Literature DB >> 25255216

The neural crest is a source of mesenchymal stem cells with specialized hematopoietic stem cell niche function.

Joan Isern1, Andrés García-García1, Ana M Martín1, Lorena Arranz1, Daniel Martín-Pérez1, Carlos Torroja1, Fátima Sánchez-Cabo1, Simón Méndez-Ferrer1.   

Abstract

Mesenchymal stem cells (MSCs) and osteolineage cells contribute to the hematopoietic stem cell (HSC) niche in the bone marrow of long bones. However, their developmental relationships remain unclear. In this study, we demonstrate that different MSC populations in the developing marrow of long bones have distinct functions. Proliferative mesoderm-derived nestin(-) MSCs participate in fetal skeletogenesis and lose MSC activity soon after birth. In contrast, quiescent neural crest-derived nestin(+) cells preserve MSC activity, but do not generate fetal chondrocytes. Instead, they differentiate into HSC niche-forming MSCs, helping to establish the HSC niche by secreting Cxcl12. Perineural migration of these cells to the bone marrow requires the ErbB3 receptor. The neonatal Nestin-GFP(+) Pdgfrα(-) cell population also contains Schwann cell precursors, but does not comprise mature Schwann cells. Thus, in the developing bone marrow HSC niche-forming MSCs share a common origin with sympathetic peripheral neurons and glial cells, and ontogenically distinct MSCs have non-overlapping functions in endochondrogenesis and HSC niche formation.

Entities:  

Keywords:  bone marrow; developmental biology; hematopoietic stem cells; mesenchymal stem cells; mouse; neural crest; stem cell niche; stem cells

Mesh:

Substances:

Year:  2014        PMID: 25255216      PMCID: PMC4381911          DOI: 10.7554/eLife.03696

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Bone marrow stromal cells (BMSCs) are a heterogeneous population. The different mesenchymal cell types might either arise from a variety of resident progenitors or might ultimately be derived from a single population of rare MSCs (Caplan, 1991). In adult mammals, a multiple origin of skeletal MSCs is suggested by the distinct germ layer derivation of different bone structures, with craniofacial bones generated by the neuroectoderm, whereas the axial and appendicular bones are respectively derived from paraxial and lateral mesoderm. Mesoderm generates chondrocytes, which are progressively replaced by osteoblasts through the process of endochondral ossification (Olsen et al., 2000). MSCs share cell-surface markers and localization with pericytes, suggesting that some pericytes might be MSCs (Crisan et al., 2008). However, it remains unclear whether the bone marrow hosts ontogenically distinct MSCs in the same bones and whether they are endowed with specific functions. In adult bone marrow, a variety of mesenchymal cells regulate HSCs (Calvi et al., 2003; Zhang et al., 2003; Arai et al., 2004; Sacchetti et al., 2007; Chan et al., 2008; Naveiras et al., 2009; Mendez-Ferrer et al., 2010; Omatsu et al., 2010; Raaijmakers et al., 2010). Nevertheless, the specialized functions and developmental origin of these cells are largely unknown. Adult HSCs are also regulated by certain other non-hematopoietic lineages, including endothelial cells (Avecilla et al., 2004; Kiel et al., 2005; Ding et al., 2012), sympathetic neurons and associated non-myelinating Schwann cells (Katayama et al., 2006; Spiegel et al., 2007; Mendez-Ferrer et al., 2008; Yamazaki et al., 2011), perivascular cells expressing the leptin receptor (Ding et al., 2012) and mesodermal derivatives (Greenbaum et al., 2013). However, the relationships and potential overlap among these populations remain unclear. It is also not known whether MSCs that form the HSC niche also generate other stromal cells or are a specialized population that arises earlier in embryogenesis and persists into adulthood. In this study, we investigated the developmental origin and functions of MSCs in the primordial marrow of long bones. We show that, like peripheral neural and glial cells, HSC niche-forming MSCs in perinatal bone marrow arise from the trunk neural crest and make only a modest contribution to endochondrogenesis. Thus, whereas mesoderm-derived MSCs are mostly involved in endochondral ossification, neural crest-derived cells have a specialized function in establishing the HSC niche in the developing marrow of the same bones. These results provide compelling evidence for functional segregation of MSCs derived from different germ layers. The data also show that three HSC niche components—peripheral sympathetic neurons, Schwann cells, and MSCs—share a common origin.

Results

Fetal bone marrow nestin+ cells are quiescent and distinct from osteochondral cells

In adult mouse bone marrow, stromal cells expressing the green fluorescent protein (GFP) driven by the regulatory elements of nestin promoter (Nes-GFP+) display features of both MSCs and HSC niche cells (Mendez-Ferrer et al., 2010). This finding prompted us to characterize Nes-GFP+ cells during marrow development in limb bones. GFP+ cells were already present in E16.5 bone marrow, associated preferentially with blood vessels infiltrating the cartilage scaffold (Figure 1—figure supplement 1A–C). At E18.5 Nes-GFP+ cells were frequently associated with arterioles and sprouting endothelial cells within the osteochondral junction (Figure 1A–C). Fetal bone marrow Nes-GFP+ cells were heterogeneous, composed of a majority of BMSCs but also including a small subset of CD31+ putative endothelial cells that increased during the postnatal period (Figure 1D,E and Figure 1—figure supplement 1D). Compared with Nes-GFP- BMSCs, the Nes-GFP+ cell population was enriched in endogenous Nestin mRNA expression (Figure 1F). Arterioles were associated with an intense fluorescence microscopy signal, due to the presence of several concentric GFP+ cells, including an outer layer that expressed smooth muscle actin and an inner layer of endothelial cells (Figure 1G and Figure 1—figure supplement 1E,F). Fetal bone marrow Nes-GFP+ cells were distinct from S100-expressing chondrocytes and osteoblastic cells genetically labeled with the 2.3-kilobase proximal fragment of the α1(I)-collagen promoter (Dacquin et al., 2002) (Figure 1H–J). Contrasting the marked proliferation of Nes-GFP- BMSCs in perinatal life, Nes-GFP+ cells remained mostly quiescent (Figure 1K and Figure 1—figure supplement 1G). As a result, whereas Nes-GFP- BMSCs steadily expanded, Nes-GFP+ BMSC number did not change significantly (Figure 1L). Fetal bone marrow Nes-GFP+ cells thus include a small subset (<10%) of endothelial cells and a large population of non-endothelial stromal cells (>90%). Unlike Nes-GFP- stromal cells, Nes-GFP+ cells proliferate slowly and do not express osteochondral protein cell markers.
Figure 1—figure supplement 1.

Perivascular and endothelial Nes-GFP+ cells invade the incipient bone marrow associated with blood vessels.

(A) Longitudinal section of E16.5 Nes-Gfp forelimb. A profuse perivascular network of GFP+ cells can be observed, mostly associated with arterial blood vessels. (B) High magnification detail (inset B’) of arterioles containing Nes-GFP+ cells during invasion of the distal shaft of fetal bone. (C) Section through an E16.5 Nes-Gfp metaphyseal region undergoing vascularization, revealed by CD31 immunostaining of endothelial cells (red). (D) Representative FACS histograms of anti-CD31-stained CD45- bone marrow cells from 2-week old Nes-Gfp mice. The frequency of GFP+ putative endothelial cells is indicated. (E and F) Confocal high magnification detail is showing several layers of perivascular GFP+ cells (arrows) encircling an arteriole. Innermost endothelial cells immunostained with CD31 (red) also expressed GFP (yellow overlay, asterisks). (G) Femoral bone marrow section from newborn Nes-Gfp mouse stained with Ki67 (red) to label proliferative cells. Arrows indicate GFP+ Ki67+ cells; arrowheads depict GFP+ Ki67− cells; dashed line marks bone contour. (A-C,E,G) Nuclei were counterstained with DAPI (gray). Scale bars: 500 μm (A); 200 μm (B); 100 μm (C,G); 50 μm (E and F).

DOI: http://dx.doi.org/10.7554/eLife.03696.004

Figure 1.

Fetal bone marrow nestin+ cells proliferate slowly and are distinct from osteochondral cells.

(A–C) Nes-GFP+ cells in fetal bones undergoing endochondral ossification. Whole-mount confocal projection of E18.5 Nes-Gfp femoral bone marrow stained with CD31 (magenta) to mark endothelium. Note the perivascular distribution of GFP+ cells (green) in arterioles (B–B′′) and small vessels invading the primary spongiosa (C–C′′). (D–E) Nes-Gfp transgene is expressed by a subset of bone marrow endothelial cells. Flow cytometry histograms show the frequency of CD45− Nes-GFP+ cells expressing CD31. (F) Endogenous Nestin mRNA expression measured by qPCR in stromal populations isolated from Nes-Gfp mice at the indicated stages (mean ± SD, n = 3–5). (G) Nes-Gfp bone marrow section stained with smooth muscle actin antibodies (αSma, red; asterisks) to reveal arterioles. (H) Limb section from an E17.5 Nes-Gfp;Col2.3-Cre;KFP embryo showing Nes-GFP+ (green) and osteoblasts identified with antibodies to Katushka (KFP) protein (red), driven by the 2.3-kb proximal fragment of the α1(I)-collagen promoter. Arrowheads, endosteal surface. (I) Metaphysis of E17.5 Nes-Gfp embryo showing S100+ chondrocytes (red). (J) Magnified view of boxed area in (I). (K) Representative cell cycle profiles of bone marrow stromal Nes-GFP+/- cells at early postnatal stages. Frequencies of cells in G2/S-M (%) are indicated. (L) Number of stromal Nes-GFP+/− cells in postnatal bone marrow (mean ± SEM, n = 3–4). Scale bars: 200 μm (A, A′, B′′, C, H), 100 μm (G, I and J); (A′, G–J) dashed line indicates bone contour. BM, bone marrow; C, cartilage; PS, primary spongiosa.

DOI: http://dx.doi.org/10.7554/eLife.03696.003

(A) Longitudinal section of E16.5 Nes-Gfp forelimb. A profuse perivascular network of GFP+ cells can be observed, mostly associated with arterial blood vessels. (B) High magnification detail (inset B’) of arterioles containing Nes-GFP+ cells during invasion of the distal shaft of fetal bone. (C) Section through an E16.5 Nes-Gfp metaphyseal region undergoing vascularization, revealed by CD31 immunostaining of endothelial cells (red). (D) Representative FACS histograms of anti-CD31-stained CD45- bone marrow cells from 2-week old Nes-Gfp mice. The frequency of GFP+ putative endothelial cells is indicated. (E and F) Confocal high magnification detail is showing several layers of perivascular GFP+ cells (arrows) encircling an arteriole. Innermost endothelial cells immunostained with CD31 (red) also expressed GFP (yellow overlay, asterisks). (G) Femoral bone marrow section from newborn Nes-Gfp mouse stained with Ki67 (red) to label proliferative cells. Arrows indicate GFP+ Ki67+ cells; arrowheads depict GFP+ Ki67− cells; dashed line marks bone contour. (A-C,E,G) Nuclei were counterstained with DAPI (gray). Scale bars: 500 μm (A); 200 μm (B); 100 μm (C,G); 50 μm (E and F).

DOI: http://dx.doi.org/10.7554/eLife.03696.004

Fetal bone marrow nestin+ cells proliferate slowly and are distinct from osteochondral cells.

(A–C) Nes-GFP+ cells in fetal bones undergoing endochondral ossification. Whole-mount confocal projection of E18.5 Nes-Gfp femoral bone marrow stained with CD31 (magenta) to mark endothelium. Note the perivascular distribution of GFP+ cells (green) in arterioles (B–B′′) and small vessels invading the primary spongiosa (C–C′′). (D–E) Nes-Gfp transgene is expressed by a subset of bone marrow endothelial cells. Flow cytometry histograms show the frequency of CD45Nes-GFP+ cells expressing CD31. (F) Endogenous Nestin mRNA expression measured by qPCR in stromal populations isolated from Nes-Gfp mice at the indicated stages (mean ± SD, n = 3–5). (G) Nes-Gfp bone marrow section stained with smooth muscle actin antibodies (αSma, red; asterisks) to reveal arterioles. (H) Limb section from an E17.5 Nes-Gfp;Col2.3-Cre;KFP embryo showing Nes-GFP+ (green) and osteoblasts identified with antibodies to Katushka (KFP) protein (red), driven by the 2.3-kb proximal fragment of the α1(I)-collagen promoter. Arrowheads, endosteal surface. (I) Metaphysis of E17.5 Nes-Gfp embryo showing S100+ chondrocytes (red). (J) Magnified view of boxed area in (I). (K) Representative cell cycle profiles of bone marrow stromal Nes-GFP+/- cells at early postnatal stages. Frequencies of cells in G2/S-M (%) are indicated. (L) Number of stromal Nes-GFP+/− cells in postnatal bone marrow (mean ± SEM, n = 3–4). Scale bars: 200 μm (A, A′, B′′, C, H), 100 μm (G, I and J); (A′, G–J) dashed line indicates bone contour. BM, bone marrow; C, cartilage; PS, primary spongiosa. DOI: http://dx.doi.org/10.7554/eLife.03696.003

Perivascular and endothelial Nes-GFP+ cells invade the incipient bone marrow associated with blood vessels.

(A) Longitudinal section of E16.5 Nes-Gfp forelimb. A profuse perivascular network of GFP+ cells can be observed, mostly associated with arterial blood vessels. (B) High magnification detail (inset B’) of arterioles containing Nes-GFP+ cells during invasion of the distal shaft of fetal bone. (C) Section through an E16.5 Nes-Gfp metaphyseal region undergoing vascularization, revealed by CD31 immunostaining of endothelial cells (red). (D) Representative FACS histograms of anti-CD31-stained CD45- bone marrow cells from 2-week old Nes-Gfp mice. The frequency of GFP+ putative endothelial cells is indicated. (E and F) Confocal high magnification detail is showing several layers of perivascular GFP+ cells (arrows) encircling an arteriole. Innermost endothelial cells immunostained with CD31 (red) also expressed GFP (yellow overlay, asterisks). (G) Femoral bone marrow section from newborn Nes-Gfp mouse stained with Ki67 (red) to label proliferative cells. Arrows indicate GFP+ Ki67+ cells; arrowheads depict GFP+ Ki67− cells; dashed line marks bone contour. (A-C,E,G) Nuclei were counterstained with DAPI (gray). Scale bars: 500 μm (A); 200 μm (B); 100 μm (C,G); 50 μm (E and F). DOI: http://dx.doi.org/10.7554/eLife.03696.004

Bone marrow nestin+ cells do not contribute to fetal endochondrogenesis

We next studied whether Nes-GFP+ cells displayed osteoprogenitor activity in fetal bone marrow. The axial and appendicular skeleton is thought to originate solely from mesoderm. During endochondral ossification, cartilage is progressively replaced by osteoblast precursors that express the transcription factor osterix and infiltrate the perichondrium along the invading blood vessels (Maes et al., 2010). To identify mesodermal derivatives, we performed lineage-tracing studies by crossing mice expressing the RCE reporter—a sensitive reporter that drives stronger GFP expression than other reporter lines (Sousa et al., 2009)—with mice expressing inducible Cre recombinase under the regulatory elements of the Hoxb6 gene, which is expressed in the lateral plate mesoderm (Nguyen et al., 2009). The resulting double-transgenic mice were administered tamoxifen at E10.5, a stage when the Hoxb6 gene is still expressed. These mice and newborn Nes-gfp embryos were analyzed for osterix protein expression, which marks cells committed to the osteoblast lineage. Unlike osteoblast precursors derived from lateral plate mesoderm, Nes-GFP+ cells in fetal-limb bone marrow did not express highly osterix protein (Figure 2A,B).
Figure 2.

Bone marrow nestin+ cells are different from mesodermal osteo-chondroprogenitors.

(A and B) Bone marrow sections from Nes-Gfp (A–A′′) and Hoxb6-CreER;RCE (B–B′′) E18.5 embryos (tamoxifen-induced at E10.5) immunostained with Osterix antibodies (Osx, red) to label osteoprogenitor cells. GFP+ Osx+ mesodermal-derived osteoprogenitors are marked with asterisks (insets 2–3). (C–C′′′) Perinatal recombination in Nes-CreER mice efficiently targets bone marrow stromal Nes-GFP+ cells. Bone marrow section of a P7 Nes-Gfp;Nes-CreER;R26-Tomato mouse that received tamoxifen at birth, showing Nes-GFP+ cells (green), Nes-derived progeny (red), and double-positive cells (arrowheads). (D–F) Fate mapping of the progeny of nestin+ cells and limb mesoderm in E18.5/19.5 femoral bone marrow from Nes-CreER;RCE (D–D′′, F–F′) and Hoxb6-CreER;RCE fetuses (E). (D) GFP (green) and nuclei counterstained with DAPI (gray) in bone of E18.5 fetus induced with tamoxifen at E13.5. Neither proliferating (*) nor hypertrophic (**) chondrocytes showed GFP fluorescence (inset 1). (D′–D′′) Nes-derived cells with a similar morphology and distribution to Nes-GFP cells were detected near the cartilage–perichondrium interface (arrows) and within the chondro–osseous junction (arrowheads). (E and F) Bone marrow sections of (E) Hoxb6-CreER;RCE and (F) Nes-CreER;RCE E18.5 embryos induced with tamoxifen at E10.5 and E8.5, respectively, stained with S100 antibodies to label chondrocytes (red). High magnification views of cartilage (inset 2) showing abundant double-positive chondrocytes (arrowheads). (F) Nes-traced cells (green) were not chondrocytes (red, *) but infiltrated the chondro–osseous junction and trabecular bone (arrowheads). Scale bars: 200 μm (A–A′, B–B′), 100 μm (A′′, B′′), 50 μm (B′′3, C). BM, bone marrow; C, cartilage; GIFM, genetic inducible fate mapping.

DOI: http://dx.doi.org/10.7554/eLife.03696.005

(A) Neonatal Nes-Gfp bone marrow section immunostained with anti-osterix antibodies (red). Right panels, perichondrium detail showing inner rim of GFP+ cells (green) adjacent to distinctive perichondrial osterix+ cells. Nuclei were counterstained with DAPI (gray). Scale bar, 100 μm. PC, perichondrium. (B) Scheme showing FACS isolation of bone marrow stromal populations from Nes-Gfp mice and MSC assays. (C) Representative FACS plots and gating strategy to isolate stromal GFP+/- cells from Nes-Gfp bone marrow.

DOI: http://dx.doi.org/10.7554/eLife.03696.006

Bone marrow nestin+ cells are different from mesodermal osteo-chondroprogenitors.

