, pendant-like structure, showing a compact
packing of CS around the siRNA (Figure 1A,C).
The negative stain used for visualization of the particles seems to
intercalate in the siRNA to give a dark contrast. On the contrary,
the targeted nanoparticles with both types of CS complexed to siRNA
show larger particle size, confirming the observation made from the
DLS measurement (Figure 1B,D). The particle
size from the TEM images corresponded well with the size obtained
from the DLS measurement for different nanoparticle formulations.
Figure 1
TEM image
of chitosan/siRNA nanoparticles at a NP ratio of 50:
(A) NT-LMW, (B) T-LMW, (C) NT-HMW, and (D) T-HMW. Scale bar in all
images corresponds to 100 nm.
TEM image
of chitosan/siRNA nanopn>articles at a Nn>an class="Chemical">P ratio of 50:
(A) NT-LMW, (B) T-LMW, (C) NT-HMW, and (D) T-HMW. Scale bar in all
images corresponds to 100 nm.
Stability Against RNase Digestion
siRNA degradation
is one of the most important barriers for siRNA delivery. Considering
that it is associated with loss of activity and therapeutic effect,
we have evaluated the protection effect of different siRNA/chitosan
derivative complexes against RNase digestion (Figure 2). As expected, free siRNA was degraded completely in the
presence of RNase A, while the presence of heparinhad no effect on
its stability. On the other hand, siRNA, which was incorporated in
chitosan particles, remained intact. This result clearly showed the
ability of CS derivatives to protect siRNA from enzymatic degradation.
Figure 2
RNase
stability of siRNA in the CS/PLA/siRNA complexes. Free siMad2
was a negative control. The complexes were incubated with RNase A
(5 mIU/μg siRNA) at 37 °C for 2 h. The reaction was inactivated
at 70 °C, and the siRNA was released after incubation for 10
min with 5 μL of heparin (1000 U/mL). Resulting mixtures were
analyzed by 4% agarose gel electrophoresis.
RNase
stability of siRNA in the CS/n>an class="Chemical">PLA/siRNA complexes. Free siMad2
was a negative control. The complexes were incubated with RNase A
(5 mIU/μg siRNA) at 37 °C for 2 h. The reaction was inactivated
at 70 °C, and the siRNA was released after incubation for 10
min with 5 μL of heparin (1000 U/mL). Resulting mixtures were
analyzed by 4% agarose gel electrophoresis.
Qualitative Analysis of Nanoparticle Uptake and Cellular Trafficking
Fluorescence confocal microscopy was employed to visualize the
qualitative intracellular uptake of nontargeted and EGFR-targeted
CS–siRNA nanoparticles in A549 as a function of time. Intracellular
uptake was analyzed at 15, 30, and 60 min for the nontargeted and
targeted CS–siRNA nanoparticles at a siRNA concentration of
50 nM. CS was labeled with green fluorescentAlexa Fluor 488, while
siMad2 was labeled with red fluorescentCy5 dye prior to nanoparticle
formation. Figure 3 shows the confocal images
for uptake of nontargeted and targeted LMW CS nanoparticles in A549
cells. The images taken after 15 min incubation with the nontargeted
and targeted nanoparticles clearly show that, while targeted nanoparticles
show internalization, no evident uptake is shown by the nontargeted
system. Nontargeted nanoparticles show internalization at 30 min,
which confirms that the EGFR-targeting peptide modification of the
PEG–CS nanoparticles facilitates an early uptake by receptor-mediated
endocytosis. Most importantly, in both cases, green and red fluorescence
colocalized on some of the nanoparticles attached to the cellular
membrane and inside the cytoplasm, but the majority of red fluorescence
(siRNA tag) was rapidly detected in the nucleus. Similar results were
also obtained for the nontargeted and targeted HMWCS nanoparticles
(data not shown). The untreated control cells as well as cell labeled
with unlabeled nanoparticle did not show any background autofluorescence
(data not shown).
