Literature DB >> 25249781

Detection and characterization of Wolbachia infection in silkworm.

Xingfu Zha1, Wenji Zhang1, Chunyan Zhou1, Liying Zhang1, Zhonghuai Xiang1, Qingyou Xia1.   

Abstract

Wolbachia naturally infects a wide variety of arthropods, where it plays important roles in host reproduction. It was previously reported that Wolbachia did not infect silkworm. By means of PCR and sequencing we found in this study that Wolbachia is indeed present in silkworm. Phylogenetic analysis indicates that Wolbachia infection in silkworm may have occurred via transfer from parasitic wasps. Furthermore, Southern blotting results suggest a lateral transfer of the wsp gene into the genomes of some wild silkworms. By antibiotic treatments, we found that tetracycline and ciprofloxacin can eliminate Wolbachia in the silkworm and Wolbachia is important to ovary development of silkworm. These results provide clues towards a more comprehensive understanding of the interaction between Wolbachia and silkworm and possibly other lepidopteran insects.

Entities:  

Keywords:  Wolbachia; antibiotics; silkworm; wsp

Year:  2014        PMID: 25249781      PMCID: PMC4171764          DOI: 10.1590/s1415-47572014000400014

Source DB:  PubMed          Journal:  Genet Mol Biol        ISSN: 1415-4757            Impact factor:   1.771


Introduction

Wolbachia is a cytoplasmically inherited rickettsia that was found in a wide range of arthropods (Jeyaprakash and Hoy, 2000; Werren and Windsor, 2000; Hilgenboecker ). Infections were detected in all of the major insect orders, including Coleoptera, Diptera, Hemiptera/Homoptera, Hymenoptera, Lepidoptera, and Orthoptera (Werren and Windsor, 2000). Wolbachia can regulate host reproduction via cytoplasmic incompatibility (CI), feminization, parthenogenesis and male killing (Werren ; Blagrove ). Zhou established a general naming system basing on the sequence of the wsp gene, a single copy gene coding for an outer membrane protein of Wolbachia. They classified Wolbachia into two supergroups, supergroup A and B, and within these a total of eight potential groups could be recognized within the A group and four within group B. As wsp shows relatively high genetic divergence among these strains, the gene has been used extensively in phylogenetic analyses and for microtaxonomic subdivision (Van Meer ; Baldo ). Several recent studies using FISH or Southern blotting methods reported that Wolbachia genes have been horizontally transferred to host chromosomes (Kondo ; Nikoh ). Such events are present in a variety of insects, including the fruit fly Drosophila ananassae, a parasitoid wasp of the genus Nasonia, the mosquito Aedes aegypti, the pea aphid Acyrthosiphon pisum, the longicorn beetle Monochamus alternates, and the adzuki bean beetle Callosobruchus chinensis (Dunning Hottop et al., 2007; Klasson ; Nikoh and Nakabachi, 2009). In order to identify the function of Wolbachia in its host, a frequently used method is the elimination of Wolbachia through the use of selective antibiotics (Kuriwada ; Voronin ). Fytrou found that Wolbachia-infected Drosophila simulans showed a reduced ability to encapsulate parasitoid eggs compared to a tetracycline-treated, bacterium-free line. Chen used tetracycline to eliminate Wolbachia in the rice water weevil, Lissorhoptrus oryzophilus, showing that Wolbachia is necessary for its host’s oocyte production. The silkworm, Bombyx mori, is an economically important lepidopteran insect, domesticated from the wild silkworm Bombyx mandarina, which occurs in a range from India to China, Korea, Japan and far into the eastern regions of Russia (Goldsmith ). Despite its economic importance, surprisingly few studies focused on Wolbachia in the silkworm. One reason may be that Wolbachia was not detected in the silkworm strains used in previous studies (Puttaraju and Madhu, 2002; Prakash and Puttaraju, 2007). In this study, we amplified the Wolbachia-specific wsp gene in silkworm by PCR and cloned the gene. Our results indicate that Wolbachia is present in several strains of silkworm and antibiotics treatment revealed that Wolbachia plays an important role in silkworm ovary development.