(A and B) Bone marrow sections from Nes-Gfp (A–A′′) and Hoxb6-CreER;RCE (B–B′′) E18.5 embryos (tamoxifen-induced at E10.5) immunostained with Osterix antibodies (Osx, red) to label osteoprogenitor cells. GFP+ Osx+ mesodermal-derived osteoprogenitors are marked with asterisks (insets 2–3). (C–C′′′) Perinatal recombination in Nes-CreER mice efficiently targets bone marrow stromal Nes-GFP+ cells. Bone marrow section of a P7 Nes-Gfp;Nes-CreER;R26-Tomato mouse that received tamoxifen at birth, showing Nes-GFP+ cells (green), Nes-derived progeny (red), and double-positive cells (arrowheads). (D–F) Fate mapping of the progeny of nestin+ cells and limb mesoderm in E18.5/19.5 femoral bone marrow from Nes-CreER;RCE (D–D′′, F–F′) and Hoxb6-CreER;RCE fetuses (E). (D) GFP (green) and nuclei counterstained with DAPI (gray) in bone of E18.5 fetus induced with tamoxifen at E13.5. Neither proliferating (*) nor hypertrophic (**) chondrocytes showed GFP fluorescence (inset 1). (D′–D′′) Nes-derived cells with a similar morphology and distribution to Nes-GFP cells were detected near the cartilage–perichondrium interface (arrows) and within the chondro–osseous junction (arrowheads). (E and F) Bone marrow sections of (E) Hoxb6-CreER;RCE and (F) Nes-CreER;RCE E18.5 embryos induced with tamoxifen at E10.5 and E8.5, respectively, stained with S100 antibodies to label chondrocytes (red). High magnification views of cartilage (inset 2) showing abundant double-positive chondrocytes (arrowheads). (F) Nes-traced cells (green) were not chondrocytes (red, *) but infiltrated the chondro–osseous junction and trabecular bone (arrowheads). Scale bars: 200 μm (A–A′, B–B′), 100 μm (A′′, B′′), 50 μm (B′′3, C). BM, bone marrow; C, cartilage; GIFM, genetic inducible fate mapping. DOI: http://dx.doi.org/10.7554/eLife.03696.005

Sub-fractionation of fetal bone marrow mesenchymal progenitors.

(A) Neonatal Nes-Gfp bone marrow section immunostained with anti-osterix antibodies (red). Right panels, perichondrium detail showing inner rim of GFP+ cells (green) adjacent to distinctive perichondrial osterix+ cells. Nuclei were counterstained with DAPI (gray). Scale bar, 100 μm. PC, perichondrium. (B) Scheme showing FACS isolation of bone marrow stromal populations from Nes-Gfp mice and MSC assays. (C) Representative FACS plots and gating strategy to isolate stromal GFP+/- cells from Nes-Gfp bone marrow. DOI: http://dx.doi.org/10.7554/eLife.03696.006 We next performed genetically inducible fate mapping using Nes-CreER mice (Balordi and Fishell, 2007). In these mice, tamoxifen administration triggers labeling of Nes-GFP+ cells and their progeny (Figure 2C,D). Tamoxifen was administered at E13.5 (when primary ossification centers start forming) (Maes et al., 2010), and at E8.5, to mark earlier nestin+ embryonic precursors. Unlike Hoxb6-traced mesodermal derivatives, nestin+ cells did not contribute to cartilage formation during this period. In contrast, Nes-traced cells with a similar morphology and distribution to Nes-GFP+ cells were observed in the chondro–osseous junction (Figure 2E,F). Similarly, Nes-GFP+ cells were not present inside the cartilage but were found in the innermost part of the perichondrium (Figure 2—figure supplement 1A), a region enriched in MSCs (Maes et al., 2010; Yang et al., 2013; Zaidi and Mendez-Ferrer, 2013). The results thus show that, unlike mesodermal derivatives, Nes-GFP+ cells do not exhibit osteochondral progenitor activity in the fetal bone marrow.
Figure 2—figure supplement 1.

Sub-fractionation of fetal bone marrow mesenchymal progenitors.

(A) Neonatal Nes-Gfp bone marrow section immunostained with anti-osterix antibodies (red). Right panels, perichondrium detail showing inner rim of GFP+ cells (green) adjacent to distinctive perichondrial osterix+ cells. Nuclei were counterstained with DAPI (gray). Scale bar, 100 μm. PC, perichondrium. (B) Scheme showing FACS isolation of bone marrow stromal populations from Nes-Gfp mice and MSC assays. (C) Representative FACS plots and gating strategy to isolate stromal GFP+/- cells from Nes-Gfp bone marrow.

DOI: http://dx.doi.org/10.7554/eLife.03696.006

MSC activity is progressively enriched in nestin+ cells

The lack of a contribution by nestin+ cells to fetal endochondrogenesis raised questions regarding their putative MSC properties in fetal bone marrow. We therefore measured mesenchymal progenitor activity in purified bone-marrow stromal subsets using the fibroblastic colony-forming unit (CFU-F) assay (Friedenstein et al., 1970) and the multipotent self-renewing sphere-forming assay (Mendez-Ferrer et al., 2010) (Figure 2—figure supplement 1B). BMSCs were isolated according to Nes-GFP expression (Figure 2—figure supplement 1C). CFU-F efficiency was nearly three times higher in Nes-GFP- cells than in Nes-GFP+ cells at E17.5 (Figure 3A). Conversely, non-adherent sphere formation was markedly enriched in GFP+ cells, whereas most spheres derived from GFP− cells rapidly attached to plastic and spontaneously differentiated into adipocytes (Figure 3B–G), suggesting that Nes-GFP- BMSCs are in a more committed state. Spheres formed by Nes-GFP+ bone marrow cells contained mesenchyme-like spindle-shaped GFP+ cells (Figure 3E). At E18.5 and during the first postnatal week, CFU-F frequency was 6-fold higher in the GFP− stromal population than in GFP+ cells (Figure 3H). However, at later postnatal stages, CFU-F activity was progressively restricted to Nes-GFP+ cells due to a sharp drop in activity in GFP− BMSCs (>100-fold reduction between E18.5 and P14, compared with a 0.5-fold reduction in Nes-GFP+ cells). At P7, CFU-Fs derived from Nes-GFP- cells contained mostly preosteoblasts (Figure 3I–K). The expression of genes associated with chondrocyte development was higher in Nes-GFP- than in Nes-GFP+ BMSCs at E18.5; in contrast, the expression of master regulators of chondrogenesis, osteogenesis, and adipogenesis was progressively enriched in postnatal Nes-GFP+ BMSCs (Figure 3L), consistent with the increasing MSC enrichment in this population. Together, these results suggest that most fetal BMSCs do not express nestin and quickly differentiate towards committed skeletal precursors, losing most MSC activity by the second week after birth. In contrast, nestin+ cells conserve MSC activity throughout life.
Figure 3.

Perinatal enrichment of MSC activity in bone marrow nestin+ cells.

(A and B) Fibroblast colony-forming units (CFU-F) and mesensphere-forming activities segregate in Nes-GFP- and Nes-GFP+ fetal bone marrow cells, respectively. Frequencies of CFU-F and mesensphere-forming efficiency in E17.5 Nes-Gfp embryos. (C–E) Representative sphere cultures from both mesenchymal subpopulations sorted from bone marrow of Nes-Gfp fetuses. Note the presence of GFP+ fibroblast-like cells (E′ and insets1–3). (F–G) Adherent colonies derived from GFP- population stained with Oil Red O (red), to reveal mature adipocytes. (H) MSC activity is progressively restricted to bone marrow Nes-GFP+ cells. Frequency of CFU-Fs in cultures of stromal (CD45− CD31− Ter119−) GFP+/− cells, isolated from the bone marrow of Nes-Gfp mice of the indicated age. Right panels show representative CFU-Fs in cell populations from adult mice. (I) Frequency of osteoblastic colony-forming units (CFU-OB) in bone marrow stromal GFP+/− cells of the indicated age. (J) Representative Giemsa-stained CFU-F from 3- and 10-day old bone marrow subpopulations. (K) Stained CFU-OB from E18.5 (alkaline phosphatase staining, left panels) and 1-week old (alizarin red staining, right panels) bone marrow subpopulations. (L) qPCR analysis of mesenchymal genes in bone marrow stromal populations isolated from fetal (E18.5) or 1-week old (P7) Nes-Gfp mice, as depicted (Figure 3—figure supplement 1). (A–B, H–L) Mean ± SD, n = 3–6; *p < 0.05, unpaired two-tailed t test. Scale bars: 200 μm (D, E′, G), 100 μm (G), 50 μm (E′1–3).

DOI: http://dx.doi.org/10.7554/eLife.03696.007

Perinatal enrichment of MSC activity in bone marrow nestin+ cells.

(A and B) Fibroblast colony-forming units (CFU-F) and mesensphere-forming activities segregate in Nes-GFP- and Nes-GFP+ fetal bone marrow cells, respectively. Frequencies of CFU-F and mesensphere-forming efficiency in E17.5 Nes-Gfp embryos. (C–E) Representative sphere cultures from both mesenchymal subpopulations sorted from bone marrow of Nes-Gfp fetuses. Note the presence of GFP+ fibroblast-like cells (E′ and insets1–3). (F–G) Adherent colonies derived from GFP- population stained with Oil Red O (red), to reveal mature adipocytes. (H) MSC activity is progressively restricted to bone marrow Nes-GFP+ cells. Frequency of CFU-Fs in cultures of stromal (CD45CD31Ter119−) GFP+/− cells, isolated from the bone marrow of Nes-Gfp mice of the indicated age. Right panels show representative CFU-Fs in cell populations from adult mice. (I) Frequency of osteoblastic colony-forming units (CFU-OB) in bone marrow stromal GFP+/− cells of the indicated age. (J) Representative Giemsa-stained CFU-F from 3- and 10-day old bone marrow subpopulations. (K) Stained CFU-OB from E18.5 (alkaline phosphatase staining, left panels) and 1-week old (alizarin red staining, right panels) bone marrow subpopulations. (L) qPCR analysis of mesenchymal genes in bone marrow stromal populations isolated from fetal (E18.5) or 1-week old (P7) Nes-Gfp mice, as depicted (Figure 3—figure supplement 1). (A–B, H–L) Mean ± SD, n = 3–6; *p < 0.05, unpaired two-tailed t test. Scale bars: 200 μm (D, E′, G), 100 μm (G), 50 μm (E′1–3). DOI: http://dx.doi.org/10.7554/eLife.03696.007

The trunk neural crest contributes to bone marrow nestin+ MSCs

Neural crest cells are characterized by nestin expression and sphere-forming ability. Although cells traced to neural crest origin have been reported in adult murine bone marrow (Nagoshi et al., 2008; Morikawa et al., 2009b; Glejzer et al., 2011; Komada et al., 2012), their precise identity, developmental dynamics, and function have remained elusive. Moreover, the neural crest-specific Wnt1-Cre line used in these studies displays ectopic Wnt1 activation. To trace neural crest derivatives, we performed genetic fate-mapping studies with a recent Wnt1-Cre2 line that does not induce ectopic Wnt1 activity (Lewis et al., 2013). Unexpectedly, limb bones from Wnt1-Cre2;R26-Tomato double-transgenic neonates showed some neural crest-derived osteoblasts and osteocytes aligning the most recent layers of bone deposition, as well as similarly distributed chondrocytes in the outermost layers of the femur head (Figure 4A,B). As expected, neural crest-traced Schwann cells expressing glial fibrillary acidic protein (GFAP) were also detected in the bone marrow of one-week old mice (Figure 4—figure supplement 1A,B). Intriguingly, GFAP− perivascular cells with a similar morphology and distribution to Nes-GFP+ cells were also derived from Wnt1+ cells (Figure 4—figure supplement 1C,D). The number of neural crest-traced osteochondral cells increased in the first postnatal week (Figure 4C). By P28, CFU-F activity was much higher in Wnt1-Cre2-traced cells than in non-neural crest-traced bone marrow stromal cells (Figure 4D). These results show that the neural crest contributes to limb bones late in development.
Figure 4.

Contribution of trunk neural crest cells to mesenchymal lineages in long bones.

(A and B) Fate mapping of neural crest derivatives in femoral bone marrow of neonatal Wnt1-Cre2;R26-Tomato mice. (A) Section through femoral distal epiphysis showing cortical neural-crest-derived chondrocytes (arrowheads, red); green signal corresponds to phalloidin staining. Nuclei were counterstained with DAPI (gray). (B) Bone marrow section showing Wnt1-Cre2-derived Tomato+ (red) osteocytes. (Inset 1) Neural-crest-derived osteocytes (asterisks) in endosteal region, showing their typical morphology revealed by phalloidin staining (green). (C–E) The neural crest contributes to Pdgfrα+ BMSCs in long bones. (C–C′′) Fluorescent signals of GFP, Tomato, and DAPI in bone marrow sections from 1-week old Wnt1-Cre2;R26-Tomato;Nes-Gfp mice. (D) Frequency of fibroblastic colony-forming units (CFU-F) in CD31- CD45- Ter119- Tomato+/- bone marrow cells sorted from 1-week old Wnt1-Cre2;R26-Tomato mice (n = 3); N.D., not detectable. (D′) Examples of Giemsa staining (top panel) and Tomato fluorescence in neural crest-derived CFU-Fs. (E) Representative flow cytometry analysis of bone marrow stromal cells from 4-week old Wnt1-Cre2;R26-Tomato;Nes-Gfp mice. (F) Flow cytometry analysis of bone marrow stromal cells from Nes-Gfp;Sox10-CreER;R26-Tomato triple-transgenic mice stained with Pdgfrα antibody. (E, F) Frequencies of neural crest-traced BMSCs are indicated. Scale bars: 200 μm (A–A′′, C, D–D′), 100 μm (B), 20 μm (B1, C′–C′′′). Dashed line depicts the bone and cartilage contour (A–C).

DOI: http://dx.doi.org/10.7554/eLife.03696.008

(A–C) Diaphysis section stained with antibodies against glial fibrillary acidic protein (Gfap, cyan). Neural crest-traced cells included Gfap+ Schwann cells (inset 1, arrowheads) and Gfap− putative BMSCs (inset 2, asterisks) (B-B′′, C-C′′). (D-D′′′) Staining of basal lamina with collagen IV antibodies (blue) showing close association of neural crest-derived cells (red) with blood vessels. (E) Surface expression of Pdgfrα enriches for fetal bone marrow mesenchymal progenitors. Fibroblast colony-forming units (CFU-F) in bone marrow stromal cells (CD45- CD31- Ter119-) isolated from E17.5 Nes-Gfp mice according to GFP and Pdgfrα expression. (F) Frequency of CFU-F colonies obtained from sorted populations of Wnt1-Cre2;R26-Tomato;Nes-Gfp 1-week old pups. (G) Schwann cells are closely associated with distinctive Nes-GFP+ perivascular cells (arrowheads). Immunofluorescence of P9 Nes-Gfp tibial bone marrow showing GFP+ cells (green), Gfap+ Schwann cells (red), and CD31+ endothelial cells (pink); nuclei were counterstained with DAPI (gray). (G′–G′′) Details of central diaphyseal region (insets) at high magnification. (G′) Note the long Gfap+ Schwann cells extending through the arteriole, surrounded by distinctive Nes-GFP+ cells (arrowhead). (G′′) Magnified view of a long arteriole. Asterisks indicate Gfap- perivascular Nes-GFP+ cells. Scale bars: 200 μm (A, D, G), 50 μm (B, C, G′–G′′).

DOI: http://dx.doi.org/10.7554/eLife.03696.009

(A-A′′′) Bone marrow section from newborn Wnt1-Cre2;R26-Tomato pup stained with calcein to mark calcium deposition (green), showing Wnt1-Cre2-traced Tomato+ osteoblasts (red) in calcifying areas (asterisks). Scale bar = 100 μm. (B) Representative bone section of an E18.5 Sox10-CreER;R26-Tomato mouse showing Tomato+ osteocytes (asterisks) and bone-lining osteoblasts (red). Dashed line depicts the bone contour. Nuclei were counterstained with DAPI (gray). (C and D) Representative flow cytometry plots of bone marrow stained with Pdgfrα from neonatal (D) and 4-week old (C) Wnt1-Cre2;R26-Tomato;Nes-Gfp mice, after gating on the stromal (CD45- CD31- Ter119-) population. (E) Representative flow cytometry histogram of bone marrow cells from E18.5 Sox10-CreER;R26-Tomato;Nes-Gfp embryos, induced with tamoxifen at E9.5, after gating on the tomato-bright population. Scale bars: 200 μm (B), 100 μm (A, B′).

DOI: http://dx.doi.org/10.7554/eLife.03696.010

Figure 4—figure supplement 1.

Bone marrow Nes-GFP+ cells are distinct from mature Schwann cells.

(A–C) Diaphysis section stained with antibodies against glial fibrillary acidic protein (Gfap, cyan). Neural crest-traced cells included Gfap+ Schwann cells (inset 1, arrowheads) and Gfap− putative BMSCs (inset 2, asterisks) (B-B′′, C-C′′). (D-D′′′) Staining of basal lamina with collagen IV antibodies (blue) showing close association of neural crest-derived cells (red) with blood vessels. (E) Surface expression of Pdgfrα enriches for fetal bone marrow mesenchymal progenitors. Fibroblast colony-forming units (CFU-F) in bone marrow stromal cells (CD45- CD31- Ter119-) isolated from E17.5 Nes-Gfp mice according to GFP and Pdgfrα expression. (F) Frequency of CFU-F colonies obtained from sorted populations of Wnt1-Cre2;R26-Tomato;Nes-Gfp 1-week old pups. (G) Schwann cells are closely associated with distinctive Nes-GFP+ perivascular cells (arrowheads). Immunofluorescence of P9 Nes-Gfp tibial bone marrow showing GFP+ cells (green), Gfap+ Schwann cells (red), and CD31+ endothelial cells (pink); nuclei were counterstained with DAPI (gray). (G′–G′′) Details of central diaphyseal region (insets) at high magnification. (G′) Note the long Gfap+ Schwann cells extending through the arteriole, surrounded by distinctive Nes-GFP+ cells (arrowhead). (G′′) Magnified view of a long arteriole. Asterisks indicate Gfap- perivascular Nes-GFP+ cells. Scale bars: 200 μm (A, D, G), 50 μm (B, C, G′–G′′).

DOI: http://dx.doi.org/10.7554/eLife.03696.009

Contribution of trunk neural crest cells to mesenchymal lineages in long bones.