Figure 3
Cell uptake and intracellular trafficking of siMad2-Cy5
encapsulated
in chitosan nanoparticles modified with Alexa Fluor 488. Similar results
were obtained for 90 kDa chitosan. The concentration of siMad2-Cy5
was 50 nm. Cell nuclei were counterstained with Hoechst 33258 (blue).
The column on the right consists on the merge of the fluorescence
images and the phase images. Scale bar = 10 μm.
Cell uptake and intracellular trafficking of n>an class="Chemical">siMad2-Cy5
encapsulated
in chitosan nanoparticles modified with Alexa Fluor 488. Similar results
were obtained for 90 kDa chitosan. The concentration of siMad2-Cy5
was 50 nm. Cell nuclei were counterstained with Hoechst 33258 (blue).
The column on the right consists on the merge of the fluorescence
images and the phase images. Scale bar = 10 μm.
Quantitative Cellular Uptake by Flow Cytometry
In order
to ascertain the trend of nanoparticle uptake shown by confocal images
and to get a quantitative estimate of intracellular uptake, A549 cells
treated with fluorescently labeled nontargeted and targeted nanoparticles
in a time-dependent manner were analyzed by flow cytometry. The fluorescence
intensity for all of the samples was normalized to the untreated control
A549NSCLC cells. Figure 4 shows the quantitative
relative uptake of Cy5-labeled siRNA as a function of time for the
different samples where the T-LMW and T-HMW nanoparticles show significantly
higher uptake compared to the respective nontargeted nanoparticles,
confirming the trend observed by confocal imaging. Besides, cells
show nearly 5-fold increase in fluorescence intensity after 15 min
of incubation with NT-LMW and T-LMW nanoparticles, indicating that
targeted nanoparticles indeed are rapidly internalized by the cells
by receptor-mediated endocytosis and confirmed the much higher uptake
shown by confocal imaging. We also analyzed uptake after 5 min of
incubation of nanoparticles to see the targeting efficiency of the
EGFR-binding peptide, and the results obtained clearly show that T-LMW
nanoparticles give better fluorescence intensity after 5 min than
NT-LMW nanoparticles after 1 h of incubation. Flow cytometry data
also confirmed that LMW CS nanoparticles are more readily internalized
by the cells in comparison to the HMWCS nanoparticles. T-LMW nanoparticles
show a 312% increase in the relative fluorescence after 60 min on
incubation, while the T-HMW nanoparticles show 176% increase in the
fluorescent intensity under similar experimental conditions.
Figure 4
Quantitative
relative intracellular uptake study of nontargeted
and targeted siRNA-loaded CS nanoparticles by flow cytometry in the
A549 cell line. Data are shown as mean ± SD (n = 3).
Quantitative
relative in>an class="Chemical">ntracellular uptake study of nontargeted
and targeted siRNA-loaded CS nanoparticles by flow cytometry in the
A549 cell line. Data are shown as mean ± SD (n = 3).
Evaluation of Targeted
Receptor Internalization
EGF
is internalized by ligand-induced recepn>tor-mediated uptake.[43] In order to confirm that higher uptake, better
cytotoxicity, and enhanced siRNA efficacy of EGFR-targeted chitosan
nanoparticles are due to receptor-mediated endocytosis, the uptake
of fluorescently labeled siRNA-containing nanoparticles was evaluated
in a series of experiments. One of the strategies adapted was to block
the EGFR receptors on the surface of A549 cells by exposing them to
excess EGFR-binding peptide. Cells were preincubated with free EGFR-binding
peptide for 1 h prior to exposing them to the targeted system, and
the nanoparticle uptake was quantitatively determined by FACS (Figure 5). The uptake of the targeted systems significantly
decreased when cells were preincubated with free EGFR-binding peptide,
suggesting that the targeted nanoparticles show better uptake due
to receptor-mediated endocytosis. After 15 min of incubation with
nanoparticles, A549 showed a decrease in uptake from 47 to 13% for
T-LMW and 36 to 11% for T-HMW. Concomitantly, we also studied the
uptake of targeted siRNA-loaded nanoparticles in NIH-3T3 fibroblast
cells, a low-expressing EGFR-expressing cell line.[44] To determine the expression level of EGFR by A549 and NIH-3T3
cells, the binding of anti-EGFR antibody to the cells was quantified
using flow cytometry (Figure SI 3). The
variation in the fluorescence intensity of A549 after incubation with
anti-EGFR antibody was considerably higher than the variation in NIH-3T3
cells, proving a much higher expression of EGFR on A549 than NIH-3T3
cells. The nanoparticle uptake by NIH-3T3 cells was found to be roughly
the same irrespective of the presence or absence of targeting ligand,
further cementing that the enhanced uptake of targeted particles in
A549 cells is due to the receptor-mediated endocytosis.