Materials and Methods

Silkworm samples

The silkworms examined in this study, information about strain and collection locations are listed in Supplementary material Table S1. Samples of adult silkworm moths were collected in 2008 and stored in absolute ethanol at −80 °C. Total DNA of was extracted from each single strain (one individual per sample). DNA extraction was performed by using the QIAamp DNA Mini kit (Qiagen) for PCR amplification or by a standard proteinase K/SDS/phenol/chloroform extraction procedure for Southern blotting (Green and Sambrook, 2012).

PCR and cloning of the wsp gene

Wolbachia infection was detected by polymerase chain reaction (PCR) using the following wsp-specifc primers: wsp-81F (5′-TGGTCCAATAAGTGATGAAGA AAC-3′), wsp-691R (5′-AAAAATTAAACGCTACTC CA-3′) (Braig ; Zhou ), resulting in an amplified DNA fragment of about 600 bp. PCR amplications were performed in 25 μL reactions containing 1 μL of DNA, 2.5 μL 10x reaction buffer, 2.0 μL MgCl2 (25 mM), 1 μL dNTPs (25 uM), 0.2 μLof Taq polymerase (Takara) and 18.3 μL water. PCRs were run under the following cycling conditions: 94 °C for 4 min, followed by 30 cycles of 40 s at 94 °C, 40 s at 55 °C, 1 min at 72 °C and a final extension step of 10 min at 72 °C. The PCR products were electrophoresed on a 1% agarose gel to determine the presence and general size of the amplified DNA. Considering the possibility of false positive PCR results, all the amplified PCR fragments were sequenced. For this, PCR products were purified by a Gel Extraction Kit (Omega) and purified DNA was ligated into a pMD18-T vector (Takara) for transformation of Escherichia coli DH5a competent cells. Positive clones were picked and sequenced. An additional strategy to detect Wolbachia infection was to design specific primers for the Wolbachia ftsZ gene: ftsZ-F: TACTGACTGTTGGAGTTGTAACTAAGCCGT and ftsZ-R: TGCCAGTTGCAAGAACAGAAACTCTAACTC. The resulting PCR fragments were cloned and sequenced in the same way.

Phylogenetic analysis

All Wolbachia wsp gene sequences obtained in this study were aligned by using the program package ClustalW (Thompson ) or MEGA3.1 (Kumar ). Sequences downloaded from GenBank representing all currently known supergroups of Wolbachia were included in the analysis (Table S2). Phylogenetic analyses were conducted by the Neighbour-Joining algorithm. Bootstrap probabilities were assessed by generating 1000 bootstrap replicates.

Southern blotting analysis

DNA probes for Southern blotting were synthesized by PCR amplification from recombinant wsp plasmid DNA as template using the same wsp gene specific primers. The amplification products were electrophoresed in 1% agarose gels and purified. Digoxigenin labeling was done by using the DIG Random Primed DNA Labeling Kit (Roche). Genomic DNA preparations of Bombyx mori Dazao and wild silkworms were digested with HindIII restriction enzyme. The digested DNA samples of 25–30 μg were electrophoresed in 0.8% agarose gels. Plasmid DNA of recombinant wsp gene vector was used as positive control. The separated DNA fragments were transferred to nylon membranes and fixed by UV cross-linking. Hybridization, stringency washes and detection were performed by using the DIG Detection Kit (Roche) following the manufacturer’s manual.

Antibiotic treatment

The Bombyx mori strain Dazao used in this experiment was provided by the Silkworm Gene Resource of Southwest University. Silkworm larvae were reared under standard conditions. Antibiotics used included tetracycline, rifampicin, ciprofloxacin and penicillin (Table S3). Antibiotics were dissolved in double-distilled water at a concentration of 100 mg/mL. After the first day of pupation, each silkworm was injected with a volume of 10 μL(1mgofthe antibiotic) into the eighth abdominal segment by using needles pulled from glass capillaries. Negative-control silk-worms were injected with the same volume of water. Individual silkworms were collected 10 days after injection and DNA was extracted as per the above described protocol. Quantitative PCR was used to determine Wolbachia abundance in silkworms. In order to understand the effect of antibiotic treatment, Wolbachia density of untreated samples (Infection free) was also detected by Quantitative PCR. Given a probable side effect of a high dose of antibiotic, injections were also done with a lower dose of tetracycline (10 mg/mL). Injection volume, time and location were the same as in the former experiment. Furthermore, tetracycline-injected female and male silkworms were mated and the F1 generation was reared to assess the ovary phenotype adult F1 females.