(A and B) Fate mapping of neural crest derivatives in femoral bone marrow of neonatal Wnt1-Cre2;R26-Tomato mice. (A) Section through femoral distal epiphysis showing cortical neural-crest-derived chondrocytes (arrowheads, red); green signal corresponds to phalloidin staining. Nuclei were counterstained with DAPI (gray). (B) Bone marrow section showing Wnt1-Cre2-derived Tomato+ (red) osteocytes. (Inset 1) Neural-crest-derived osteocytes (asterisks) in endosteal region, showing their typical morphology revealed by phalloidin staining (green). (C–E) The neural crest contributes to Pdgfrα+ BMSCs in long bones. (C–C′′) Fluorescent signals of GFP, Tomato, and DAPI in bone marrow sections from 1-week old Wnt1-Cre2;R26-Tomato;Nes-Gfp mice. (D) Frequency of fibroblastic colony-forming units (CFU-F) in CD31- CD45- Ter119- Tomato+/- bone marrow cells sorted from 1-week old Wnt1-Cre2;R26-Tomato mice (n = 3); N.D., not detectable. (D′) Examples of Giemsa staining (top panel) and Tomato fluorescence in neural crest-derived CFU-Fs. (E) Representative flow cytometry analysis of bone marrow stromal cells from 4-week old Wnt1-Cre2;R26-Tomato;Nes-Gfp mice. (F) Flow cytometry analysis of bone marrow stromal cells from Nes-Gfp;Sox10-CreER;R26-Tomato triple-transgenic mice stained with Pdgfrα antibody. (E, F) Frequencies of neural crest-traced BMSCs are indicated. Scale bars: 200 μm (A–A′′, C, D–D′), 100 μm (B), 20 μm (B1, C′–C′′′). Dashed line depicts the bone and cartilage contour (A–C). DOI: http://dx.doi.org/10.7554/eLife.03696.008

Bone marrow Nes-GFP+ cells are distinct from mature Schwann cells.

(A–C) Diaphysis section stained with antibodies against glial fibrillary acidic protein (Gfap, cyan). Neural crest-traced cells included Gfap+ Schwann cells (inset 1, arrowheads) and Gfap− putative BMSCs (inset 2, asterisks) (B-B′′, C-C′′). (D-D′′′) Staining of basal lamina with collagen IV antibodies (blue) showing close association of neural crest-derived cells (red) with blood vessels. (E) Surface expression of Pdgfrα enriches for fetal bone marrow mesenchymal progenitors. Fibroblast colony-forming units (CFU-F) in bone marrow stromal cells (CD45- CD31- Ter119-) isolated from E17.5 Nes-Gfp mice according to GFP and Pdgfrα expression. (F) Frequency of CFU-F colonies obtained from sorted populations of Wnt1-Cre2;R26-Tomato;Nes-Gfp 1-week old pups. (G) Schwann cells are closely associated with distinctive Nes-GFP+ perivascular cells (arrowheads). Immunofluorescence of P9 Nes-Gfp tibial bone marrow showing GFP+ cells (green), Gfap+ Schwann cells (red), and CD31+ endothelial cells (pink); nuclei were counterstained with DAPI (gray). (G′–G′′) Details of central diaphyseal region (insets) at high magnification. (G′) Note the long Gfap+ Schwann cells extending through the arteriole, surrounded by distinctive Nes-GFP+ cells (arrowhead). (G′′) Magnified view of a long arteriole. Asterisks indicate Gfap- perivascular Nes-GFP+ cells. Scale bars: 200 μm (A, D, G), 50 μm (B, C, G′–G′′). DOI: http://dx.doi.org/10.7554/eLife.03696.009

Contribution of trunk neural crest to bone marrow stromal lineages.

(A-A′′′) Bone marrow section from newborn Wnt1-Cre2;R26-Tomato pup stained with calcein to mark calcium deposition (green), showing Wnt1-Cre2-traced Tomato+ osteoblasts (red) in calcifying areas (asterisks). Scale bar = 100 μm. (B) Representative bone section of an E18.5 Sox10-CreER;R26-Tomato mouse showing Tomato+ osteocytes (asterisks) and bone-lining osteoblasts (red). Dashed line depicts the bone contour. Nuclei were counterstained with DAPI (gray). (C and D) Representative flow cytometry plots of bone marrow stained with Pdgfrα from neonatal (D) and 4-week old (C) Wnt1-Cre2;R26-Tomato;Nes-Gfp mice, after gating on the stromal (CD45- CD31- Ter119-) population. (E) Representative flow cytometry histogram of bone marrow cells from E18.5 Sox10-CreER;R26-Tomato;Nes-Gfp embryos, induced with tamoxifen at E9.5, after gating on the tomato-bright population. Scale bars: 200 μm (B), 100 μm (A, B′). DOI: http://dx.doi.org/10.7554/eLife.03696.010 We further characterized cell surface marker expression by neural crest-derived MSCs. Platelet-derived growth factor receptor alpha (Pdgfrα) is required in mesodermal and neural crest-derived mesenchyme during development (Schatteman et al., 1992; Soriano, 1997). Mouse Pdgfrα+ BMSCs are highly enriched in CFU-F activity (Takashima et al., 2007; Morikawa et al., 2009a) and most adult mouse bone marrow nestin+ cells are also Pdgfrα+ (Yamazaki et al., 2011; Pinho et al., 2013). We found that Pdgfrα+ BMSCs were also enriched in CFU-F activity at fetal stages (Figure 4—figure supplement 1E). In the bone marrow of 4-week old Nes-Gfp;Wnt1-Cre2;R26-Tomato mice, most neural crest-traced cells were also Pdgfrα+ and Nes-GFP+ (Figure 4E). For confirmation, we intercrossed Nes-Gfp;R26-Tomato mice with a line expressing tamoxifen inducible Cre recombinase under the regulatory elements of the gene encoding the neural crest transcription factor Sox10. Nes-Gfp;Sox10-CreER;R26-Tomato mice were administered tamoxifen at E9.5 to label migratory neural crest-derived cells. Similar to the situation in stage-matched Nes-Gfp mice—and also consistent with Wnt1-Cre2-traced cells—most Sox10-CreER-traced bone marrow stromal cells were Pdgfrα+ and Nes-GFP+ cells (Figure 4F and Figure 4—figure supplement 2). These results thus demonstrate definitively that the neural crest contributes to nestin+ BMSCs.
Figure 4—figure supplement 2.

Contribution of trunk neural crest to bone marrow stromal lineages.

(A-A′′′) Bone marrow section from newborn Wnt1-Cre2;R26-Tomato pup stained with calcein to mark calcium deposition (green), showing Wnt1-Cre2-traced Tomato+ osteoblasts (red) in calcifying areas (asterisks). Scale bar = 100 μm. (B) Representative bone section of an E18.5 Sox10-CreER;R26-Tomato mouse showing Tomato+ osteocytes (asterisks) and bone-lining osteoblasts (red). Dashed line depicts the bone contour. Nuclei were counterstained with DAPI (gray). (C and D) Representative flow cytometry plots of bone marrow stained with Pdgfrα from neonatal (D) and 4-week old (C) Wnt1-Cre2;R26-Tomato;Nes-Gfp mice, after gating on the stromal (CD45- CD31- Ter119-) population. (E) Representative flow cytometry histogram of bone marrow cells from E18.5 Sox10-CreER;R26-Tomato;Nes-Gfp embryos, induced with tamoxifen at E9.5, after gating on the tomato-bright population. Scale bars: 200 μm (B), 100 μm (A, B′).

DOI: http://dx.doi.org/10.7554/eLife.03696.010

The Nes-GFP+ bone marrow population comprises Pdgfrα+ MSCs and Pdgfrα− Schwann cell precursors

The finding that some fetal bone marrow Nes-GFP+ cells expressed Pdgfrα while others did not prompted us to study the possible functional heterogeneity of this population. Recent work showed that most adult bone marrow nestin+ cells are Pdgfrα+ and also that nestin+ Pdgfrα+ Schwann cells contribute to HSC maintenance (Yamazaki et al., 2011). We found that bone marrow Nes-GFP+ cells were closely associated with distinctive Gfap+ Schwann cells (Figure 4—figure supplement 1G). After sorting of neonatal GFP+/− Pdgfrα+/− BMSCs (Figure 5A), the two populations were analyzed by next-generation sequencing. Detection of endogenous Pdgfrα and Nes transcripts verified the isolation strategy. Interestingly, whereas Ly6a/Sca1 expression was higher in GFP−Pdgfrα+ cells (Figure 5—figure supplement 1A,B), the expression levels of HSC maintenance genes (Cxcl12, Kitl and Angpt1) and the Leptin receptor, which marks HSC niche-forming mesenchymal cells (Ding et al., 2012), was highly enriched in GFP+ Pdgfrα+ cells (Figure 5B). This population also abundantly expressed other genes enriched in MSCs (Figure 5—figure supplement 1C). In contrast, Nes-GFP+ Pdgfrα− cells expressed genes characteristic of Schwann cell precursors (Sox10, Plp1, Erbb3, Dhh) but did not express mature Schwann cell genes, such as Gfap (Figure 5C). Gene ontology analysis of differentially expressed genes between the two Pdgfrα+ subpopulations revealed enrichment of categories related to ossification, bone and blood vessel development, axon guidance, and Schwann cell differentiation (Figure 5—figure supplement 1D and supplement 2).
Figure 5.

The neonatal bone marrow Nestin-GFP+ population contains Pdgfrα+ MSCs and Pdgfrα− Schwann cell precursors.

(A) Representative flow cytometry profiles showing Nes-GFP and Pdgfrα expression in postnatal BMSCs. (B and C) Relative mRNA expression levels of (B) HSC niche-related genes and (C) Schwann cell progenitor genes by GFP+ Pdgfrα+ (black) or GFP+ Pdgfrα− BMSCs. RNAseq data are expressed as fragments per kilobase of exon per million fragments mapped (FPKM; n=2 independent samples from pooled newborns). Note that the neonatal GFP+ Pdgfrα− subpopulation has a Schwann cell progenitor signature (C), whereas GFP+ Pdgfrα+ cells are enriched in HSC maintenance genes. (D) Principal component analysis comparing the transcriptome of neonatal Nes-Gfp bone marrow stromal subsets with available microarray expression data sets from neural crest-derived populations and primary adult mouse BMSCs (Table 1). (E and F) In vitro differentiation of neonatal subpopulations isolated as in (A) and cultured in mesenchymal (mesenchymal) and Schwann cell (glial) differentiation medium. Adipocytes were stained with Oil Red O (red) and counterstained with hematoxylin (left panels); Schwann cells were stained with antibodies against glial fibrillary acidic protein (Gfap, red) and overlaid with endogenous GFP fluorescence (right panels). Scale bars: 200 μm (top right insets: 50 μm).

DOI: http://dx.doi.org/10.7554/eLife.03696.011

(A) Representative FACS profile of GFP and Pdgfrα expression in CD45− CD31− Ter119− BMSCs from neonatal Nes-Gfp long bones. Four different stromal subpopulations identified based on expression levels of Pdgfrα and GFP were isolated and analyzed by RNAseq. (B) Endogenous transcript expression levels of Nestin, Pdgfra, Cspg4 (NG2), and Sca1 (Ly6a) in isolated stromal populations depicted in (A), expressed in fragments per kilobase of exon per million fragments mapped (FPKM). (C) Expression profiles of characteristic mesenchymal genes in the stromal subpopulations. (D) Functional gene ontology enrichment analysis (DAVID software) of genes differentially expressed (p ≤ 0.10) between the GFP+ and GFP− subsets of P1 Pdgfrα+ bone marrow stromal cells.

DOI: http://dx.doi.org/10.7554/eLife.03696.012

Top 50 downregulated (A) and upregulated (B) genes in Nes-GFP+ Pdgfrα+ and Nes-GFP+ Pdgfrα− cells from P1 bone marrow stroma.

DOI: http://dx.doi.org/10.7554/eLife.03696.013

Figure 5—figure supplement 1.

The neonatal Nes-GFP+ bone marrow population is enriched in primitive mesenchymal progenitors.

(A) Representative FACS profile of GFP and Pdgfrα expression in CD45− CD31− Ter119− BMSCs from neonatal Nes-Gfp long bones. Four different stromal subpopulations identified based on expression levels of Pdgfrα and GFP were isolated and analyzed by RNAseq. (B) Endogenous transcript expression levels of Nestin, Pdgfra, Cspg4 (NG2), and Sca1 (Ly6a) in isolated stromal populations depicted in (A), expressed in fragments per kilobase of exon per million fragments mapped (FPKM). (C) Expression profiles of characteristic mesenchymal genes in the stromal subpopulations. (D) Functional gene ontology enrichment analysis (DAVID software) of genes differentially expressed (p ≤ 0.10) between the GFP+ and GFP− subsets of P1 Pdgfrα+ bone marrow stromal cells.

DOI: http://dx.doi.org/10.7554/eLife.03696.012

The neonatal bone marrow Nestin-GFP+ population contains Pdgfrα+ MSCs and Pdgfrα− Schwann cell precursors.

(A) Representative flow cytometry profiles showing Nes-GFP and Pdgfrα expression in postnatal BMSCs. (B and C) Relative mRNA expression levels of (B) HSC niche-related genes and (C) Schwann cell progenitor genes by GFP+ Pdgfrα+ (black) or GFP+ Pdgfrα− BMSCs. RNAseq data are expressed as fragments per kilobase of exon per million fragments mapped (FPKM; n=2 independent samples from pooled newborns). Note that the neonatal GFP+ Pdgfrα− subpopulation has a Schwann cell progenitor signature (C), whereas GFP+ Pdgfrα+ cells are enriched in HSC maintenance genes. (D) Principal component analysis comparing the transcriptome of neonatal Nes-Gfp bone marrow stromal subsets with available microarray expression data sets from neural crest-derived populations and primary adult mouse BMSCs (Table 1). (E and F) In vitro differentiation of neonatal subpopulations isolated as in (A) and cultured in mesenchymal (mesenchymal) and Schwann cell (glial) differentiation medium. Adipocytes were stained with Oil Red O (red) and counterstained with hematoxylin (left panels); Schwann cells were stained with antibodies against glial fibrillary acidic protein (Gfap, red) and overlaid with endogenous GFP fluorescence (right panels). Scale bars: 200 μm (top right insets: 50 μm).
Table 1.

Description of publicly available data sets used for principal component analyses

DOI: http://dx.doi.org/10.7554/eLife.03696.014

Plot IDCell PopulationGEO* samplesSample descriptionRef
1BM osteoblastic cells (Alcam- Sca1-)GSM437794BM (adult) primary stromal Alcam- Sca1-
2BM osteoblastic cells (Alcam+ Sca1-)GSM437795BM (adult) primary stromal Alcam+ Sca1-
3BM osteoblastic cells (Pdgfrα- Sca1-)GSM437797BM (adult) primary stromal Pdgfrα- Sca1-
4BM osteoblastic cells ( Pdgfrα+ Sca1-)GSM437798BM (adult) primary stromal Pdgfrα+ Sca1-
5BM MPC’s (Pdgfrα+ Sca1+)GSM437799BM (adult) primary stromal Mesenchymal progenitor cells (MPC) (Pdgfrα+ Sca1+)
6BM MPC’s (Alcam+ Sca1+)GSM437796BM (adult) primary stromal Mesenchymal progenitor cells (MPC) (Alcam+ Sca1+)
7BM MSC-like derived clonesGSM795638-40BM MSC-derived cell line, Wnt1Cre/R26R β-gal- selected clone passage>10§
8BM NCSC-derived clonesGSM795641-43BM NCSC-derived cell line, Wnt1Cre/R26R β-gal- selected clone passage>10
9E13.5 vascular segment (mesoderm-derived)GSM261911E13.5 internal carotid artery vascular segment (smooth muscle mesoderm-derived)
10E13.5 vascular segment (NC derived)GSM261912E13.5 external carotid artery vascular segment (smooth muscle NC-derived)
11BM (adult) Nes-GFP+GSM545815-17BM (adult) primary (CD45-) Nes-GFP+ cells**
12BM (adult) Scf-GFP+GSM821066-68BM (adult) primary Scf-GFP+ cells††
13P0 Schwann cellsGSM15386-88P0 primary Schwann cells (Plp-GFP+) from sciatic nerve‡‡
14E12.5 Schwann cell precursors (SCPs)GSM15373-75E12.5 primary Schwann cell precursors (Plp-GFP+) from sciatic nerve
15E14.5 Enteric Neural crest cells (ENCC)GSM844492-94E14.5 primary ENCCs (Wnt1Cre/R26-YFP+) from gut
16E9.5 Neural crest stem cells (NCSC)GSM15370-72E9.5 trunk primary Plp-GFP+ cells (migrating NCSCs)
17E18.5 Schwann cellsGSM15383-85E18.5 primary Schwann cells (Plp-GFP+) cells from sciatic nerve

Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/).

CD45-CD31-Ter119-.

References:.

Nakamura et al. Isolation and characterization of endosteal niche cell populations that regulate hematopoietic stem cells. Blood (2010) vol. 116 (9) pp. 1422-32.

Wislet-Gendebien et al. Mesenchymal stem cells and neural crest stem cells from adult bone marrow: characterization of their surprising similarities and differences. Cell Mol Life Sci (2012)vol. 69 (15) pp. 2593-608.

Zhang et al. Origin-specific epigenetic program correlates with vascular bed-specific differences in Rgs5 expression. FASEB J (2012) vol. 26 (1) pp. 181-91.

Méndez-Ferrer et al. Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature (2010) vol. 466 (7308) pp. 829-34.

Ding and Morrison. Haematopoietic stem cells and early lymphoid progenitors occupy distinct bone marrow niches. Nature (2013) pp. 1-6.

Buchstaller et al. Efficient isolation and gene expression profiling of small numbers of neural crest stem cells and developing Schwann cells. J Neurosci (2004) vol. 24 (10) pp. 2357-65.

DOI: http://dx.doi.org/10.7554/eLife.03696.011

The neonatal Nes-GFP+ bone marrow population is enriched in primitive mesenchymal progenitors.

(A) Representative FACS profile of GFP and Pdgfrα expression in CD45CD31Ter119− BMSCs from neonatal Nes-Gfp long bones. Four different stromal subpopulations identified based on expression levels of Pdgfrα and GFP were isolated and analyzed by RNAseq. (B) Endogenous transcript expression levels of Nestin, Pdgfra, Cspg4 (NG2), and Sca1 (Ly6a) in isolated stromal populations depicted in (A), expressed in fragments per kilobase of exon per million fragments mapped (FPKM). (C) Expression profiles of characteristic mesenchymal genes in the stromal subpopulations. (D) Functional gene ontology enrichment analysis (DAVID software) of genes differentially expressed (p ≤ 0.10) between the GFP+ and GFP− subsets of P1 Pdgfrα+ bone marrow stromal cells. DOI: http://dx.doi.org/10.7554/eLife.03696.012

RNA-seq data analysis.