Figure 5
Quantitative
relative intracellular uptake study collected by flow
cytometry of nontargeted and targeted siRNA-loaded CS nanoparticles
in A549 and NIH-3T3 cell lines at 37 and 4 °C and a 50 nM siRNA
concentration. Data collected refers to a 15 min incubation period.
Data are shown as mean ± SD (n = 3); ***P < 0.001.
Quantitative
relative in>an class="Chemical">ntracellular uptake study collected by flow
cytometry of nontargeted and targeted siRNA-loaded CS nanoparticles
in A549 and NIH-3T3 cell lines at 37 and 4 °C and a 50 nM siRNA
concentration. Data collected refers to a 15 min incubation period.
Data are shown as mean ± SD (n = 3); ***P < 0.001.
Receptor-mediated endocytosis is an energy-dependent process,
and
so we also performed a nanopn>article uptake study at 4 °C, where
recepn>tor-mediated uptake will be the minimum. Indeed, the uptake of
targeted systems is dramatically low at 4 °C compared to that
when the cells were maintained at 37 °C. Nanoparticle uptake
was lower for all treatments at 4 °C; the decrease was, however,
statistically significant only in the case of the targeted LMW and
HMW nanoparticles. It is also noteworthy that the net uptake upon
blocking of the EGFR, using a EGFR non-expressing cell line or performing
the study at 4 °C, is the same, indicating conclusively that
the presence of EGFR-binding peptide on the nanoparticles facilitates
receptor-mediated endocytosis. It is important to understand that
these data cannot be compared to the results represented in Figure 4 because the percent labeling of the siRNA was different
for that experiment.
Optimization of EGFR Peptide Density on Nanoparticles
for Specific
Cellular Uptake
The density of the EGFR-binding pepn>tide on
the surface could be a key parameter to impact the net uptake of the
nanopn>articles by the cells. Peptide-modified PEG–CS (10% modification)
was blended at 0, 25, 50, 75, and 100% (w/w) to the mPEG-modified
CS to vary total peptide content of the nanoparticles and was subsequently
tested for uptake in A549 cells as a function of incubation time (Figure SI 4). The cellular uptake profile of
nanoparticles with EGFR targeting at 50% or higher concentrations
showed almost identical uptake behavior at all time points up to 60
min of incubation. A 50–50 blend of peptide-modified PEG–CS
and mPEG-modified CS was, therefore, chosen for all subsequent experiments
with targeted nanoparticles.
In Vitro Mad2 Gene Silencing
in A459 NSCLC
Cells
qRT-PCR was used to evaluate the ability of different
formulations to silence the expression of Mad2 gene
in A549 cells. Mad2-specific mRNA expression was
quantified in a dose- and time-dependent manner after treatment with
nontargeted and EGFR-targeted CS nanoparticles. A N/P ratio of 50:1
was used for all of the experiments, and lipofectamine, a cationic
lipid transfection reagent-complexed siRNA, was used as a positive
control. The dose-dependent gene silencing with varying siRNA concentrations
ranging from 5 to 50 nM was tested after 48 h of incubation with cells,
as shown in Figure 6A. Concentrations below
20 nM did not show a significant change in the Mad2 expression levels in any of the treatment groups. The gene-silencing
effect was significantly improved at 30 nM dose of siRNA, where nontargeted
LMW and HMW nanoparticles show 73 ± 2 and 74 ± 7% decreases
in the gene expression. However, the silencing effect was more dramatic
with EGFR-targeted nanoparticles, which showed 39 ± 6 and 53
± 4% gene silencing for T-LMW and T-HMW nanoparticles, respectively. Mad2 expression shows a substantial decrease when the A549
cells were treated with 50 nM of siRNA loaded in CS nanoparticles
with 4 ± 2% for NT-LMW, 1 ± 3% for T-LMW, 9 ± 3% for
NT-HMW, and 1 ± 2% for T-HMW nanoparticles.