Quantitative PCR

The abundance of Wolbachia after antibiotic treatments was determined by quantitative PCR. Platinum SYBR green qPCR SuperMix-UDG (Invitrogen) was used according to the manufacturer’s protocol. Real-time quantitative PCR was performed using the ABI Prism 7000 Sequence Detection System (Applied Biosystems). Primer sequences corresponded to regions of the Bombyx mori reference gene sw22934 (Wang ) and the Wolbachia wsp gene. The sw22934 primer sequences used were 5′-TTCGTACTGGCTCTTCTCGT-3′ and 5′-CAAAGTTGATAGCAATTCCCT-3′, while the wsp primer sequences were 5′-AGATAGTGTAACAGCGTT TTCAGGAT-3′ and 5′-CACCATAAGAACCAAAAT AACGAG-3′. Template-free qPCRs were included as negative controls. Positive controls for the reference gene and Wolbachia were also included in each qPCR run. The instrument was programmed to provide initial enzyme activation at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 31 s. Amplification efficiency was calculated according to the method of Tichopad .

Results

Screening for Wolbachia infections in silkworm populations

By means of a PCR approach using the general wsp-specific primers we screened a total of 21 samples of silk-worms for the presence of Wolbachia. The samples were collected in seven provinces of China (Chongqing, Yunnan, Sichuan, Shandong, Zhejiang, Jiangsu and Guangdong) and represented two types of silkworms (domesticated and wild silkworms). The results showed that PCR amplification products with the expected size of about 600 bp were observed (Figure 1). In order to confirm PCR products, we cloned and sequenced the fragments, showing that the 21 silkworm samples share high sequence similarity with differences in only a few sites (Figures S1 and S2). Taken together, these results demonstrate that wsp gene fragments could be amplified in all 21 silkworm samples. The sequence of the silkworm wsp gene was submitted to GenBank (Acc. No. KJ659909). Homology searches with BLASTn indicated that the sequence in the Dali wild silk-worm sample were the best hit to the wsp gene of Wolbachia in Orius minutus (Tsukuba), with 98% identity. Additionally, PCR assays were carried out by using ftsZ-specific primers in wild silkworm Dali and Dazao (Figure 1C), and the sequencing results showed that the PCR bands were indeed the ftsZ gene of Wolbachia. The sequence of ftsZ was also submitted to GenBank (Acc. No. KJ659910). In conclusion, the PCR results for the wsp and ftsZ genes are evidence that there are Wolbachia infections in silkworm.
Figure 1

PCR screening for the presence of Wolbachia in silkworms. (A) PCR screening for wsp gene in the samples of domesticated silkworms. Lane M represents DL2000 plus DNA marker. Lanes 1–10 represent domesticated silkworm samples from the following strains: lane 1, 871; lane 2, 932; lane 3, 7532; lane 4, Xianghui; lane 5, Yue; lane 6, Hang7; lane 7, Shi7; lane 8, Feng9; lane 9, Furong; lane 10, Yan7. Lanes 11 and 12 represent female and male samples from the strain Dazao, respectively. (B) PCR screening for the wsp gene in samples of wild silkworms. Lane M represents DL2000 plus DNA marker. Lanes 1–10 represent wild silk-worm samples from the following areas: lane 1, Dali; 2, Nanchong; 3, Peng’an; 4, Pingdu; 5, Qingmuguang; 6, Haining; 7, Xichang; 8, Huzhou; 9, Zhenjiang; 10, Rongchang. (C) PCR screening for the ftsZ gene in samples of silkworm. Lane M represents DL2000 plus DNA marker. Lane 1, Dali; 2, Dazao. All PCR fragments were cloned and sequenced. Sequencing results showed that the bigger bands in lanes 1–12 are fragments of the wsp (A, B) or ftsZ genes (C), whereas the second, smaller band in lanes was non-specifical PCR product.