Top 50 downregulated (A) and upregulated (B) genes in Nes-GFP+ Pdgfrα+ and Nes-GFP+ Pdgfrα− cells from P1 bone marrow stroma. DOI: http://dx.doi.org/10.7554/eLife.03696.013 To further characterize nestin+ subpopulations, we compared the transcriptome-wide profile of neonatal Nes-GFP+/− Pdgfrα+/− BMSCs with publicly available microarray expression data sets from primary adult BMSCs or neural crest derivatives (Table 1). Unbiased hierarchical clustering and principal component analysis (Figure 5D) revealed that Nes-GFP+ Pdgfrα+ cells were more similar to adult primitive BMSCs and distinct from more differentiated osteoblastic cells (Nakamura et al., 2010). Pdgfrα+ Nes-GFP+/− cells clustered nearby, consistent with the increasing restriction of Pdgfrα to Nes-GFP+ cells in postnatal bone marrow. In addition, Nes-GFP+ Pdgfrα + cells clustered far from Nes-GFP+ Pdgfrα− cells, whose genomic profile was closest to that of E12.5 Schwann cell precursors. MSC-like and neural crest stem-cell-like derived clones (Wislet-Gendebien et al., 2012) were markedly different, probably because these were cultured cells. Intriguingly, we noted a maturation hierarchy of Schwann and osteolineage cells, from undifferentiated cells (Figure 5D, lower corners) to more mature lineages (Figure 5D, contralateral upper corners). At the intersection of these differentiation waves, adult bone marrow CD45Nes-GFP+ cells (Mendez-Ferrer et al., 2010) converged with bone marrow HSC niche cells identified by the expression of stem cell factor (Ding et al., 2012). These results suggest the existence of two nestin+ populations with non-overlapping MSC and Schwann cell precursor features. To test this hypothesis functionally, we cultured neonatal Nes-GFP+/− Pdgfrα+/− BMSCs in differentiation medium, finding that mesenchymal and glial differentiation was segregated in Pdgfrα+ and Pdgfrα− cells, respectively (Figure 5E,F). Thus two Nes-GFP+ neural crest derivatives occur in postnatal bone marrow: Pdgfrα+ MSCs enriched in HSC-supporting genes and Pdgfrα− Schwann cell precursors. Description of publicly available data sets used for principal component analyses DOI: http://dx.doi.org/10.7554/eLife.03696.014 Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/). CD45-CD31-Ter119-. References:. Nakamura et al. Isolation and characterization of endosteal niche cell populations that regulate hematopoietic stem cells. Blood (2010) vol. 116 (9) pp. 1422-32. Wislet-Gendebien et al. Mesenchymal stem cells and neural crest stem cells from adult bone marrow: characterization of their surprising similarities and differences. Cell Mol Life Sci (2012)vol. 69 (15) pp. 2593-608. Zhang et al. Origin-specific epigenetic program correlates with vascular bed-specific differences in Rgs5 expression. FASEB J (2012) vol. 26 (1) pp. 181-91. Méndez-Ferrer et al. Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature (2010) vol. 466 (7308) pp. 829-34. Ding and Morrison. Haematopoietic stem cells and early lymphoid progenitors occupy distinct bone marrow niches. Nature (2013) pp. 1-6. Buchstaller et al. Efficient isolation and gene expression profiling of small numbers of neural crest stem cells and developing Schwann cells. J Neurosci (2004) vol. 24 (10) pp. 2357-65.

Deficient migration of neural crest-derived cells along nerves reduces the bone marrow MSC and HSC populations

Under similar culture conditions used to grow neural crest cells, adult mouse bone marrow Nes-GFP+ cells can form self-renewing and multipotent mesenchymal spheres with the capacity to transfer hematopoietic activity to ectopic sites during serial transplantations (Mendez-Ferrer et al., 2010). In addition, human bone marrow-derived mesenspheres secrete factors that can expand human cord blood HSCs through secreted factors (Isern et al., 2013). These findings and the results presented so far together suggest that neural crest-derived MSCs might have a specialized function in establishing the HSC niche in the developing bone marrow. We further studied the role of neural crest-derived cells in this process using a loss-of-function model. Perineural migration of neural crest-derived cells requires the interaction of the receptor tyrosine-protein kinase ErbB3 with the ligand neuregulin-1, produced by developing nerves (Jessen and Mirsky, 2005). Erbb3-deficient mice initially show normal development of peripheral nerves but later display impaired perineural migration of neural crest-derived cells and die at perinatal stage (Riethmacher et al., 1997). Hematopoietic progenitors were increased in fetal liver of KO mice (Figure 6A). In contrast, expression of the MSC marker CD90, enriched in Nes-GFP+ cells (Figure 6B,C), was reduced two-fold in Erbb3−/− limb bone marrow, associated with 5-fold drop in the number of bone marrow hematopoietic progenitors (Figure 6D,G). To further dissect the contribution of neural crest to fetal hematopoiesis, we performed a similar analysis in mice conditionally lacking ErbB3 in Schwann-committed cells. To label Schwann cells, we intercrossed R26-Tomato reporter mice intercrossed with a line expressing Cre recombinase under the regulatory elements of desert hedgehog (Dhh) promoter (Jaegle et al., 2003) (Figure 6—figure supplement 1A–C). These Dhh-Cre mice were then intercrossed with the ErbB3 conditional KO. Similar to the constitutive KO, Dhh-Cre;Erbb3 mice are virtually devoid of Schwann cells (Sheean et al., 2014); however, unlike the constitutive KO, Dhh-Cre;Erbb3 mice had a normal frequency of bone marrow hematopoietic progenitors (Figure 6—figure supplement 1D). Together, these results suggest that neural crest cells not yet committed to the Schwann cell lineage migrate along developing nerves to the bone marrow, giving rise to HSC niche-forming MSCs.
Figure 6.

Perineural migration of neural crest-derived cells to long bones generates nestin+ MSCs with specialized HSC niche function.

(A) E17.5-E18.5 fetal liver (FL) sections from wild-type (wt) and Erbb3-null embryos stained with antibodies for mature hematopoietic lineage (blue) and c-Kit (red). Quantification of fetal liver Lin− c-Kit+ hematopoietic progenitors (per 0.41 mm2). (B) Representative FACS profile of CD45- CD31-Ter119- bone marrow cells from 2-week old Nes-Gfp mice stained with the mesenchymal marker CD90, showing the expression enrichment in Nes-GFP+ cells. (C) Neonatal bone marrow section stained with anti-CD90 (red), which labeled Nes-GFP+ (green) cells. Scale bar: 50 μm. (D) Representative bone marrow sections from wt and Erbb3-null E17.5/18.5 mice immunostained with anti-CD90 (red). (E) Quantification of CD90 immunostaining of samples in (D); n = 3. (F) Staining of bone marrow sections from wt and Erbb3-null embryos with antibodies for mature hematopoietic lineage (blue) and c-Kit (red). (G) Quantification of bone marrow Lineage− c-Kit+ hematopoietic progenitors in E17.5/18.5 wt and Erbb3-null mice (n = 3). (E, G) Mean ± SEM; *p < 0.05, unpaired two-tailed t test.

DOI: http://dx.doi.org/10.7554/eLife.03696.015

(A-A′) Whole-mount view of ventral ribcage of a Dhh-Cre;R26-Tomato neonate, showing labeling of glial cells along the intercostal peripheral nerves (red). (B-B′) Surface detail of Tomato+ Schwann cells between 2 ribs. (C) High magnification of ventral skull showing an intricate network of Tomato+ Schwann cells. (D) Frequency of hematopoietic lineage− c-Kit+ Sca-1+ (LSK) cells in neonatal bone marrow of Dhh-Cre;Erbb3 and control littermate mice (mean ± SD, n = 4–5).

DOI: http://dx.doi.org/10.7554/eLife.03696.016

Figure 6—figure supplement 1.

Conditional Erbb3 deletion after glial specification of Schwann cell precursors does not affect bone marrow HSCs.

(A-A′) Whole-mount view of ventral ribcage of a Dhh-Cre;R26-Tomato neonate, showing labeling of glial cells along the intercostal peripheral nerves (red). (B-B′) Surface detail of Tomato+ Schwann cells between 2 ribs. (C) High magnification of ventral skull showing an intricate network of Tomato+ Schwann cells. (D) Frequency of hematopoietic lineage− c-Kit+ Sca-1+ (LSK) cells in neonatal bone marrow of Dhh-Cre;Erbb3 and control littermate mice (mean ± SD, n = 4–5).

DOI: http://dx.doi.org/10.7554/eLife.03696.016

Perineural migration of neural crest-derived cells to long bones generates nestin+ MSCs with specialized HSC niche function.

(A) E17.5-E18.5 fetal liver (FL) sections from wild-type (wt) and Erbb3-null embryos stained with antibodies for mature hematopoietic lineage (blue) and c-Kit (red). Quantification of fetal liver Lin− c-Kit+ hematopoietic progenitors (per 0.41 mm2). (B) Representative FACS profile of CD45- CD31-Ter119- bone marrow cells from 2-week old Nes-Gfp mice stained with the mesenchymal marker CD90, showing the expression enrichment in Nes-GFP+ cells. (C) Neonatal bone marrow section stained with anti-CD90 (red), which labeled Nes-GFP+ (green) cells. Scale bar: 50 μm. (D) Representative bone marrow sections from wt and Erbb3-null E17.5/18.5 mice immunostained with anti-CD90 (red). (E) Quantification of CD90 immunostaining of samples in (D); n = 3. (F) Staining of bone marrow sections from wt and Erbb3-null embryos with antibodies for mature hematopoietic lineage (blue) and c-Kit (red). (G) Quantification of bone marrow Lineage− c-Kit+ hematopoietic progenitors in E17.5/18.5 wt and Erbb3-null mice (n = 3). (E, G) Mean ± SEM; *p < 0.05, unpaired two-tailed t test. DOI: http://dx.doi.org/10.7554/eLife.03696.015

Conditional Erbb3 deletion after glial specification of Schwann cell precursors does not affect bone marrow HSCs.

(A-A′) Whole-mount view of ventral ribcage of a Dhh-Cre;R26-Tomato neonate, showing labeling of glial cells along the intercostal peripheral nerves (red). (B-B′) Surface detail of Tomato+ Schwann cells between 2 ribs. (C) High magnification of ventral skull showing an intricate network of Tomato+ Schwann cells. (D) Frequency of hematopoietic lineage− c-Kit+ Sca-1+ (LSK) cells in neonatal bone marrow of Dhh-Cre;Erbb3 and control littermate mice (mean ± SD, n = 4–5). DOI: http://dx.doi.org/10.7554/eLife.03696.016

Neural crest-derived nestin+ cells direct developmental HSC migration to the bone marrow

Despite the low frequency of HSCs and Nes-GFP+ cells, detailed immunofluorescence analysis showed significant proximity of HSCs to Nes-GFP+ cells in neonatal bone marrow (Figure 7A,B), suggesting that nestin+ cells might attract circulating HSCs toward their final developmental destination in the bone marrow. To study the contribution of nestin+ cells to HSC migration from fetal liver to bone marrow, we used mice expressing the diphtheria toxin (iDTA) or its receptor (iDTR) in nestin+ cells. Depletion of nestin+ cells at E15.5 in Nes-CreER;iDTR mice caused an ∼4-fold reduction in fetal bone marrow HSC activity within 48 hr, inversely correlating with an ∼8-fold increase in fetal liver HSC activity (Figure 7C,D). The cell cycle profile and apoptosis in hematopoietic progenitors were unchanged (Figure 7—figure supplement 1A), but their numbers increased in fetal liver by 40% (Figure 7E). Similar results were obtained by depleting nestin+ cells during the first postnatal week in Nes-CreER;iDTA mice, which otherwise showed normal bone marrow histology (Figure 7F and Figure 7—figure supplement 1B). Developmental HSC migration to bone marrow proceeds until the second week after birth (Dzierzak and Speck, 2008), suggesting that the bone marrow environment might still mature during this period to accommodate HSCs. We therefore analyzed GFP+/− BMSCs from E18.5 and P7 Nes-Gfp bone marrow. The expression of HSC-supporting genes was markedly higher and progressively upregulated in GFP+ cells during the first postnatal week (Figure 7G). These results suggest that perinatal maturation of nestin+ cells allows the colonization of bone marrow by circulating HSCs.
Figure 7.

CXCL12 produced by nestin+ MSCs contributes to the establishment of the HSC niche in the bone marrow.

(A and B) HSCs are localized near Nes-GFP+ cells in neonatal bone marrow. Neonatal femoral sections from Nes-Gfp mice were immunostained with antibodies for mature hematopoietic lineages, CD48 (blue) and CD150 (red). (A) Quantification of the distance of Lin− CD48− CD150+ HSC-enriched cells from Nes-GFP+ cells (mean ± SEM, n = 41). (B) Representative image of a putative HSC (asterisk) near a Nes-GFP+ cell. (C–F) Depletion of nestin+ cells compromises developmental HSC migration to bone marrow. (C and D) Long-term culture-initiating cell (LTCIC) assay from nestin-depleted fetal liver and bone-marrow cells. Nes-CreER;iDTR (red dots) and control iDTR (black dots) mice were exposed to tamoxifen at E14.5 and diphtheria toxin at E15.5, and liver cells (C) and bone marrow cells (D) were isolated at E17.5 (n = 5-6). The percentage of culture dishes that failed to generate hematopoietic colony-forming units in culture (CFU-C) is plotted against five serial dilutions of (C) fetal liver Lin− Sca-1+ cells and (D) nucleated bone marrow cells. HSC frequencies and p values are indicated (Pearson’s chi-squared test). (E) Frequency of Lin− Sca-1+ E17.5 liver cells in mice in (C). (F) Bone marrow CFU-C content in 1-week old Nes-CreER;R26-DTA and control littermates treated with tamoxifen at birth (n = 3–7). (G) Expression of core HSC maintenance genes increases in perinatal Nes-GFP+ BMSCs. qPCR analysis of Cxcl12, stem cell factor/kit ligand (Kitl), angiopoietin-1 (Angpt1), and vascular cell adhesion molecule-1 (Vcam1) mRNA in CD45- CD31- Ter119- GFP+/− cells isolated from E18.5 and P7 Nes-Gfp bone marrow. (H) Relative Cxcl12 mRNA expression levels in endothelial cells and Nes-GFP+/- BMSCs isolated from 1-week old mice (qPCR; n = 2). (I and J) Relative enrichment of Cxcl12 (I) and Nestin (J) mRNA expression in populations sorted from the bone marrow of P7 Nes-Gfp;Wnt1-Cre2;R26-Tomato compound transgenic mice. (K) Representative confocal image of a bone marrow section from a 1-week old (P7) Nes-Gfp;Nes-CreER;R26-Tomato mouse treated with tamoxifen at birth. Both sinusoidal (asterisk) and arteriolar GFP+ cells express the Nes-CreER-derived Tomato (red) reporter (yellow in overlaid picture, K′). (L and M) Efficiency of perinatal Cxcl12 excision by the Nes-CreER driver in CD45-Ter119−CD31- cells (L) and endothelial (M) cells isolated from P7 bone marrow; qPCR in CD45-Ter119−CD31- cells isolated from Cxcl12;Nes-CreER (E) and control (C) littermates treated with tamoxifen at birth (n = 2-3). (N and O) Bone marrow CFU-C (N) and long-term HSC (O) content in P7 Cxcl12;Nes-CreER and control littermates treated with tamoxifen at birth. (O) Lethally-irradiated mice (CD45.1) were transplanted with 1 ×106 bone marrow cells from P7 Cxcl12;Nes-CreER or Cxcl12 mice (CD45.2), together with 1 × 106 recipient bone marrow cells (CD45.1). Peripheral donor-derived blood chimerism after 16 weeks is shown (n = 4 per group). (E, L) Each dot represents an individual mouse. (F, H–J) Mean ± SD. *p < 0.05, unpaired two-tailed t test.

DOI: http://dx.doi.org/10.7554/eLife.03696.017

(A) Cell cycle profile of Lin− Sca-1+ E17.5 liver cells isolated from Nes-CreER;iDTR embryos and control iDTR littermates 24 hr after tamoxifen administration and 48 hr after diphtheria toxin treatment (mean ± SEM, n = 6). (B) Representative femoral bone marrow section from a tamoxifen-treated Nes-CreER;R26-DTA mouse immunostained with collagen IV antibody (red) to reveal blood vessels (B′). Nuclei were counterstained with DAPI (gray). Scale bar, 100 μm.

DOI: http://dx.doi.org/10.7554/eLife.03696.018

Figure 7—figure supplement 1.

Neural crest-derived cells direct developmental HSC migration to the bone marrow.

(A) Cell cycle profile of Lin− Sca-1+ E17.5 liver cells isolated from Nes-CreER;iDTR embryos and control iDTR littermates 24 hr after tamoxifen administration and 48 hr after diphtheria toxin treatment (mean ± SEM, n = 6). (B) Representative femoral bone marrow section from a tamoxifen-treated Nes-CreER;R26-DTA mouse immunostained with collagen IV antibody (red) to reveal blood vessels (B′). Nuclei were counterstained with DAPI (gray). Scale bar, 100 μm.

DOI: http://dx.doi.org/10.7554/eLife.03696.018

CXCL12 produced by nestin+ MSCs contributes to the establishment of the HSC niche in the bone marrow.