Figure 6
Down-regulation of Mad2
expression by siMad2-loaded nontargeted
and targeted CS nanoparticles in the A549 cell line: (A) dose-dependent
gene silencing 48 h postdosing and (B) time-dependent gene silencing
with 50 nM siMad2 administration. The N/P ratio for all formulations
was 50:1. Data are shown as mean ± SD (n = 3);
**P < 0.01; ***P < 0.001.
Down-regulation of Mad2
expn>ression by n>an class="Chemical">siMad2-loaded nontargeted
and targeted CS nanoparticles in the A549 cell line: (A) dose-dependent
gene silencing 48 h postdosing and (B) time-dependent gene silencing
with 50 nM siMad2 administration. The N/P ratio for all formulations
was 50:1. Data are shown as mean ± SD (n = 3);
**P < 0.01; ***P < 0.001.
Dose-dependent study showed an
efficient gene silencing at 50 nM
concentration of siMad2 loaded in all formulations, and therefore,
the same concentration was chosen to evaluate a time-dependent gene-silencing
profile of the formulation with lipofectamine as the positive control
(Figure 6B). Lipofectamine-loaded siMad2 effectively
decreases Mad2 expression level to 10 ± 1% within
12 h of dosing with a significant and sustained silencing efficiency
until 96 h. However, the Mad2 expression level starts
to revive at later time points of 120 and 144 h, which could be due
to the continued growth and proliferation of nontransfected cells
leading to a higher expression level of the gene. On the contrary,
treatment with nontargeted and targeted siRNA-loaded CS nanoparticles
not only showed an efficient silencing effect at early time points
but also showed a sustained silencing effect at the later time periods
unlike lipofectamine. Mad2 expression levels 144
h post-transfection were 5 ± 3, 3 ± 8, 8 ± 5, and 5
± 6% for NT-LMW, T-LMW, NT-HMW, and T-HMW, respectively. In contrast,
lipofectamine-mediated siRNA delivery led to 26 ± 1 and 27 ±
5% expression of the Mad2 at 120 and 144 h, respectively,
indicating that CS nanoparticles serve as a more potent delivery system
with an efficient and sustained gene-silencing effect.
Determination
of Mad2 Protein Levels in A549 NSCLC Cells
Flow cytometry
was used to further investigate the effect of Mad2 gene silencing on the n>an class="Gene">Mad2 protein level in A549 cells
after treatment with CS–siMad2 nanoparticles (Figure 7). A549 cells were exposed to 50 nM of siMad2 loaded
in CS nanoparticles, and the protein levels were evaluated up to 72
h post-transfection. The level of Mad2 protein does not show any significant
difference after 24 h post-transfection, and the relative protein
content was found to be equivalent to the untreated control. Mad2
protein content 48 h post-transfection, however, shows a dramatic
decrease in all the cells treated with CS–siMad2 nanoparticles
with 19 ± 4, 17 ± 5, 6 ± 2, 35 ± 1, and 23 ±
4% lipofectamine for NT-LMW, T-LMW, NT-HMW, and T-HMW respectively.
Incubation for 72 h in different formulations further led to a decrease
in the Mad2 protein level, which is consistent with the Mad2 mRNA expression levels observed by qRT-PCR (Figure 6B).