PCR screening for the presence of Wolbachia in silkworms. (A) PCR screening for wsp gene in the samples of domesticated silkworms. Lane M represents DL2000 plus DNA marker. Lanes 1–10 represent domesticated silkworm samples from the following strains: lane 1, 871; lane 2, 932; lane 3, 7532; lane 4, Xianghui; lane 5, Yue; lane 6, Hang7; lane 7, Shi7; lane 8, Feng9; lane 9, Furong; lane 10, Yan7. Lanes 11 and 12 represent female and male samples from the strain Dazao, respectively. (B) PCR screening for the wsp gene in samples of wild silkworms. Lane M represents DL2000 plus DNA marker. Lanes 1–10 represent wild silk-worm samples from the following areas: lane 1, Dali; 2, Nanchong; 3, Peng’an; 4, Pingdu; 5, Qingmuguang; 6, Haining; 7, Xichang; 8, Huzhou; 9, Zhenjiang; 10, Rongchang. (C) PCR screening for the ftsZ gene in samples of silkworm. Lane M represents DL2000 plus DNA marker. Lane 1, Dali; 2, Dazao. All PCR fragments were cloned and sequenced. Sequencing results showed that the bigger bands in lanes 1–12 are fragments of the wsp (A, B) or ftsZ genes (C), whereas the second, smaller band in lanes was non-specifical PCR product. Based on previous reports (Zhou ; Van Meer ), we downloaded 41 wsp sequences of Wolbachia as a data set (Table S2). First, we merged our wsp sequence from the sample of Dali wild silkworm with the data set and performed a phylogenetic analysis. The topology confirmed the division of Wolbachia into the two supergroups A and B, showing that our Wolbachia belongs to supergroup B (Figure 2). Wolbachia strains from Lepidoptera E. kuehniella, E. cautella and silkworm appeared to cluster in different groups. Interestingly, Wolbachia from silkworm was closely related to that of the parasitic wasp T. bedeguaris. Considering the possibility of a horizontal transmission of Wolbachia (Perlman ) we hypothesize that Wolbachia detected in wild silkworm may have come from Hymenoptera, such as T. confusum, T. bedeguaris or others. Further experiments are, of course, required to test this hypothesis of horizontal transmission. In a next step we constructed a phylogenetic tree based on our 21 wsp sequences, showing that Wolbachia identified in domesticated and wild silkworms are quite similar to each other (Figure 3), indicating that Wolbachia had infected certain silkworms before strains of this species were domesticated.
Figure 2

Phylogenetic tree of Wolbachia based on wsp gene sequences. The name of the host arthropod species was followed by the group designation. The name ‘Bombyx mandarina(Dali)’ represents Wolbachia in wild silkworm from Dali in Yunnan. The tree was constructed by the Neighbour-Joining algorithm. Numbers on the nodes indicated percentages of 1,000 bootstrap replicates.

Figure 3

Phylogenetic tree of Wolbachia in silkworms. All 21 wsp sequences from samples of silkworms were used to construct the tree.

Phylogenetic tree of Wolbachia based on wsp gene sequences. The name of the host arthropod species was followed by the group designation. The name ‘Bombyx mandarina(Dali)’ represents Wolbachia in wild silkworm from Dali in Yunnan. The tree was constructed by the Neighbour-Joining algorithm. Numbers on the nodes indicated percentages of 1,000 bootstrap replicates. Phylogenetic tree of Wolbachia in silkworms. All 21 wsp sequences from samples of silkworms were used to construct the tree.