(A and B) HSCs are localized near Nes-GFP+ cells in neonatal bone marrow. Neonatal femoral sections from Nes-Gfp mice were immunostained with antibodies for mature hematopoietic lineages, CD48 (blue) and CD150 (red). (A) Quantification of the distance of Lin− CD48CD150+ HSC-enriched cells from Nes-GFP+ cells (mean ± SEM, n = 41). (B) Representative image of a putative HSC (asterisk) near a Nes-GFP+ cell. (C–F) Depletion of nestin+ cells compromises developmental HSC migration to bone marrow. (C and D) Long-term culture-initiating cell (LTCIC) assay from nestin-depleted fetal liver and bone-marrow cells. Nes-CreER;iDTR (red dots) and control iDTR (black dots) mice were exposed to tamoxifen at E14.5 and diphtheria toxin at E15.5, and liver cells (C) and bone marrow cells (D) were isolated at E17.5 (n = 5-6). The percentage of culture dishes that failed to generate hematopoietic colony-forming units in culture (CFU-C) is plotted against five serial dilutions of (C) fetal liver Lin− Sca-1+ cells and (D) nucleated bone marrow cells. HSC frequencies and p values are indicated (Pearson’s chi-squared test). (E) Frequency of Lin− Sca-1+ E17.5 liver cells in mice in (C). (F) Bone marrow CFU-C content in 1-week old Nes-CreER;R26-DTA and control littermates treated with tamoxifen at birth (n = 3–7). (G) Expression of core HSC maintenance genes increases in perinatal Nes-GFP+ BMSCs. qPCR analysis of Cxcl12, stem cell factor/kit ligand (Kitl), angiopoietin-1 (Angpt1), and vascular cell adhesion molecule-1 (Vcam1) mRNA in CD45- CD31- Ter119- GFP+/− cells isolated from E18.5 and P7 Nes-Gfp bone marrow. (H) Relative Cxcl12 mRNA expression levels in endothelial cells and Nes-GFP+/- BMSCs isolated from 1-week old mice (qPCR; n = 2). (I and J) Relative enrichment of Cxcl12 (I) and Nestin (J) mRNA expression in populations sorted from the bone marrow of P7 Nes-Gfp;Wnt1-Cre2;R26-Tomato compound transgenic mice. (K) Representative confocal image of a bone marrow section from a 1-week old (P7) Nes-Gfp;Nes-CreER;R26-Tomato mouse treated with tamoxifen at birth. Both sinusoidal (asterisk) and arteriolar GFP+ cells express the Nes-CreER-derived Tomato (red) reporter (yellow in overlaid picture, K′). (L and M) Efficiency of perinatal Cxcl12 excision by the Nes-CreER driver in CD45-Ter119CD31- cells (L) and endothelial (M) cells isolated from P7 bone marrow; qPCR in CD45-Ter119CD31- cells isolated from Cxcl12;Nes-CreER (E) and control (C) littermates treated with tamoxifen at birth (n = 2-3). (N and O) Bone marrow CFU-C (N) and long-term HSC (O) content in P7 Cxcl12;Nes-CreER and control littermates treated with tamoxifen at birth. (O) Lethally-irradiated mice (CD45.1) were transplanted with 1 ×106 bone marrow cells from P7 Cxcl12;Nes-CreER or Cxcl12 mice (CD45.2), together with 1 × 106 recipient bone marrow cells (CD45.1). Peripheral donor-derived blood chimerism after 16 weeks is shown (n = 4 per group). (E, L) Each dot represents an individual mouse. (F, H–J) Mean ± SD. *p < 0.05, unpaired two-tailed t test. DOI: http://dx.doi.org/10.7554/eLife.03696.017

Neural crest-derived cells direct developmental HSC migration to the bone marrow.

(A) Cell cycle profile of Lin− Sca-1+ E17.5 liver cells isolated from Nes-CreER;iDTR embryos and control iDTR littermates 24 hr after tamoxifen administration and 48 hr after diphtheria toxin treatment (mean ± SEM, n = 6). (B) Representative femoral bone marrow section from a tamoxifen-treated Nes-CreER;R26-DTA mouse immunostained with collagen IV antibody (red) to reveal blood vessels (B′). Nuclei were counterstained with DAPI (gray). Scale bar, 100 μm. DOI: http://dx.doi.org/10.7554/eLife.03696.018

Nestin+ MSC-derived Cxcl12 contributes to the establishment of the HSC niche in the bone marrow

HSC migration to fetal bone marrow is enhanced by Cxcl12 and stem cell factor (Christensen et al., 2004), both of which are highly expressed and progressively upregulated in bone marrow nestin+ cells at perinatal stages (Figure 7G). Cxcl12 is produced by several stromal cells and is required for developmental bone marrow colonization by HSCs (Ara et al., 2003). It has been argued that Cxcl12 produced by endothelial cells and nestin− mesenchymal progenitors—but not by nestin+ cells—is necessary for adult HSC maintenance (Ding and Morrison, 2013; Greenbaum et al., 2013). We found that, one week after birth, Cxcl12 mRNA levels in Nes-GFP+ BMSCs were >20-fold higher than in bone marrow endothelial cells and 80-fold higher than in Nes-GFP- BMSCs (Figure 7H). Among neural crest-traced cells, Nes-GFP+ BMSCs were particularly enriched in the expression of Cxcl12 and endogenous Nestin (Figure 7I,J). To conditionally delete Cxcl12 in nestin+ cells in the first postnatal week, we intercrossed Cxcl12 mice (Tzeng et al., 2010) with Nes-CreER mice, which mostly label Nes-GFP+ cells during this period (Figure 7K). Tamoxifen administration did not significantly alter Cxcl12 mRNA levels in bone marrow endothelial cells but decreased these levels by 5-fold in BMSCs (Figure 7L–M). This was associated with an ∼30% reduction of bone marrow hematopoietic progenitors and HSCs measured by long-term competitive repopulation assays (Figure 7N,O). These results demonstrate that Cxcl12 production by nestin+ MSCs contributes to the HSC niche formation in the developing bone marrow.

Discussion

The aim of this study was to investigate the ontogeny and specific functions of mesenchymal progenitors in the fetal bone marrow. We show that the developing bone marrow in axial and appendicular skeleton harbors different MSC populations with distinct origins and specialized roles. While mesoderm-derived nestin− MSCs give rise to bone and cartilage, the neuroectoderm provides an additional source of MSCs, marked by nestin expression, that are endowed with specific HSC niche functions. We therefore conclude that osteochondroprogenitor and stem cell niche functions are separate and non-overlapping during bone marrow ontogenesis. The neural crest thus gives rise to three regulators of adult HSC activity: sympathetic neurons, associated Schwann cells, and nestin+ MSCs. Although it is accepted that mammalian connective tissues, such as bone or skeletal muscle, are derived mainly from mesoderm, the precise origin of BMSCs has remained unclear. While the neural crest contributes to the craniofacial skeleton, the trunk neural crest is thought to generate mostly non-ectomesenchymal derivatives, including melanocytes, neurons, and glia of the peripheral nervous system. In the trunk skeleton, mesenchymal cells have thus been considered to be derived mostly from the mesoderm (Olsen et al., 2000), but the neural crest is also a source of pericytes, mural cells, and fibroblasts (Bergwerff et al., 1998; Etchevers et al., 2001; Joseph et al., 2004) that can differentiate into mesenchymal lineages in vitro (Morikawa et al., 2009b; Glejzer et al., 2011; John et al., 2011; Komada et al., 2012). In addition, mature endothelial cells can generate mesenchymal cells through endothelial-to-mesenchymal transition. Genetic fate-mapping studies using the neuroepithelial marker Sox1 identified a neuroectodermal origin of the earliest trunk MSCs, but other MSCs are recruited from undefined sources at later stages (Takashima et al., 2007). This picture raised the question of whether several MSCs might transiently coexist in the developing bone marrow and whether neural-crest-derived MSCs with specific functions might persist in the postnatal bone marrow. In this study, we show that most mesenchymal activity and chondrogenic capacity in the fetal bone marrow is associated with nestin− MSCs, but that these rapidly differentiate towards committed osteochondral lineages early in postnatal life. In contrast, slow-proliferating neural crest-derived nestin+ MSCs do not contribute to fetal endochondrogenesis but are instead required to establish the HSC niche in the same bones. Interestingly, we also found that nestin+ cells retained most of their steady-state MSC activity after the second postnatal week. Future studies will determine the potential contribution of this MSC population to adult skeletal turnover. Very recent data showed that Osterix-Cre-labeled cells in neonatal bone give rise to Nes-GFP+ MSCs (Mizoguchi et al., 2014; Ono et al., 2014); however, the Osterix-Cre lines used in these studies have been shown previously to mark not only osteolineage cells but also a large variety of non-osteolineage cells, including adventitial reticular cells, vascular smooth muscle cells, adipocytes, and perineural cells (Liu et al., 2013). It therefore remains possible that some Nes-GFP+ cells, which highly express Osterix mRNA (but not the protein, as we show here), also express the Osterix-Cre transgene; however, this might not necessarily reflect a lineage relationship or osteoblastic commitment. Moreover, it is unclear whether this Osterix-Cre-traced population is uniformly mesodermal or neural crest-derived. We did not find Nes-GFP+ cells within cartilage, but some GFP+ cells were associated with the innermost part of the perichondrium, a region that contains MSCs (Maes et al., 2010; Yang et al., 2013; Zaidi and Mendez-Ferrer, 2013). Moreover, we found perichondrial Wnt1-Cre2-traced cells and neural crest-derived chondrocytes in the most superficial layers of articular cartilage, suggesting that the neural crest also contributes to these mesenchymal cells outside the marrow. Neural crest-derived skeletal embryonic precursors might be Pdgfrα+ Nes-GFP- BMSCs, since we have shown that most neural crest cells traced by Wnt1-Cre2 are Pdgfrα+ Nes-GFP+ cells, which do not seem to contribute to fetal osteochondral lineages. Previous studies suggested that only endochondral cells can form a hematopoietic microenvironment when implanted beneath the kidney capsule (Chan et al., 2008, 2013), although bones formed by intramembranous ossification, such as the skull, can also form hematopoietic marrow without progressing through a cartilage intermediate. Notably, two surface markers used to isolate osteochondrogenic precursors in these studies, CD105 and CD90/Thy1, are particularly enriched in bone marrow Nes-GFP+ cells. Our genetic studies clearly show that neural crest-derived cells that are not yet committed to the Schwann cell lineage migrate to bone in association with developing nerve fibers and give rise to bone marrow nestin+ MSCs with specialized HSC niche functions. Constitutive deletion of the neuregulin-1 receptor ErbB3, which does not directly affect the peripheral nerves but impairs perineural migration of neural crest-derived cells (Riethmacher et al., 1997), reduces BMSC number and impairs developmental HSC migration from liver to bone marrow. In contrast, conditional deletion of ErbB3 in committed glial precursors severely reduced Schwann cell numbers (Sheean et al., 2014) but did not affect bone marrow HSCs in our study. HSC maintenance genes are highly enriched and progressively upregulated in Nes-GFP+ Pdgfrα+ MSCs, coincident with HSC bone marrow colonization (Christensen et al., 2004). Perinatal deletion of nestin+ cells or blockade of their Cxcl12 production prevented HSC bone marrow seeding. Therefore, we are confident that neural crest-derived nestin+ MSCs are indeed required for developmental HSC migration and formation of the bone marrow HSC niche. Uncertainties remain about the possible overlap among different adult bone marrow mesenchymal cells with proposed HSC niche functions, which might also differ in fetal and adult bone marrow. Two populations of adult bone marrow Nes-GFP+ cells can be separated by fluorescence intensity by microscopy. Nes-GFPbright peri-arteriolar cells, unlike Nes-GFPdim peri-sinusoidal cells, were found highly enriched in CFU-F activity and expression of HSC maintenance genes (Kunisaki et al., 2013). However, these features have been previously attributed to peri-sinusoidal cells (Kiel et al., 2005; Sacchetti et al., 2007), which, unlike arteriolar cells, express both Nes-GFP+ and leptin receptor (Ding et al., 2012). Alternatively, an intermediate type of vessel that connects arterioles with sinusoids near the bone surface might be highly enriched in nestin+ MSCs. These vessels, different from arterioles and sinusoids, contain CD31hi Endomucinhi endothelial cells and have been associated with osteoprogenitor activity (Kusumbe et al., 2014). We initially reported that adult bone marrow Nes-GFP+ cells were CD31− after using an intensive enzymatic digestion protocol to isolate the cells (Mendez-Ferrer et al., 2010). In the present study, we have used milder conditions that better preserve antigen expression. In these conditions, we detect Nes-GFP+ CD31+ putative bone marrow endothelial cells progressively increasing in number with age, as reported by others (Ono et al., 2014). We also find that multiple layers of Nes-GFP+ endothelial and perivascular cells likely make the arteriolar GFP signal appear brighter for GFP under the microscope. This raises the possibility that arteriolar Nes-GFP+ cells (Kunisaki et al., 2013) might not completely coincide with the brightest cells isolated by FACS. However, we also found that Cxcl12 is more abundantly produced by Nes-GFP+ BMSCs than by endothelial cells, and that Cxcl12 deletion in Nes-CreER mice impairs developmental HSC migration by preferentially targeting BMSCs. Different bone marrow cells have been proposed as the main producers of Cxcl12 for HSCs. One report has argued that the only relevant source of Cxcl12 for adult HSC maintenance is nestinleptin receptor–mesenchymal progenitors targeted by the Prx1-Cre driver (Greenbaum et al., 2013). This conclusion is based on the stronger HSC depletion when Cxcl12 was deleted using the Prx1-Cre line—which targets somatic lateral plate mesoderm and its derivatives, including chondrogenic and osteogenic lineages—compared to deletion in more specific stromal populations. Also, the HSC defect was specifically attributed to CD45- Lin− Pdgfrα+ Sca-1+ Prx1-cre-tdtomatohi cells which were not enriched in the expression of nestin or leptin receptor but also showed no marked enrichment in the expression of Cxcl12, Kitl or other mesenchymal markers. An alternate model is that endothelial cells are needed for Cxcl12-mediated adult HSC maintenance (Ding et al., 2012; Ding and Morrison, 2013). Nonetheless, the Tek-Cre system used would also target endothelial cells in fetal hematopoietic organs, so some of the effects might have been exported to the bone marrow during development. The study, in essence, proposed that nestin-negative leptin receptor (Lepr)-Cre-traced mesenchymal progenitors are another key source of Cxcl12 for HSC maintenance. These studies, however, analyzed the adult bone marrow, whereas the focus of our study has been the fetal and perinatal period. Differences may also have arisen from distinct experimental settings, Cre drivers (constitutive/inducible), Cre induction regimes and reporters used. It is also likely that constitutive Prx1-Cre and Lepr-Cre lines target multiple mesenchymal derivatives and that combined deletion of Cxcl12 in these populations would have a more pronounced effect than deletion in specific cell types; however, the responsible cell populations might not be clear yet. Conversely, the lower excision in Nes-Cre mice and inefficient bone marrow recombination in adult Nes-CreER mice might not target all MSCs, or might result in compensatory actions by other Cxcl12-producing cells. In the present study, recombination efficiency in Nes-GFP+ MSCs was higher when tamoxifen was administered in neonatal Nes-CreER mice than in adults. It has also been proposed that Nes-Gfp and Nes-CreER lines might target different populations (Ding et al., 2012). To directly address this, we generated Nes-Gfp;Nes-CreER;R26-Tomato triple transgenic mice that demonstrate consistent labeling using a different induction protocol. Bone marrow endothelial Cxcl12 expression levels are significantly lower in this model, and seem unaffected by Nes-CreER-driven excision, contrasting with the reduction in BMSCs, which was associated with decreased HSPC numbers in perinatal bone marrow. Our results thus clearly show that Cxcl12 produced by nestin+ MSCs is required for developmental HSC migration to bone marrow. We recently reported that sympathetic neuropathy of the HSC niche is required for the manifestation of myeloproliferative neoplasms, disorders previously considered to be autonomously driven by mutated HSCs and typically associated with excessive fibroblasts and osteoblasts in the bone marrow. During this pathogenesis, bone marrow nestin+ cells do not seem to differentiate into fibroblasts or osteoblasts, but instead activate the Schwann cell program as a consequence of the neuroglial damage caused in the bone marrow by mutated HSCs (). These changes could be explained by a neural crest contribution found for HSC niche-forming MSCs and suggest the possible re-programming of these cells towards the closest ontogenically-related linages during the pathogenesis of these disorders. In summary, this study designates separate biologic functions to ontogenically distinct populations of MSCs, and demonstrates that not all MSCs are alike. In the appendicular skeleton, nestin− MSCs derived from the mesoderm have a primarily osteochondroprogenitor function. In contrast, a distinct population of neural crest-derived nestin+ MSCs contributes to directed HSC migration through the secretion of the chemokine Cxcl12 to ultimately establish the HSC niche in the neonatal bone marrow. These niche-forming MSCs share a common origin with sympathetic neurons and Schwann cells, an ontogenic relationship that underscores our earlier observations on the sympathetic control of HSC niche function (Mendez-Ferrer et al., 2008, 2010; Arranz et al., 2014). Future studies will also determine whether tight regulation of other peripheral adult stem cell niches by the nervous system also builds upon an ontogenic relationship of their components.

Materials and methods

Animals

Mouse lines used in this study (please see Supplementary file 1 for a detailed list of mouse strains used in this study) included Nes-Gfp (Mignone et al., 2004), Nes-CreER (Balordi and Fishell, 2007), Sox10-CreER (Matsuoka et al., 2005), Col2.3-Cre (Dacquin et al., 2002), Dhh-Cre (Jaegle et al., 2003), RCE-loxP (Sousa et al., 2009), LSL-KFP (Dieguez-Hurtado et al., 2011), R26-DTA (Brockschnieder et al., 2006), Cxcl12floxed (Tzeng et al., 2010), Erbb3floxed (Sheean et al., 2014), Erbb3-null (Riethmacher et al., 1997), and 129S4.Cg-Tg(Wnt1-cre)2Sor/J, C57BL/6-Gt(ROSA)26Sor/J, B6.Cg-Gt(ROSA)26Sor/J, wild-type CD1 and wild-type C57BL/6J (Jackson Laboratories). Material and methods were approved by the Animal Care and Use Committees of the Spanish National Cardiovascular Research Center and Comunidad Autónoma de Madrid (PA-47/11 and ES280790000176).

Embryo analysis and genetic inducible fate mapping

Embryos were dissected as previously described (Isern et al., 2008). Briefly, selected intercrosses between mice carrying the alleles of interest were set and the morning of detection of the vaginal plug was considered as day 0.5 of gestation. We preferentially used paternal transgene transmission, by mating compound or simple transgenic males with females of wild-type background (C57BL/6 or CD1). Inducible lineage tracing studies were conducted as follows. Tamoxifen (T5648; Sigma, St. Louis, MO) was dissolved in corn oil at a final concentration of 20 mg/mL and given to pregnant dams by oral gavage (100-150 mg/kg) on the morning of the indicated stages. For neonatal induction, mothers of newborn pups were given tamoxifen (by oral gavage, 4 mg) on days 1 and 3 after delivery.

Histology

Dissected tissues for histology were fixed in 2% paraformaldehyde at 4°C, cryopreserved by consecutive equilibration in 15% and 30% sucrose, and snap frozen and embedded in OCT compound (Tissue-Tek). In some cases, fixed frozen limbs or sterna were trimmed sequentially from both sides to expose the central medullar cavity and processed further for whole-mount fluorescence staining. Cryostat sections (15 μm) were prepared and processed for immunostaining or regular hematoxylineosin staining. Oil red O staining was performed as described (Isern et al., 2013).