Figure 7
Mad2 protein levels in A549 cells. A549 cells were incubated with
50 nM of siMad2 encapsulated in PEG-modified chitosan nanoparticles
and EGFR-targeting peptide-modified chitosan nanoparticles, using
a NP ratio in all the cases of 50:1. Data are shown as mean ±
SD (n = 3).
Mad2protein levels in n>an class="CellLine">A549 cells. A549 cells were incubated with
50 nM of siMad2 encapsulated in PEG-modified chitosan nanoparticles
and EGFR-targeting peptide-modified chitosan nanoparticles, using
a NP ratio in all the cases of 50:1. Data are shown as mean ±
SD (n = 3).
Cell Viability Analysis with siRNA-Encapsulated CS Nanoparticles
We further conducted cytotoxicity assessment of CS derivatives
alone and loaded with siMad2 to study the biocompatibility of the
delivery material in A549. MTT assay with differentCS derivatives
revealed that these derivatives by themselves did not show any apparenttoxicity to both the cell lines even after long periods of incubation
at the same concentration used for all of the in vitro studies (Figure SI 5). Previous studies have shown that
chitosan is an attractive polymer for gene delivery due to several
characteristics including its excellent biocompatibility, low toxicity,
and low immunogenicity.[45] It has been demonstrated
that chitosan only exhibited significantcytotoxicity at concentrations
higher than 0.741 mg/mL, which is 7 times higher than the concentration
used in this study.[46] SiMad2-loaded CS
nanoparticles on the other hand showed severe cytotoxicity in A549
after 48 h of incubation and kept this trend throughout until 120
h of the study, where the cell viability for all nanoparticles was
around 25% (Figure 8A). These results clearly
indicate that any cytotoxicity effect elicited by the CS nanoparticles
is due to the contribution of the siMad2 and that CS derivatives are
highly biocompatible and nontoxic. In order to evaluate the cytotoxicity
of CS–siMad2 nanoparticles in EGFR non-expressing, noncancerous
cells, a human lung primary cell line, HPAEpiC, was used (Figure 8B). All different nanoparticle formulations showed
a delayed cytotoxic effect in HPAEpiC when compared to A549 cells.
Only after 72 h post-treatment did the chitosan nanoparticles trigger
a significant change in HPAEpiC cell viability, while in A549, the
effect was visible after 48 h. Interestingly, the cytotoxic effect
of the nontargeted and targeted nanoparticles is similar in the primary
cells, indicating a similar uptake level, which would be expected
because these cells do not overexpress EGFR. Besides, the effect of
the treatments was much milder in the primary cells compared to that
in the tumor cells at the corresponding incubation periods.
Figure 8
Time-dependent
cytotoxicity studies in (A) A549 cells and (B) HPAEpiC
upon incubation with 50 nM of siMad2 loaded in CS derivatives. Data
are shown as mean ± SD (n = 3); **P < 0.05; **P < 0.01; ***P < 0.001.
Time-dependentn>an class="Disease">cytotoxicity studies in (A) A549 cells and (B) HPAEpiC
upon incubation with 50 nM of siMad2 loaded in CS derivatives. Data
are shown as mean ± SD (n = 3); **P < 0.05; **P < 0.01; ***P < 0.001.
Cellular Apoptosis Studies
with siRNA-Encapsulated CS Nanoparticles
In order to evaluate
the mechanism of n>an class="Chemical">siMad2-induced cell toxicity
in A549 cells and confirm that the observed cell death is through
an apoptotic pathway, we performed an Annexin V–propidium iodide
assay using flow cytometry (Figure 9). Annexin
V conjugated to FITC specifically stains phosphatidylserine that translocates
from the inner side to the outer surface of the plasma membrane in
apoptotic cells. After 48 h post-transfection with T-LMW nanoparticles
loaded with siMad2, 58 ± 5% cells exhibited positive Annexin
V staining, indicating apoptotic cell population. Treatment with other
formulations including lipofectamine shows only 35% apoptotic cell
population under similar conditions, which corroborates the cytotoxicity
results (Figure 8). The apoptotic cell population
increased further after 72 h post-transfection, where T-LMW shows
nearly 87 ± 7% Annexin V positive cells while treatment with
other formulations showed a lower increase in population. This study
ascertains that cytotoxicity mediated by siMad2 administration is
due to induction of an apoptotic pathway in the cells.