Immunohistochemistry

Cryostat sections were stained using standard procedures. Briefly, tissues were permeabilized for 5-10 min at room temperature (RT) with 0.1% Triton X-100 and blocked for 1 h at RT with TNB buffer (0.1 M Tris–HCl, pH 7.5, 0.15 M NaCl, 0.5% blocking reagent, Perkin Elmer, Waltham, MA). Primary antibody incubations were conducted either for 1-2 h at RT or overnight (o/n) at 4°C. Secondary antibody incubations were conducted for 1 h at RT. Repetitive washes were performed with PBS + 0.05% Tween-20. Stained tissue sections were counterstained for 5 min with 5 μM DAPI and rinsed with PBS. Slides were mounted in Vectashield Hardset mounting medium (Vector Labs, Burlingame, CA) and sealed with nail polish. For whole-mount staining of thick-sectioned tissue pieces, all the incubations, including permeabilization and blocking, were performed o/n at 4°C with gently agitation, and washing steps were extended. Specimens were mounted in glass bottom dishes (Mat-Tek, Ashland, MA).

Immunofluorescence

Fetal bone marrow and fetal liver sections were stained following standard procedures. Antibodies used are indicated in the table below. SLAM staining was performed in bone marrow sections from neonate mice. Slides were first blocked in 20% goat serum in PBS for 45 min. Endogenous avidin and biotin were blocked with an Avidin/Biotin Blocking Kit (Vector Labs) for 30 min with each reagent, washing 3 times with PBS in between. Slides were then incubated with rat anti-mouse CD150 antibody (Biolegend, San Diego, CA) at 1:50 dilution in goat blocking buffer for 2 h, and after washes with goat anti-rat IgG conjugated to Alexa555 (Molecular Probes, Eugene, OR) at 1:200 dilution in 20% goat serum in PBS for 1 h. Slides were then blocked in 20% rat serum in PBS for 10 min and incubated for 1 h with hamster anti-mouse biotin-conjugated CD48 (Abcam, UK) and the Biotin Mouse Lineage Panel (BD Pharmingen, San Jose, CA), which includes rat anti-mouse B220, rat anti-mouse CD3, rat anti-mouse Gr1, rat anti-mouse Mac-1, and rat anti-mouse Ter119 antibodies, each at 1:200 dilution in rat blocking buffer. Cy5-conjugated streptavidin (Molecular Probes) was added at 1:200 in rat blocking buffer for 30 min. Finally, slides were incubated with DAPI (1:1000 dilution of 5 mg/ml stock) for 10 min at room temperature and mounted in Vectashield Mounting Medium (Vector Labs). Antibodies used for Immunohistochemistry:

Imaging

Confocal images of fluorescent staining were acquired with a laser scanning confocal microscope (Zeiss LSM 700, 10×/0.45, 25×/0.85) or with a multi-photon Zeiss LSM 780 microscope (10×/0.7, 20×/1.0). Optical z-stack projections were generated with the Zen2011 software package (Zeiss, Germany) using a maximal intensity algorithm. Wide-field views of whole-mount specimens were imaged with a Leica MZFLIII stereomicroscope equipped with an Olympus DP71 color camera. Images were post-processed and quantified using ImageJ (Schneider et al., 2012) and Photoshop (Adobe, San Jose, CA).

Preparation of fetal and neonatal bone marrow cell suspensions

Fetal skeletal elements were sub-dissected from fetuses, homogenized by cutting, and digested for 15-30 min at 37°C with shaking in 0.25% collagenase (StemCell Technologies, Canada). Postnatal bone specimens were cleaned from surrounding tissue, crushed in a mortar with a pestle, and collagenase-digested for 45-60 min at 37°C, with constant agitation. After enzymatic treatment, skeletal preparations were filtered through a 40-μm cell strainer and undigested bone material was discarded. The resulting bone marrow-enriched cell suspensions were pelleted, washed twice, and resuspended in FACS staining buffer (2% FCS in PBS) for further analysis.

Flow cytometry

Dispersed bone marrow cell preparations were stained in FACS buffer for 15-30 min on ice with selected multicolor antibody cocktails (see below), washed, and resuspended with streptavidin conjugates when necessary. Stained cells were pelleted and resuspended in buffer containing DAPI to exclude dead cells. Cell cycle was analyzed by first isolating defined stromal populations by FACS, and then acquiring the cell cycle profile after staining the sorted populations with Hoechst 33342. Flow cytometry analysis and FACS were done in FACS CantoII or LSRFortessa machines (BD Biosciences) equipped with Diva Software (BD Biosciences) or in a FACS AriaII cell sorter (BD Biosciences). Data were analyzed using Diva and FlowJo (Tree Star, Inc, Eugene, OR). Antibodies used for cytometry:

CFU-F and CFU-OB assays

For fibroblast colony-forming unit (CFU-F) assays, bone marrow cell suspensions were FACS sorted directly into 6-well plates at a cell density of 100–500 cells/cm2 and cultured in maintenance medium (α-MEM/15% FCS with antibiotics). After 10-12 days in culture, adherent cells were fixed with 100% methanol and stained with Giemsa stain (Sigma) to reveal fibroblast clusters. Colonies with more than 50 cells were scored as CFU-Fs. For osteoblast colony-forming unit (CFU-OB) assays, plated cells were cultured in maintenance medium in the presence of 1 mM L-ascorbate-2-phosphate. All cultures were maintained with 5% CO2 in a water-jacketed incubator at 37°C, and medium was changed weekly. After 25 days in culture, cells were fixed and stained with alizarin red or alkaline phosphatase (Isern et al., 2013).

Hematopoietic progenitor assays

Single cell suspensions were prepared from bone marrow and mixed with methylcellulose-containing medium with cytokines (Casanova-Acebes et al., 2013). Cells (5-7.5 × 104) were plated in duplicate 35 mm dishes (Falcon, BD) and incubated under 20% O2 and 5% CO2 in a water-jacketed incubator. Hematopoietic colonies (CFU-Cs) were scored after 6-7 days in culture.

Long-term culture-initiating cell assay

Long-term culture-initiating cell assay was performed as described (Woehrer et al., 2013). Briefly, the feeder fetal stromal cell line AFT024 (kindly provided by Dr. K. Moore) was maintained as previously described (Nolta et al., 2002). One week before use, the feeders were irradiated (15 Gy) with a 137Cs irradiator and seeded in 96-well plates at confluency. After 7-10 days, five serial dilutions (each with 16 replicates) of sorted fetal liver Lin− Sca1+ cells and bone marrow nucleated cells were seeded on the irradiated feeders and cultured with Myelocult M5300 supplemented with 10−6 M hydrocortisone (StemCell Technologies) and 1% penicillin-streptomycin (Invitrogen, Carlsbad, CA). Cultures were maintained for four weeks at 33°C under 20% O2 and 5% CO2 in a water-jacketed incubator. Medium was half-changed weekly. Each well was then trypsinized for 10 min, washed with PBS, and plated for the hematopoietic progenitor assay. Twelve days after plating, the percentage of culture dishes in each experimental group that failed to generate CFU-Cs was plotted against the number of test cells. The frequencies of long-term culture-initiating cells were calculated by the Newton–Raphson method of maximum likelihood and Poisson statistics (using L-CalcTM software; StemCell Technologies) as the reciprocal of the number of test wells that yielded a 37% negative response.

Cell culture and in vitro differentiation

Primary bone marrow cells were obtained from dissected bones using a mortar. All cultures were maintained at 37°C with 20% O2, 5% CO2 in a water-jacketed incubator. To obtain CFU-Fs and CFU-OBs, 0.5 × 106 bone marrow nucleated cells were seeded in each well of a 12-well plate with α-MEM supplemented with 1% penicillin-streptomycin, 15% FBS (Invitrogen), and 1 mM L-ascorbic acid 2-phosphate (Sigma). Half medium was replaced every 5 days. The numbers of CFU-Fs and CFU-OBs were scored after 10 and 28 days in culture, respectively. CFU-F cultures were fixed in methanol for 10 min at room temperature. Cultures were stained with Giemsa diluted 1:10 in phosphate buffer, pH 6.8, for 10 min at 37°C. CFU-F colonies (those with more than 50 cells) were counted the next day. CFU-OB cultures were fixed with 4% paraformaldehyde (PFA) for 5 min at room temperature. von Kossa staining was performed by adding 5% AgNO3 to the culture and exposing plates to UV radiation for 20 min. Cells were then incubated with 5% (NH4)2S2O3 in distilled water for 5 min and counterstained with 2% eosin. For Alizarin Red staining, cells were incubated with 2% alizarin red reagent (Sigma) in distilled H2O for 15 min. For alkaline phosphatase staining, Sigma Fast BCIP/NBT substrate (Sigma) was added to cell cultures followed by incubation in the dark for 15 min.

Nucleic acid purification and qPCR

RNA from CFU-Fs and osteoblast cultures was extracted with Trizol reagent (Sigma-Aldrich) and purified on RNeasy mini columns (Qiagen, Netherlands). An on-column DNase digest (Qiagen) was performed before the clean-up step to eliminate residual genomic DNA. For osteoblast cultures, mRNA was extracted with the Dynabead mRNA DIRECT kit (Invitrogen). cDNA was generated using High Capacity cDNA Reverse Transcription reagents (Applied Biosystems, Waltham, MA). qPCR was performed in triplicate with SYBRgreen Universal PCR Master Mix (Applied Biosystems), using primers optimized for each target gene. The expression level of each gene was determined by using the relative standard curve method. Briefly, a standard curve was performed by doing serial dilutions of a mouse reference total RNA (Clontech, Palo Alto, CA). The expression level of each gene was calculated by interpolation from the standard curve. Relative quantifications of each transcript were obtained by normalizing against Gapdh transcript abundance, using the standard curve method. The sequences of oligonucleotides for qPCR are detailed below.

Primary sphere-forming cultures

For sphere formation, cells were plated at clonal density (<1000 cells/cm2) in ultra-low adherent 35 mm dishes (StemCell Technologies). The growth medium consisted of DMEM/F12 (1:1) mixed 1:2 with human endothelial serum-free medium (Invitrogen) and contained 15% chicken embryo extract, prepared as described (Stemple and Anderson, 1992; Pajtler et al., 2010); 0.1 mM ß-mercaptoethanol; 1% non-essential aminoacids (Sigma); 1% N2 and 2% B27 supplements (Invitrogen); recombinant human fibroblast growth factor (FGF)-basic; recombinant human epidermal growth factor (EGF); recombinant human platelet-derived growth factor (PDGF-AB); recombinant human oncostatin M (227 a.a. OSM) (20 ng/ml); and recombinant human insulin-like growth factor-1 (IGF-1; 40 ng/ml) (Peprotech, Rocky Hill, NJ). The cultures were kept at 37°C under 5% CO2, 20% O2 in a water-jacketed incubator, and were left untouched for one week to prevent cell aggregation in low density cultures. Medium was half-changed weekly. Mesenspheres were scored on days 10–14.

In vitro differentiation of Schwann cells from bone marrow precursors

We used an adaptation of the original method (Biernaskie et al. 2006). Defined stromal populations were isolated based on GFP and Pdgfrα expression from collagenase-treated bone marrow of Nes-Gfp neonates. Sorted cells were plated onto laminin/polylysine-coated chamber slide dishes (Labtek) and allowed to attach and expand in SKP medium I. After 3 days, cells were changed to SKP medium II (containing neuregulin-1 at 50 ng/mL) and allowed to differentiate further for >10 days. In vitro-generated Schwann cells were defined by morphology as thin and elongated cells. After differentiation, cells were fixed in 4% PFA, gently permeabilized with Triton X-100, and stained for immunofluorescence with anti-glial fibrillary acidic protein (Gfap) antibody (Dako, Carpinteria, CA).

In vitro differentiation of bone marrow mesenchymal cells

Defined stromal populations were isolated based on GFP and Pdgfrα expression from collagenase-treated bone marrow of Nes-Gfp neonates and plated directly onto plastic dishes to allow attachment of fibroblasts. Adherent cells were cultured for 7-14 days in regular α-MEM supplemented with 15% FBS. In some cases, recombinant human PDGF was added at 20 ng/mL. At the end of the culture period, cells were fixed and stained with Oil red O to reveal adipocytes and counterstained with hematoxylin.

RNA-Seq

For next-generation sequencing, total RNA was isolated using the Arcturus Picopure RNA isolation kit (Life Technologies, Carlsbad, CA) from small numbers of sorted cells (15,000-80,000), obtained from neonatal Nes-Gfp bone marrow preparations (two biological replicates). Each independent set of samples was obtained from pooled skeletal elements (long bones and sterna) from multiple littermates.

RNA-Seq library production

Amplified cDNA was prepared with the Ovation RNA-Seq System V2 Kit (NuGEN Technologies Inc., San Carlos, CA) followed by sonication and TrueSeq DNA Library Preparation Kit from Illumina. The quality, quantity, and the size distribution of the Illumina libraries were determined using the DNA-1000 Kit (Agilent Bioanalyzer). Libraries were sequenced on a Genome Analyzer II× (Illumina Inc., San Diego, CA) following the standard RNA sequencing protocol with the TruSeq SBS Kit v5. Fastq files containing reads for each library were extracted and demultiplexed using the Casava v1.8.2 pipeline.

RNA-Seq analysis

Sequencing adaptor contaminations were removed from reads using the cutadapt software tool (MIT), and the resulting reads were mapped and quantified on the transcriptome (NCBIM37 Ensembl gene-build 65) using RSEM v1.17 (Li and Dewey, 2011). Only genes with >2 counts per million in ≥2 samples were considered for statistical analysis. Data were then normalized and differential expression assessed using the function Voom from the bioconductor package Limma (Law et al., 2014; Smyth, 2005). We considered those genes as differentially expressed with a Benjamini–Hochberg adjusted p-value ≤0.05.

Principal component analysis (PCA) comparison with previously published data

Normalized RNA-Seq data were compared via principal component analysis (PCA) with previously published array expression data (Table 1). GEO data sets were downloaded and pre-processed using the GEOquery Bioconductor package (Davis and Meltzer, 2007). Data sets were adjusted to the same intensity range, as previously described (Heider and Alt, 2013). Batch correction was applied to the data sets using ComBat (Johnson et al., 2007) on the log2-normalized GEO data sets together with the log2-normalized counts from each RNA-Seq experiment. eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers. Thank you for sending your work entitled “The neural crest is a source of mesenchymal stem cells with specialized hematopoietic stem cell niche function” for consideration at eLife. Your article has been favorably evaluated by Janet Rossant (Senior editor) and 3 reviewers, one of whom is a member of our Board of Reviewing Editors. The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission. While all reviewers concur on the importance of your work and the potential impact in the field, two out of three are not satisfied by the quality of the images that support your conclusions. In a lineage tracing study this is a crucial requirement since, at low magnification, as all the images are, it is very difficult if not impossible to demonstrate co-localisation of the tracer with the tissue specific antigen under observation. Confocal, high magnification analysis would be required to substantiate the results in virtually all the figures presented. Moreover, even at low magnification there are clear inconsistencies: for example expression of CD31 is not known to occur in non-endothelial cells and thus a double staining should have been performed. Also, while Osterix appears not to be expressed in lateral plate derived cells (but very few cells are shown), the co-expression with Wnt1 labeled neural crest is partial and doubtful, making the main conclusion of the whole work particularly weak. In addition all reviewers found the manuscript difficult to read and practically inaccessible to a non-specialised audience. The reviews are included below to assist with your revisions. Reviewer #1: This manuscript reports an interesting and potentially important finding on functional heterogeneity and developmental origin of bone marrow stromal cells. However the main and potentially ground breaking finding, i.e. that Nestin+ MSC are derived from neural crest and support hematopoiesis rather than building the bone itself, is not supported by the data presented, that are of poor quality and do not allow to draw final conclusions on the developmental origin of these cells. Moreover, the manuscript is poorly written, difficult to follow and would greatly benefit from careful editing and, at least in some parts, re-writing. 1) Authors report that a small but increasing fraction of GFP+ also express CD31 and that this fraction increases with age. Since Nestin is not known to be expressed in endothelial cells, a co-staining with also anti-nestin antibody should be performed and co-localization investigated at confocal level, since this bears important implications on the fidelity of the GFP transgene. 2) The text describing data presented in Figure 2B is particularly confusing and almost impossible to interpret: “These mice and newborn Nes-gfp embryos were analyzed for osterix protein expression, which marks cells committed to the osteoblastic lineage. In contrast, cells genetically traced by the regulatory elements of Osterix gene do not only comprise osteoblastic cells, but also adventitial reticular cells, vascular smooth muscle cells, adipocytes and perineural cells (Liu et al., 2013). Unlike cells derived from lateral plate mesoderm, fetal limb bone marrow Nes-GFP+ cells did not express osterix protein (Figure 2A-B) and therefore could not be considered osteoblast precursors.” After describing the Hoxb6-CreERT mice (labelling lateral mesoderm derived cells) the Authors show no co-localization of Nes-GFP and Osterix, and then “presumed” co-localization of Hoxb6 (i.e. lateral plated) derived cells and Osterix (Figure 2B). They conclude that because Nestin-GFP+ cells do not co-localize with Hoxb6 labelled cells they cannot be of lateral plate origin. This is a crucial point and particularly weak. First of all, at the magnification shown it is impossible to draw any conclusion. In A', very few GFP+ cells are visible and in an area where they are quite distant from Osx+ cells. On the other hand, in B' only a very small minority of HoxB6 derived cells express Osx (and at that magnification it is hard to be sure): in most case the colour overlap seems partial, as it may originate from two cells one above the other. Even assuming that there is co-localization in few cells, what about all the others Osx+ cells? Even though recombination is never 100% efficient, one would conclude that the very large majority of Osx expressing cells do not derive from lateral mesoderm. Maybe they originate from paraxial mesoderm, but then another Cre would be required or the origin of Osx expressing cells remains largely unidentified in this work. 3) The overlap between Nestin-GFP and Nestin-Cre derived cells is only minor and, again, at that magnification it is impossible to draw solid conclusions. It is possible that Nestin-Cre derived cells have turned off the expression of Nestin gene, but then what have they become? Conversely, many Nestin-GFP+ do not seem to have originated from cells previously expressing Nestin. Even the example at “high” magnification (Figure 2D) shows one cell (**) that is clearly double labelled and another example (*) where there are two neighbouring but clearly distinct cells. These data are not convincing at all of a reliable lineage tracing. 4) Data on Wnt1-Cre appear more convincing, but again, a high magnification of a double-labelled cell at the confocal level would be necessary, especially for osteocytes (Cartilage staining is quite convincing even at low mag). However, FACS analysis shown in Figure 4E has problems. The Wnt1-Cre/Tomato clearly shows a dim (continuous with background) and a very bright population, both gated together to show that 62% of these are Nes-GFP+. I would have liked to see whether the Nes-GFP+ cells are equally represented in the bright and the dim populations. This is critical because the results are highly dependent on the specific gating. Most importantly, the IF shown in Figure 4D is highly unconvincing and does not support the claim that Nes-GFP+ are derived from Wnt1 expressing cells. The very few Tomato+ cells do not really co-localize with GFP+ cells and the examples shown in D look like at most closely located cells. Finally, the FACS analysis for Sox10-Cre also shows that gating has included both bright cells, clearly separated from the negative peak and the shoulder of this. I would like to see whether the bright cells only are GFP+. 5) The final sections of the Results, though also suffering of the poor quality of the images, are more convincing but less original. Furthermore DTR experiments are tricky, first because killing Nestin expressing cells may have also consequences in other tissue and possibly systemic effects. In addition, and this criticism applies to all of these studies, developmental biologists seem to be unaware of the “bystander effect”, well studied by gene therapists, where killing a specific cell, often causes the death of the nearest cells, thus mudding the results. Reviewer #2: The manuscript by Isern et al describes the results of experiments examining the developmental origins (fetal, neonatal and adult) of the mesenchymal cells that are osteogenic and that support the hematopoietic system in the bone marrow. The experiments mainly utilize the nestin-gfp reporter mouse model in addition to other mouse models in which induced recombination mediated reporter expression defines specific neural crest derived populations. The manuscript is filled with information but it is sometimes difficult to understand how it is related to the main question. For example, it is not explained why CD31 immunostaining is performed on nestin gfp tissues; what cell types does it mark? Convention is the endothelial and hematopoietic cells express CD31, not MSC. The Discussion provides some information about levels of CD31 expression but this comes rather late in the manuscript. In the Results section that describes BM nestin+ cells do not contribute to fetal endochondrogenesis, the RCE reporter is used, what is this? No definition is provided. Also, later in this paragraph, the sentence beginning with “In contrast, cells…” seems misplaced and confusing, making this text and results hard to follow. Similarly, it is not understood why a Wnt Cre line was used. What is the rationale? I seem to miss the connection. It would be helpful to reorganize and perhaps move some information from the main text to the Discussion or leave it out if it is not directly related to the question. It would be helpful to the reader if the manuscript could be more direct in describing the experimental rationale. Altogether, the authors have done a large amount of work to show that there are different component populations of mesenchymal cells that contribute to the development of the long bones, bone marrow and the supportive hematopoietic microenvironment. This is an important set of results that supports a new conceptual model for the development of the hematopoietic supportive microenvironment. Reviewer #3: This manuscript identifies the ontological source of an important bone marrow (BM) niche cells previously identified by the senior author. These cells are the Nestin-GFP+ (Nes-GFP+) cells in the adult BM that are a source of MSC and niche support. The Mendez-Ferrer group has extended this work to the developing fetal and early postnatal bone and observed exciting and enlightening results. They demonstrate that trunk neural crest cells are the developmental source for Nes-GFP+ MSC in the BM, in addition to their known contributions to peripheral sympathetic neurons and Schwann cells. Interestingly, all three of these cells types are important BM niche components. As such they share an ontological relationship that could theoretically extend to other niche components elsewhere in the body. Nes-GFP+ cells were characterized in the developing bone (E17.5), at P0 and at P7 with a variety of lineage tracing and Cre deletion transgenics in addition to cell surface IHC and flow cytometry. From a wide array of models they show: 1) Nes-GFP+ cells do not exhibit osteochondral progenitor activity. Nes-GFP- cells that derive from lateral plate mesoderm possess this activity in fetal bone. 2) Neural crest contribution to postnatal BM-MSCs was definitively demonstrated by genetic fate mapping with Wnt1-Cre2 and Sox10-CreERT2. 3) Cell surface and mRNA-seq studies of PDGFRa+/- and Nes-GFP+/- cells revealed that there are two Nes-GFP+ neural crest derived cells in postnatal BM. Schwann cell precursors are in the PDGFRa- fraction while PDGFRa+ cells contain the MSCs. 4) Neural crest cells migrate along developing nerves to the fetal bone before commitment to the Schwann cell lineage and give rise to niche forming MSCs. 5) Cxcl12 expression was shown to be 80 and 20-fold higher in Nes-GFP+ cells compared to Nes-GFP- and endothelial cells respectively. 6) Conditional deletion of Cxcl12 in Nes-GFP+ cells led to a significant 30% reduction in CFU and a non-significant decrease in repopulating HSC. The experiments are well performed and described. With minor exceptions the figures are clear and well presented. I have only minor suggestions and comments about the paper. The reviewer appreciates the very thoughtful and extensive discussion that attempts to resolve some apparent controversies in the field. I believe the manuscript is a significant contribution the HSC niche field. So many different transgenic strains of mice, here at least 12 gets confusing with all the acronyms and the lack of good explanations, here a table would have helped. Reviewer #1: This manuscript reports an interesting and potentially important finding on functional heterogeneity and developmental origin of bone marrow stromal cells. We thank the reviewer for finding our study interesting and potentially important, and for the suggestions that have helped to improve the paper. However the main and potentially ground breaking finding, i.e. that Nestin+ MSC are derived from neural crest and support hematopoiesis rather than building the bone itself, is not supported by the data presented, that are of poor quality and do not allow to draw final conclusions on the developmental origin of these cells. We apologize if the quality of the images examined was suboptimal. Although we provided images covering wide bone marrow areas to convincingly illustrate our findings, these images also had good resolution and might have lost it during the compression and conversion to pdf. Nevertheless, we now provide insets from low magnification pictures with increased resolution. We have also shown high magnification details to facilitate viewing. We have provided new data that further and fully support the main conclusion of our study already stated in the title that the neural crest is a source of MSCs with a specialized HSC niche function: 1) Higher detail images from triple transgenics showing neural-crest-derived cells co-labeled with Nestin-GFP, providing additional proof of a neural crest origin for a subset of Nestin-GFP+ cells (although other populations marked by Nestin-GFP+ might contain cells from other origins). 2) Functional data showing the enrichment in mesenchymal stem cell activity (CFU-F) and HSC niche features (Cxcl12 mRNA expression) within sorted bone marrow neural-crest-derived stromal cells, which are also enriched in endogenous Nestin mRNA expression. 3) Flow cytometry data showing that the majority of bone marrow cells derived from the neural crest are indeed stromal Nestin-GFP+ cells. Moreover, the manuscript is poorly written, difficult to follow and would greatly benefit from careful editing and, at least in some parts, re-writing. We apologize for this. We have re-written some parts and have revised the whole manuscript to make it more accessible to the broad readership of eLife. Following the suggestion by Reviewer #3, we have also included a table indicating the numerous mouse strains used, to help the reader. 1) Authors report that a small but increasing fraction of GFP+ also express CD31 and that this fraction increases with age. Since Nestin is not known to be expressed in endothelial cells, a co-staining with also anti-nestin antibody should be performed and co-localization investigated at confocal level, since this bears important implications on the fidelity of the GFP transgene. Although nestin was originally identified as a neural stem cell marker in the developing central nervous system (Lendahl U et al. 1990 Cell), later studies have detected nestin expression in many other cell lineages, most pronouncedly during development (for a review, please see Wiese et al. Nestin expression, a property of multi-lineage progenitor cells? Cell Mol Life Sci (2004) vol. 61 (19-20) pp. 2510-22). Many studies have reported nestin expression in endothelial cells, especially in proliferating vascular endothelial cells. Please see (among others): Ono N et al. Dev Cell. 2014 May 12;29(3):330-9. Wroblewski J et al. Differentiation. 1997 Feb;61(3):151-9. Sugawara K et al. Lab Invest. 2002 Mar;82(3):345-51. Mokrý J et al. Stem Cells Dev. 2004 Dec;13(6):658-64. Kim E et al. Invest Ophthalmol Vis Sci. 2014 Jul 17;55(8):5099-108 In fact, nestin has been recently proposed as a marker for newly formed blood vessels (Matsuda et al. World J Gastroenterol (2013) 19 (1) pp. 42-8). In light of this emerging literature, we have carefully analyzed the nestin+ endothelial subset to avoid some potential confusion, although the population of interest was the stromal CD31- Nestin-GFP+ population, which is highly enriched in mesenchymal progenitors. The other reason for using this marker to visualize blood vessels was to substantiate the perivascular or sub-endothelial localization of these mesenchymal progenitors. Regarding the fidelity of the GFP transgene, we already showed in Figure 1F of the manuscript that Nestin-GFP+ cells are clearly enriched in endogenous Nestin mRNA expression. In the new Figure 7J we also show that bone marrow CD45- CD31- Ter119- Tomato+ cells sorted from 1-week old Wnt1-Cre2;R26-tomato;Nes-Gfp triple-transgenic mice are highly enriched in endogenous Nestin expression, compared with bone marrow CD45- CD31- Ter119- Tomato- cells. In the new data provided in new Figure 4D-F we show that the majority of neural crest cells tracked using two different drivers, Wnt1-Cre2 and Sox10-CreER, are in fact Nestin-GFP+ PDGFRa+ MSC-enriched cells which contain most bone marrow mesenchymal activity (CFU-F) at early postnatal stages. All this data convincingly demonstrate endogenous nestin expression in the cell population of interest in this study. 2) The text describing data presented in is particularly confusing and almost impossible to interpret: “These mice and newborn Nes-gfp embryos were analyzed for osterix protein expression, which marks cells committed to the osteoblastic lineage. In contrast, cells genetically traced by the regulatory elements of Osterix gene do not only comprise osteoblastic cells, but also adventitial reticular cells, vascular smooth muscle cells, adipocytes and perineural cells (). Unlike cells derived from lateral plate mesoderm, fetal limb bone marrow Nes-GFP+ cells did not express osterix protein () and therefore could not be considered osteoblast precursors.” Whereas osterix protein marks osteolineage cells, Osterix mRNA or cells marked by the regulatory elements of Osterix promoter do not only contain osteoblastic-committed cells, but also a variety of other cells in the bone marrow, including adventitial reticular cells, vascular smooth muscle cells, adipocytes and perineural cells. This has been clearly shown in a study cited in our manuscript (Liu et al., 2013). This is likely explained by the fact that different stem cells (including MSCs) actively transcribe differentiation factors which are not translated into proteins, which that does not imply lineage commitment but allows them to rapidly differentiate in response to stimuli. This explains some contradictions in the field. We have reworded the corresponding section to reduce confusion. Unlike mesodermal derivatives, Nes-GFP+ did not express highly osterix protein and they did not contribute significantly to fetal osteocytes. We therefore conclude that these cells were not osteoblast precursors (even though they might show Osterix mRNA expression). After describing the Hoxb6-CreERT mice (labelling lateral mesoderm derived cells) the Authors show no co-localization of Nes-GFP and Osterix, and then “presumed” co-localization of Hoxb6 (i.e. lateral plated) derived cells and Osterix (). They conclude that because Nestin-GFP+ cells do not co-localize with Hoxb6 labelled cells they cannot be of lateral plate origin. This is a crucial point and particularly weak. First of all, at the magnification shown it is impossible to draw any conclusion. In A', very few GFP+ cells are visible and in an area where they are quite distant from Osx+ cells. Hoxb6-CreERT line would only label cells that express this transgene at the time that tamoxifen were administered. Together with limited recombination efficiency, this might explain why few GFP+ cells were observed using this mouse line and induction regimen. However, most of these cells labeled with cytoplasmic GFP also had nuclear osterix protein (please be aware of the different location of the fluorescent signal; new Figure 2B in the revised manuscript, also Author response image 1 below). This is in sharp contrast with the virtual absence of osterix protein in stage-matched Nestin-GFP+ cells (new Figure 2A).
Author response image 1.

Expression of osterix by bone marrow cells of the Hoxb6-derived lineage. High magnification detail of E18.5 Hoxb6-CreERT2;RCE bone marrow (BM) stained with anti-osterix (red). Embryos were induced with tamoxifen at E10.5 to trace limb mesoderm with Hoxb6-Cre driver. Asterisks indicate nuclear osterix-positive cells also marked with GFP. Dashed line indicated the bone contour. Scale bar: 50μm.

Expression of osterix by bone marrow cells of the Hoxb6-derived lineage. High magnification detail of E18.5 Hoxb6-CreERT2;RCE bone marrow (BM) stained with anti-osterix (red). Embryos were induced with tamoxifen at E10.5 to trace limb mesoderm with Hoxb6-Cre driver. Asterisks indicate nuclear osterix-positive cells also marked with GFP. Dashed line indicated the bone contour. Scale bar: 50μm. On the other hand, in B' only a very small minority of HoxB6 derived cells express Osx (and at that magnification it is hard to be sure): in most case the colour overlap seems partial, as it may originate from two cells one above the other. Even assuming that there is co-localization in few cells, what about all the others Osx+ cells? Even though recombination is never 100% efficient, one would conclude that the very large majority of Osx expressing cells do not derive from lateral mesoderm. Maybe they originate from paraxial mesoderm, but then another Cre would be required or the origin of Osx expressing cells remains largely unidentified in this work. The degree of recombination using HoxB6-CreER driver line is only partial, which might be due both to the time window when tamoxifen was administered and to limited recombination efficiency by this Cre line. This might underestimate the real contribution of lateral mesoderm to osterix+ cells. Although it is possible, as suggested by the reviewer, that other mesodermal sources contribute to osteoprogenitor cells, this possibility would not affect the conclusions of our paper and also falls outside its current and already wide scope. We have taken the advantage of this genetic system to visualize mesodermal derivatives (in this case, lateral plate) and have demonstrated that this population, unlike Nestin-creER-traced cells, overlaps with embryonic skeletal precursors expressing osterix protein (an accepted marker of osteoprogenitor cells). We have also shown an abundant contribution of mesoderm to mature skeletal cells in long bones. This is in sharp contrast with the virtual absence of osterix protein in the Nestin-GFP+ population and the absence of Nestin-creER-traced fetal osteoblasts or chondrocytes. Therefore the main conclusion of this part, that nestin+ cells do not significantly contribute to fetal osteochondral cells, is fully supported by our data. 3) The overlap between Nestin-GFP and Nestin-Cre derived cells is only minor and, again, at that magnification it is impossible to draw solid conclusions. It is possible that Nestin-Cre derived cells have turned off the expression of Nestin gene, but then what have they become? Conversely, many Nestin-GFP+ do not seem to have originated from cells previously expressing Nestin. Even the example at “high” magnification () shows one cell (**) that is clearly double labelled and another example (*) where there are two neighbouring but clearly distinct cells. These data are not convincing at all of a reliable lineage tracing. The overlap between Nes-GFP+ cells and Nes-creER-traced cells depends on the developmental stage, tamoxifen dose and stage of administration, the time between tamoxifen administration and analysis, and the strength of the reporter mouse. We have replaced former panel 2D, based on KFP mice, a weak reporter line, by the Rosa26-Tomato reporter which provides a much stronger signal. Nes-gfp;Nes-creER;Rosa26-Tomato triple-transgenic mice show a consistent labeling and significant overlap of GFP+ and Tomato+ cells when tamoxifen is administered at perinatal stages and the analysis is performed within few days/weeks. We have provided additional images at higher magnification to better support our conclusions (new Figure 2C-C and Author response image 2).
Author response image 2.

Overlap of Nestin-GFP+ cells with Nestin-CreER-labelled cells in the bone marrow. Representative confocal projections of skull bone marrow, showing the endogenous fluorescent signals of Tomato in red (upper right) and GFP in green (lower right); their corresponding overlay is indicated in orange/yellow. Nestin-gfp;Nestin-CreER;R26-Tomato triple-transgenic mice were treated with tamoxifen (4 mg, oral gavage to mother) at neonatal stage (P0) and were analyzed after 2 weeks. Asterisks indicate double-positive cells.

Overlap of Nestin-GFP+ cells with Nestin-CreER-labelled cells in the bone marrow. Representative confocal projections of skull bone marrow, showing the endogenous fluorescent signals of Tomato in red (upper right) and GFP in green (lower right); their corresponding overlay is indicated in orange/yellow. Nestin-gfp;Nestin-CreER;R26-Tomato triple-transgenic mice were treated with tamoxifen (4 mg, oral gavage to mother) at neonatal stage (P0) and were analyzed after 2 weeks. Asterisks indicate double-positive cells. 4) Data on Wnt1-Cre appear more convincing, but again, a high magnification of a double-labelled cell at the confocal level would be necessary, especially for osteocytes (Cartilage staining is quite convincing even at low mag). We have stained osteocytes with phalloidin in bone marrow sections from Wnt1-Cre2;R26-tomato mice. The pictures shown with high magnification clearly confirm the presence of phalloidin+ neural-crest-traced osteocytes in the neonatal long bones (new Figure 4B). We have also included a complete section of a long bone from Nes-Gfp;Wnt1-Cre2;R26-tomato triple-transgenic mice that does not only illustrate neural-crest-derived chondrocytes in the outermost layer of both diaphyses, but also abundant neural-crest-derived cells in the endosteal bone marrow region (new Figure 4C). However, FACS analysis shown in has problems. The Wnt1-Cre/Tomato clearly shows a dim (continuous with background) and a very bright population, both gated together to show that 62% of these are Nes-GFP+. I would have liked to see whether the Nes-GFP+ cells are equally represented in the bright and the dim populations. This is critical because the results are highly dependent on the specific gating. We have provided the negative control to substantiate the gating strategy (new Figure 4E). We have also reanalyzed the data and have performed additional experiments in Wnt1-Cre2;R26-Tomato;Nes-Gfp triple-transgenic mice analyzed at neonatal stage. As the reviewer states, two stromal populations can be distinguished based on Tomato fluorescence intensity. Although both Tomato+ stromal populations contain Nes-GFP+ PDGFRα+ MSC-enriched cells, these cells are progressively enriched in the Tomatodim population with age (new Figure 4–figure supplement 2C-D). Most importantly, the IF shown in is highly unconvincing and does not support the claim that Nes-GFP+ are derived from Wnt1 expressing cells. The very few Tomato+ cells do not really co-localize with GFP+ cells and the examples shown in D look like at most closely located cells. We admitted in our manuscript the heterogeneity of the Nes-GFP+ population, which does not only contain neural-crest-derived cells but also endothelial cells. In the revised manuscript we have provided more clear images showing Nes-GFP+ Tomato+ cells (new Figure 4C-C and Author response image 3).
Author response image 3.

High magnification confocal image from 1-week old Wnt1-Cre2;Tomato;Nes-Gfp BM section, showing co-localization of NC-derived Tomato+ cell with Nes-GFP (arrowhead).