Figure 9
Apoptosis assay using
Annexin V–PI staining after exposure
of A549 cells to 50 nM siMad2 loaded in CS nanoparticles and lipofectamine
as the positive control. Data are shown as mean ± SD (n = 3).
Apoptosis assay using
pan class="Gene">Annexin V–n>an class="Chemical">PI staining after exposure
of A549 cells to 50 nM siMad2 loaded in CS nanoparticles and lipofectamine
as the positive control. Data are shown as mean ± SD (n = 3).
Discussion
Mad2
protein is a key component of the mitotic checkpoint and a
tumor suppressor gene. Its knockdown leads to extensive cell death
as a consequence of mitosis failure mainly due to premature mitotic
exit.[7,17,18] Therefore,
modulating the expression of the Mad2 gene and subsequently
reducing the Mad2 protein translation specifically in cancerous cells
could be a promising anticancer strategy. siRNA therapy particularly
has shown tremendous promise in selectively down-regulating the activity
of a gene of interest.In order to enhance siRNA delivery specifically
for efficientMad2 gene silencing in A549NSCLC cells,
we have developed
an EGFR-targeted and nontargeted chitosan nanoparticle complex for
delivery of siMad2 for application in lung cancer therapy. Cancer
cells overexpress several receptors on their surface to increase the
uptake of nutrients and growth factors to meet their incessant demand.
EGFR is one such surface receptor that has been long known to overexpress
on the surface of a majority of cancer tumors and has been intensively
studied and characterized in lung cancer.[2,47,48] Humanlung adenocarcinomaA549 cells, in
particular, have been reported to overexpress the EGFR receptor on
their surface and have shown a sensitivity to anti-EGFR therapies.[49] Targeting EGFR therefore serves as a logical
approach, and to this end, we derivatized the CS backbone with heterobifunctional
PEG to subsequently bind the EGFR-binding peptide, while the nontargeted
nanoparticle system was developed using methoxy-PEG modification.
The use of EGFR antibody was avoided due to its larger size compared
to the EGFR-binding peptide, which often contributes to steric resistance
in conjugating to the nanoparticles’ surface and also due to
its limited diffusion in tissues.[50] Particle
size measurement reveals that mPEG-modified nontargeted CS–siMad2
nanocomplexes were in the size range of 100–175 nm depending
on the molecular weight of the CS, where lower molecular weight CS
gives smaller average particle size compared to high molecular weight
CS (Table 1). SubsequentEGFR-binding peptide
modification of CS prior to complexation with siMad2 leads to an increase
in the net average particle size from 106.8 to 227.3 nm for LMW CSand 173.1 to 257.1 nm for HMWCS samples. This increase in the particle
size could be attributed to the peptide modification of CS, which
leads to a decrease in the net positive charge on the polymer, thereby
affecting the complexation with the negatively charged siMad2. Zeta-potential
measurement indeed confirms that peptide-modified nanoparticles show
a decrease in the net surface charge for both LMW and HMW formulations
(Table 1), which would affect the nanoparticle
packing in the presence of siRNA even though the encapsulation efficiency
remains unaltered as demonstrated by similar siRNA loading profile.
CS nanoparticle size upon condensation with siRNA has been studied
as a function of the molecular weight of the polymer, and the particle
size observed by us is in agreement with that in previously reported
literature.[28]A difference in the
nanoparticle size could result in differential
uptake characteristics and siRNA release profile, especially since
the size difference between nontargeted and targeted LMW CS nanoparticles
is dramatically large. In this regard, one would expect a lower intracellular
uptake of large-sized particles due to limited diffusion capability.[51] However, on the contrary, all of our experiments
suggest that targeted nanoparticles, which are significantly larger,
show greater intracellular uptake, suggesting that any size-dependent
limitation in uptake is efficiently overcome by targeting the EGFR
receptor. Besides, the siRNA efficacy of targeted nanoparticles shows
marked improvement over respective nontargeted nanoparticles at all
studied time points, indicating that change in nanoparticle size does
not affect the siRNA release or activity in any manner.The
siRNA-mediated silencing at gene and protein levels clearly
indicated that the EGFR-targeted nanoparticles outperformed their
corresponding nontargeted systems and that the LMW CS nanoparticles
had better activity than the corresponding HMWCS nanoparticles. As
with studying any cell-specific targeted system, it is pertinent to
establish that the better activity of targeted nanoparticles is associated
with increased intracellular accumulation due to receptor-mediated
endocytosis. A series of experiments to study the uptake of the EGFR-targeted
system in EGFR non-expressing cells, selective blocking of the receptor
by a target peptide, and mitigating receptor-mediated endocytosis
by performing the study at 4 °C conclusively proved that the
enhanced intracellular uptake and subsequent great siRNA activity
shown by the targeted system indeed are a result of EGFR targeting.Qualitative intracellular uptake studies of all the nanopn>article
systems revealed another interesting phenomenon that is usually uncommon
with siRNA delivery. Confocal images indicate that the delivery siRNA
localizes in the nucleus of the cells especially at later time points,
while chitosan remains in the cytoplasm throughout the course of our
chosen experimental time points (Figure 3).
Such an observation is unusual especially since the RNAi mechanism
is known to occur in the cytoplasm where mRNA is mostly found; however,
it is not entirely surprising because several other previous studies
have reported the same behavior of siRNA.[52,53] It has also been shown that, by diffusion into the nucleus and subsequent
export out of the nucleus by Exportin-5, siRNAs can shift between
the cytoplasm and the nucleus in a sequence-dependent way.[52−55] The exact mechanism that leads to the localization of siRNA in the
nucleus is not well-understood, but it was important to understand
whether this property is imparted by the delivery system or is governed
by the siRNA itself. To discern this rather intriguing observation
further, we repeated the same study with scrambled siRNA, keeping
the delivery system unaltered (data not shown), and we did not detect
localization of the scrambled siRNA in the nucleus. It is therefore
safe to assume that the nuclear localization of siMad2 is not related
to the chitosan-based delivery system but is possibly due to the sequence-specific
siRNA property.Several siRNA-loaded delivery vectors are efficiently
internalized
into the tumor cells but do not show any activity since they fail
to escape endosomes and successfully deliver the payload into the
cytoplasm. Chitosan as a positively charged biodegradable polymerhas been extensively studied specifically for nucleic acid delivery
because it can complex with these negatively charged biomolecules.[28] However, several key characteristics of the
polymer can influence its in vitro and in vivo performance. Molecular
weight of the polymer, for example, can have an impact on the nucleic
acid complexation efficiency and subsequent protection. Low molecular
weight CS (<10 kDa) shows poor siRNA condensation, whereas intermediate
MW CS (<80 kDa) has shown a complete and efficient encapsulation.[56,57] Thus, the MW of CS can greatly impact the size of the nanoparticles
(Table 1) as well as the stability of the encapsulated
siRNA.[28] We therefore checked the ability
of our nanoparticle system to protect the siRNA payload in the presence
of RNase, and the studies clearly indicate that the 50 and 90 kDa
CS polymers could effectively shield the siRNA from enzymatic activity
(Figure 2).Activity of the siRNA can
also be influenced by the choice of CS
where delivery using higher molecular weight polymers tends to show
better efficacy of the payload.[57] High
silencing activity of siMad2 at gene and protein levels affirmed that
the CS delivery vector not only protects the payload from degradation
but is also able to release them timely to show activity in vitro.