High magnification confocal image from 1-week old Wnt1-Cre2;Tomato;Nes-Gfp BM section, showing co-localization of NC-derived Tomato+ cell with Nes-GFP (arrowhead). We have performed additional experiments that fully support our main message that neural-crest-derived nestin+ MSCs have a specialized function in forming the HSC niche in the bone marrow. We have analyzed Cxcl12 and Nestin mRNA expression in Tomato+/- GFP+/- bone marrow stromal cells sorted from P7 Wnt1-Cre2;R26-Tomato;Nes-Gfp triple-transgenic mice. Among neural-crest-traced cells, Nes-GFP+ BMSCs were particularly enriched in the expression of Cxcl12 and endogenous Nestin (Figure 7I-J). We have measured MSC activity (CFU-F) in Tomato+/- GFP+/- bone marrow stromal cells sorted from P7 Wnt1-Cre2;R26-Tomato double-transgenic and P7 Wnt1-Cre2;R26-Tomato;Nes-Gfp triple-transgenic mice. When plated at equal cell density, colonies were only detected in the neural-crest-derived cells (new Figure 4D and Figure 4–figure supplement 1F). These results fully support our original contention. Finally, the FACS analysis for Sox10-Cre also shows that gating has included both bright cells, clearly separated from the negative peak and the shoulder of this. I would like to see whether the bright cells only are GFP+. The reviewer is correct that different levels of Tomato intensity were also detected in Sox10-creERT2 mice, but both Tomatobright and Tomatodim bone marrow stromal populations stromal contained Nes-GFP+ PDGFRα+ MSC-enriched cells. We have reanalyzed our data gating on the Tomatobright population, as requested. The Tomatobright population contains a high percentage of Nes-GFP+ cells, also including PDGFRα+ cells (new Figure 4–figure supplement 2E). 5) The final sections of the Results, though also suffering of the poor quality of the images, are more convincing but less original. Furthermore DTR experiments are tricky, first because killing Nestin expressing cells may have also consequences in other tissue and possibly systemic effects. In addition, and this criticism applies to all of these studies, developmental biologists seem to be unaware of the “bystander effect”, well studied by gene therapists, where killing a specific cell, often causes the death of the nearest cells, thus mudding the results. We hope that the revised images show the quality level expected by the reviewer and us. We agree that selective cell depletion experiments might have some bystander effects; for this reason we already showed in our manuscript the normal bone marrow histology and blood vessel architecture of experimental Nes-creERT2;iDTA mice (Figure 7–figure supplement 1B) as a proof of the absence of noticeable bystander effects. To further substantiate this, we have included in the response to the reviewer bone marrow sections of Nestin-CreER;iDTR and control iDTR mice injected with tamoxifen and diphtheria toxin to demonstrate that cell deletion using this inducible Cre line is not associated with noticeable abnormalities in bone marrow histology or vascular leakage of FITC-dextran (green, please see below) previously intravenously injected in the mice (Author response image 4).
Author response image 4.

Intravital microscopy of mice previously injected with FITC-dextran (green) to demonstrate the absence of vascular leakage (upper panels). H & E staining of bone marrow sections showing a normal histology of the bone marrow (lower panels).

Intravital microscopy of mice previously injected with FITC-dextran (green) to demonstrate the absence of vascular leakage (upper panels). H & E staining of bone marrow sections showing a normal histology of the bone marrow (lower panels). Reviewer #2: The manuscript by Isern et al describes the results of experiments examining the developmental origins (fetal, neonatal and adult) of the mesenchymal cells that are osteogenic and that support the hematopoietic system in the bone marrow. The experiments mainly utilize the nestin-gfp reporter mouse model in addition to other mouse models in which induced recombination mediated reporter expression defines specific neural crest derived populations. The manuscript is filled with information but it is sometimes difficult to understand how it is related to the main question. For example, it is not explained why CD31 immunostaining is performed on nestin gfp tissues; what cell types does it mark? Convention is the endothelial and hematopoietic cells express CD31, not MSC. The Discussion provides some information about levels of CD31 expression but this comes rather late in the manuscript. We are currently lacking robust and specific MSC markers for immunofluorescence. We have used CD31 marker for two reasons: 1) To mark blood vessels, since Nes-GFP+ cells are closely associated with them. 2) To distinguish the small fraction of perinatal bone marrow Nes-GFP+ CD31+ cells from the majority of Nes-GFP+ CD31- cells, which contain the population of interest in our study. Please see also Response to Major Comment #1 by Reviewer 1. In the Results section that describes BM nestin+ cells do not contribute to fetal endochondrogenesis, the RCE reporter is used, what is this? No definition is provided. The RCE acronym stands for , an EGFP reporter allele which is expressed upon Cre-mediated recombination from the hybrid CAG promoter in the Rosa26 locus (Sousa et al. Characterization of Nkx6-2-Derived Neocortical Interneuron Lineages. Cerebral Cortex (2009) vol. 19 (Supplement 1) pp. i1-i10). We have defined it as “…a sensitive reporter that drives stronger GFP expression than other reporter lines ()…” . Also, later in this paragraph, the sentence beginning with “In contrast, cells…” seems misplaced and confusing, making this text and results hard to follow. We have moved this to the Discussion and have re-written this paragraph. Please see response to the similar Major Comment #2 by Reviewer 1. Similarly, it is not understood why a Wnt Cre line was used. What is the rationale? I seem to miss the connection. It would be helpful to reorganize and perhaps move some information from the main text to the Discussion or leave it out if it is not directly related to the question. It would be helpful to the reader if the manuscript could be more direct in describing the experimental rationale. We apologize for not being sufficiently clear. We have rewritten the manuscript to better explain the rationale of each single experiment and have made an effort to better link contiguous sections. Altogether, the authors have done a large amount of work to show that there are different component populations of mesenchymal cells that contribute to the development of the long bones, bone marrow and the supportive hematopoietic microenvironment. This is an important set of results that supports a new conceptual model for the development of the hematopoietic supportive microenvironment. We thank the reviewer for considering that our results importantly support a new conceptual model for the establishment of stem cell niches. Reviewer #3: This manuscript identifies the ontological source of an important bone marrow (BM) niche cells previously identified by the senior author. These cells are the Nestin-GFP+ (Nes-GFP+) cells in the adult BM that are a source of MSC and niche support. The Mendez-Ferrer group has extended this work to the developing fetal and early postnatal bone and observed exciting and enlightening results. They demonstrate that trunk neural crest cells are the developmental source for Nes-GFP+ MSC in the BM, in addition to their known contributions to peripheral sympathetic neurons and Schwann cells. Interestingly, all three of these cells types are important BM niche components. As such they share an ontological relationship that could theoretically extend to other niche components elsewhere in the body. Nes-GFP+ cells were characterized in the developing bone (E17.5), at P0 and at P7 with a variety of lineage tracing and Cre deletion transgenics in addition to cell surface IHC and flow cytometry. From a wide array of models they show: 1) Nes-GFP+ cells do not exhibit osteochondral progenitor activity. Nes-GFP- cells that derive from lateral plate mesoderm possess this activity in fetal bone. 2) Neural crest contribution to postnatal BM-MSCs was definitively demonstrated by genetic fate mapping with Wnt1-Cre2 and Sox10-CreERT2. 3) Cell surface and mRNA-seq studies of PDGFRa+/- and Nes-GFP+/- cells revealed that there are two Nes-GFP+ neural crest derived cells in postnatal BM. Schwann cell precursors are in the PDGFRa- fraction while PDGFRa+ cells contain the MSCs. 4) Neural crest cells migrate along developing nerves to the fetal bone before commitment to the Schwann cell lineage and give rise to niche forming MSCs. 5) Cxcl12 expression was shown to be 80 and 20-fold higher in Nes-GFP+ cells compared to Nes-GFP- and endothelial cells respectively. 6) Conditional deletion of Cxcl12 in Nes-GFP+ cells led to a significant 30% reduction in CFU and a non-significant decrease in repopulating HSC. The experiments are well performed and described. With minor exceptions the figures are clear and well presented. I have only minor suggestions and comments about the paper. The reviewer appreciates the very thoughtful and extensive discussion that attempts to resolve some apparent controversies in the field. I believe the manuscript is a significant contribution the HSC niche field. So many different transgenic strains of mice, here at least 12 gets confusing with all the acronyms and the lack of good explanations, here a table would have helped. We thank very much the reviewer for appreciating the relevance of our study and for the very positive criticism. We have included a table containing a detailed summary of all the mouse strains used in supplementary procedures (Supplementary file 3).
NameTypeCompany
THRabbit pAbMillipore
GFAPRabbit pAbDako
CD31Rat mAbBD Pharmingen
S100Rabbit pAbDako
Collagen type IVRabbit pAbMillipore
Ki67Rabbit pAbAbcam
Anti-KFPRabbit pAbEvrogen
CD150Rat mAbBiolegend
CD48ArHm mAbAbcam
Lineage-biotinRat mAbBD Biosciences
Tuj1Mouse mAbPromega
Anti-GFPRabbit pAbAbcam
c-kitgoat pAbR&D
NestinRabbit pAbAbcam
α-SMAMouse mAbSigma
NameCloneCompany
CD45-APC/Cy7104BD Biosciences
CD45-APC104BD Biosciences
CD31-APCMEC 13.3BD Biosciences
Ter119-APCTer119BD Biosciences
CD140a-biotinAPA5eBioscience
CD140a-APCAPA5Biolegend
CD90.2-APC53-2.1eBioscience
Ly6a-PEE13–161.7BD Biosciences
Vcam1-PE429 (MVCAM.A)Biolegend
Streptavidin-PE--BD Biosciences
Lineage cocktail-biotinBD Biosciences
Target geneSymbolForwardReverse
Alkal.Phosphat.AlplCACAATATCAAGGATATCGACGTGAACATCAGTTCTGTTCTTCGGGTACA
OsterixSp7ATGGCGTCCTCTCTGCTTGAGAAGGGTGGGTAGTCATTTG
Runx2Runx2TTACCTACACCCCGCCAGTCTGCTGGTCTGGAAGGGTCC
Rank ligandRanklCAGCATCGCTCTGTTCCTGTACTGCGTTTTCATGGAGTCTCA
GpnmbGpnmbCCCCAAGCACAGACTTTTGAGGCTTTCTGCATCTCCAGCCT
OsteocalcinBglapGGGCAATAAGGTAGTGAACAGGCAGCACAGGTCCTAAATAGT
OsteoglycinOgnACCATAACGACCTGGAATCTGTAACGAGTGTCATTAGCCTTGC
RankRankTGCAGCTCAACAAGGATACGGAGCTGCAGACCACATCTGA
TRAPAcp5CAGCAGCCAAGGAGGACTACACATAGCCCACACCGTTCTC
Cathepsin kCtskGGCCTCTCTTGGCCATACCTTCCCACTCTGGGTAG
Mmp-9Mmp9CGTCGTGATCCCCACTTACTAACACACAGGGTTTGCCTTC
Ppar gammaPpargACCACTCGCATTCCTTTGACTGGGTCAGCTCTTGTGAATG
AdiponectinAdipoqTGTTCCTCTTAATCCTGCCCACCAACCTGCACAAGTTCCCTT
AdipsinCfdTGCATCAACTCAGAGTGTCAATCATGCGCAGATTGCAGGTTGT
Sox9Sox9GAACAGACTCACATCTCTGTGGCAAGTATTGGTCAA
Col2a1Col2a1GTGGAGCAGCAAGAGCAAGGACTTGCCCCACTTACCAGTGTG
AggrecanAcanCACGCTACACCCTGGACTTTGCCATCTCCTCAGCGAAGCAGT
Cxcl12Cxcl12CGCCAAGGTCGTCGCCGTTGGCTCTGGCGATGTGGC
Kit ligandKitlCCCTGAAGACTCGGGCCTACAATTACAAGCGAAATGAGAGCC
Angiopoietin 1Angpt1CTCGTCAGACATTCATCATCCAGCACCTTCTTTAGTGCAAAGGCT
NestinNesGCTGGAACAGAGATTGGAAGGCCAGGATCTGAGCGATCTGAC
  78 in total

1.  Self-renewing human bone marrow mesenspheres promote hematopoietic stem cell expansion.

Authors:  Joan Isern; Beatriz Martín-Antonio; Roshanak Ghazanfari; Ana M Martín; Juan A López; Raquel del Toro; Abel Sánchez-Aguilera; Lorena Arranz; Daniel Martín-Pérez; María Suárez-Lledó; Pedro Marín; Melissa Van Pel; Willem E Fibbe; Jesús Vázquez; Stefan Scheding; Álvaro Urbano-Ispizúa; Simón Méndez-Ferrer
Journal:  Cell Rep       Date:  2013-04-25       Impact factor: 9.423

2.  The AFT024 stromal cell line supports long-term ex vivo maintenance of engrafting multipotent human hematopoietic progenitors.

Authors:  J A Nolta; F T Thiemann; J Arakawa-Hoyt; M A Dao; L W Barsky; K A Moore; I R Lemischka; G M Crooks
Journal:  Leukemia       Date:  2002-03       Impact factor: 11.528

3.  Rhythmic modulation of the hematopoietic niche through neutrophil clearance.

Authors:  María Casanova-Acebes; Christophe Pitaval; Linnea A Weiss; César Nombela-Arrieta; Raphaël Chèvre; Noelia A-González; Yuya Kunisaki; Dachuan Zhang; Nico van Rooijen; Leslie E Silberstein; Christian Weber; Takashi Nagasawa; Paul S Frenette; Antonio Castrillo; Andrés Hidalgo
Journal:  Cell       Date:  2013-05-23       Impact factor: 41.582

4.  Cell biology: tumour stem cells in bone.

Authors:  Mone Zaidi; Simón Méndez-Ferrer
Journal:  Nature       Date:  2013-07-17       Impact factor: 49.962

5.  The widely used Wnt1-Cre transgene causes developmental phenotypes by ectopic activation of Wnt signaling.

Authors:  Ace E Lewis; Harish N Vasudevan; Audrey K O'Neill; Philippe Soriano; Jeffrey O Bush
Journal:  Dev Biol       Date:  2013-05-03       Impact factor: 3.582

6.  CXCL12 in early mesenchymal progenitors is required for haematopoietic stem-cell maintenance.

Authors:  Adam Greenbaum; Yen-Michael S Hsu; Ryan B Day; Laura G Schuettpelz; Matthew J Christopher; Joshua N Borgerding; Takashi Nagasawa; Daniel C Link
Journal:  Nature       Date:  2013-02-24       Impact factor: 49.962

7.  Origins and properties of dental, thymic, and bone marrow mesenchymal cells and their stem cells.

Authors:  Yukiya Komada; Toshiyuki Yamane; Daiji Kadota; Kana Isono; Nobuyuki Takakura; Shin-Ichi Hayashi; Hidetoshi Yamazaki
Journal:  PLoS One       Date:  2012-11-21       Impact factor: 3.240

8.  virtualArray: a R/bioconductor package to merge raw data from different microarray platforms.

Authors:  Andreas Heider; Rüdiger Alt
Journal:  BMC Bioinformatics       Date:  2013-03-02       Impact factor: 3.169

9.  PDGFRα and CD51 mark human nestin+ sphere-forming mesenchymal stem cells capable of hematopoietic progenitor cell expansion.

Authors:  Sandra Pinho; Julie Lacombe; Maher Hanoun; Toshihide Mizoguchi; Ingmar Bruns; Yuya Kunisaki; Paul S Frenette
Journal:  J Exp Med       Date:  2013-06-17       Impact factor: 14.307

10.  Ptpn11 deletion in a novel progenitor causes metachondromatosis by inducing hedgehog signalling.

Authors:  Wentian Yang; Jianguo Wang; Douglas C Moore; Haipei Liang; Mark Dooner; Qian Wu; Richard Terek; Qian Chen; Michael G Ehrlich; Peter J Quesenberry; Benjamin G Neel
Journal:  Nature       Date:  2013-07-17       Impact factor: 49.962

View more
  117 in total

Review 1.  Three dimensional de novo micro bone marrow and its versatile application in drug screening and regenerative medicine.

Authors:  Guanqun Li; Xujun Liu; Qian Du; Mei Gao; Jing An
Journal:  Exp Biol Med (Maywood)       Date:  2015-08

Review 2.  Adhesion receptors involved in HSC and early-B cell interactions with bone marrow microenvironment.

Authors:  Maria De Grandis; Anne-Catherine Lhoumeau; Stéphane J C Mancini; Michel Aurrand-Lions
Journal:  Cell Mol Life Sci       Date:  2016-02       Impact factor: 9.261

Review 3.  Neural Crossroads in the Hematopoietic Stem Cell Niche.

Authors:  Sobhika Agarwala; Owen J Tamplin
Journal:  Trends Cell Biol       Date:  2018-05-29       Impact factor: 20.808

Review 4.  Haematopoietic stem cell activity and interactions with the niche.

Authors:  Sandra Pinho; Paul S Frenette
Journal:  Nat Rev Mol Cell Biol       Date:  2019-05       Impact factor: 94.444

Review 5.  Adult haematopoietic stem cell niches.

Authors:  Genevieve M Crane; Elise Jeffery; Sean J Morrison
Journal:  Nat Rev Immunol       Date:  2017-06-12       Impact factor: 53.106

6.  Snail/Slug-YAP/TAZ complexes cooperatively regulate mesenchymal stem cell function and bone formation.

Authors:  Yi Tang; Stephen J Weiss
Journal:  Cell Cycle       Date:  2017-01-23       Impact factor: 4.534

7.  Dysregulated megakaryocyte distribution associated with nestin+ mesenchymal stem cells in immune thrombocytopenia.

Authors:  Min Wang; Ru Feng; Jia-Min Zhang; Lin-Lin Xu; Fei-Er Feng; Chen-Cong Wang; Qian-Ming Wang; Xiao-Lu Zhu; Yun He; Jing Xue; Hai-Xia Fu; Meng Lv; Yuan Kong; Ying-Jun Chang; Lan-Ping Xu; Kai-Yan Liu; Xiao-Jun Huang; Xiao-Hui Zhang
Journal:  Blood Adv       Date:  2019-05-14

Review 8.  Extrinsic regulation of hematopoietic stem cells in development, homeostasis and diseases.

Authors:  Yeojin Lee; Matthew Decker; Heather Lee; Lei Ding
Journal:  Wiley Interdiscip Rev Dev Biol       Date:  2017-05-31       Impact factor: 5.814

Review 9.  Where Hematopoietic Stem Cells Live: The Bone Marrow Niche.

Authors:  Krzysztof Szade; Gunsagar S Gulati; Charles K F Chan; Kevin S Kao; Masanori Miyanishi; Kristopher D Marjon; Rahul Sinha; Benson M George; James Y Chen; Irving L Weissman
Journal:  Antioxid Redox Signal       Date:  2018-01-09       Impact factor: 8.401

10.  Engineered Mesenchymal Stem Cells as an Anti-Cancer Trojan Horse.

Authors:  Adam Nowakowski; Katarzyna Drela; Justyna Rozycka; Miroslaw Janowski; Barbara Lukomska
Journal:  Stem Cells Dev       Date:  2016-09-07       Impact factor: 3.272

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.