However, the molecular weight of the polymer alone cannot entirely
govern the nanoparticle performance because our results clearly indicate
that the 50 kDa polymer formulation shows better activity compared
that of the 90 kDa polymer formulation. Lipofectamine, a commonly
used cationic lipid transfection agent, was used as a positive control,
which generated a boost effect on gene silencing, but failed to provide
a sustained silencing effect over time.[58] CS nanoparticle-mediated delivery, on the other hand, serves as
a sustained source of siMad2 in the cells to achieve effective silencing
activity for a significantly longer period compared to the positive
control (Figure 6). Biological activity of
any siRNA is directly related to its release from the carrier, which
in turn can be influenced by nanoparticle carrier size, interaction
with the payload, stability, etc. It was previously demonstrated that
CS molecular weight can impact the biological activity where changing
the polymer from 20 to 40 or 80 kDa changed the net activity from
60 to 70%.[57]Reduction in the level
of the Mad2 protein results in premature
mitotic exit, multinucleation, and apn>opn>tosis-induced cell death.[7,17,18] It was therefore relevant to
assess if silencing the Mad2 gene and subsequent
protein expression inflicts any cytotoxic effect on the cells. A time-dependent
study with a 50 nM dose of siMad2-loaded CS derivatives in A549 cells
demonstrated higher cytotoxicity as a function of increased incubation
time post transfection (Figure 8). All formulations
loaded with siMad2 start to show cytotoxic effects around 48 h post-transfection,
which correlates extremely well with the Mad2 protein levels in A549
cells with an identical dose of siRNA (Figure 7). Most importantly, blank CS derivatives did not cause any toxicity
to the cells (Figure SI 5), thus confirming
that the observed cytotoxicity from siMad2-loaded CS nanoparticles
is due to siMad2 activity. It has been well-documented that depletion
of Mad2 protein level leads to apoptosis-mediated cell death (Figure 9).[17,18]The human lung primary
cell line, HPAEpiC, was used as an example
of nontumorhuman lung primary cell line to evaluate the toxicity
profile of the formulation and assess a therapeutic window. The primary
alveolar cell line was used to emphasize the two major differences
between nontumor cells and the tumor cells: (i) nontumor cells have
a much lower proliferation rate. Since the mitotic checkpoint proteins
such as Mad2 are only needed during cell division, its abolition would
selectively affect proliferating tissues; therefore, cancer cells
with high cell proliferation rate would be much more prone to anti-Mad2
therapy compared to their normal counterpart.[7] (ii) EGFR is frequently overexpressed in NSCLC, which would increase
the uptake of the EGFR-targeted chitosan nanoparticles when compared
with nontumor cells.[59] Due to the absence
of EGFR overexpression in the primary cell line, the targeted and
nontargeted particles seem to behave in a similar and, in A549 cells,
the effect of the targeted particles was more pronounced. This further
confirms that the enhanced toxicity demonstrated by the EGFR-targeted
nanoparticles is indeed due to their targeting effect, which would
augment the therapeutic efficacy more effectively in the in vivo setting.
Conclusions
We have developn>ed an n>an class="Gene">EGFR-targeted chitosan system for silencing
the Mad2 mitotic checkpoint gene in treatment of
non-small cell lung cancer. We showed that this system exhibited higher
and selective uptake and efficiently knocked down Mad2, resulting
in massive cell death by apoptosis. Collectively, our results indicate
that the described system can be used as a potential therapeutic strategy
for cancer treatment. Further studies are needed to validate these
results in vivo.
Authors: Li Wang; Fang Yin; Yulei Du; Bei Chen; Shuhui Liang; Yongguo Zhang; Wenqi Du; Kaichun Wu; Jie Ding; Daiming Fan Journal: Tumour Biol Date: 2010-05-04
Authors: Marc-André Langlois; Christelle Boniface; Gang Wang; Jessica Alluin; Paul M Salvaterra; Jack Puymirat; John J Rossi; Nan Sook Lee Journal: J Biol Chem Date: 2005-02-18 Impact factor: 5.157
Authors: Rocío Sotillo; Eva Hernando; Elena Díaz-Rodríguez; Julie Teruya-Feldstein; Carlos Cordón-Cardo; Scott W Lowe; Robert Benezra Journal: Cancer Cell Date: 2006-12-28 Impact factor: 31.743