Lateral transfer

It was previously reported that Wolbachia genes could laterally transfer into host chromosomes (Kondo ; Fenn ; Nikoh ). The genome sequence of the silkworm, Bombyx mori, has been completed, and the strain for sequencing was Dazao (Xia ; International Silkworm Genome Consortium, 2008). In order to confirm whether Wolbachia genes may have undergone a transfer into the silkworm genome, we performed a BLAST search by using Wolbachia gene sequences to query a database of silkworm genomic sequences. The results indicated that the complete genome of the silkworm Dazao contained no Wolbachia sequence (data not shown). To further confirm this result, we performed Southern blotting by using the wsp gene sequence as probe. This analysis showed that no wsp hybridization signal was detected in the Dazao genome, but was clearly apparent in the wild type silkworms of Huzhou, Xichan and Pingdu (Figure 4). Since Southern blotting had also previously been used to identify horizontal transfer of Wolbachia (Nikoh ), we speculate that Wolbachia did not transfer into the Dazao genome, but that a wsp gene had done so in the wild silkworm genomes of Huzhou, Xichan and Pingdu.
Figure 4

Southern blotting analysis of the wsp gene using genomic DNA from different Wolbachia infected silkworms. The blot was hybridized with a probe corresponding to the wsp gene. Lane C represents a positive control from plasmid DNA of a recombinant wsp gene. Lanes 1–3 represent wild silkworm samples from Huzhou, Xichan and Pingdu, respectively. Lane 4 represents F1 silkworms from a Male x Female cross. Lanes 5 and 6 represent female and male samples of the Dazao strain, respectively.

Southern blotting analysis of the wsp gene using genomic DNA from different Wolbachia infected silkworms. The blot was hybridized with a probe corresponding to the wsp gene. Lane C represents a positive control from plasmid DNA of a recombinant wsp gene. Lanes 1–3 represent wild silkworm samples from Huzhou, Xichan and Pingdu, respectively. Lane 4 represents F1 silkworms from a Male x Female cross. Lanes 5 and 6 represent female and male samples of the Dazao strain, respectively.

Effects of Wolbachia on silkworm ovary development

In this study, we used four kinds of antibiotics, tetracycline, penicillin, rifampin and ciprofloxacin (Table S3). These were respectively injected into the body of 30 silk-worms (half male, half female silkworms). The injected dose was 1 mg per individual. After injection, the survival rate was 100% in all experimental groups. But while in four groups (rifampicin, penicillin, autoclaved H2O and untreated controls) the silkworms could all normally emerge as adult moths, those injected with tetracycline or ciprofloxacin did not. By dissecting silkworms injected with tetracycline or ciprofloxacin we noted an abnormal ovary phenotype in female moths with a frequency of 93% and more (Table S3). Oviducts lacked the typical structure and were clearly shorter. The number of developing eggs was also lower than in the control groups (Figure 5). In order to verify the elimination of Wolbachia by the antibiotics, we performed quantitative PCR assays using wsp primers, this showing showed that the density of Wolbachia in the group injected with tetracycline or ciprofloxacin was strongly decreased (Figure 6). These results indicated that tetracycline and ciprofloxacin could dramatically reduce the density of Wolbachia in silkworm, and that the presence of Wolbachia is important for normal development of the ovary.
Figure 5

Phenotype of ovaries after antibiotic treatments. The two groups of H2O and untreated were used as control. The groups of tetracycline and ciprofloxacin treatment showed an abnormal ovary phenotype compared with that in the control groups.

Figure 6

Relative Wolbachia abundance after antibiotic treatments. The graphs show Wolbachia abundance relative to the host silkworm reference gene (sw22934) as determined by quantitative PCR. The error bars represent standard deviations.

Phenotype of ovaries after antibiotic treatments. The two groups of H2O and untreated were used as control. The groups of tetracycline and ciprofloxacin treatment showed an abnormal ovary phenotype compared with that in the control groups. Relative Wolbachia abundance after antibiotic treatments. The graphs show Wolbachia abundance relative to the host silkworm reference gene (sw22934) as determined by quantitative PCR. The error bars represent standard deviations. In view of a probable side effect of a high dose of antibiotic treatment, we repeated the experiment injecting a lower dose of tetracycline (0.1 mg per individual). In this experiment, silkworms were furthermore mated to obtain an F1 generation. Compared with the control group, nearly 29% of the F1 females still showed an abnormal ovary morphology (Figure 7), putting in evidence that a lower dose of tetracycline, for which no or less of a side effect was expected, lead to a similar effect.
Figure 7

Ovary phenotype of F1 generation females after tetracycline treatment. The injected H2O group was used as control. Tetracycline was injected with a lower dose of 0.1 mg per silkworm. After antibiotic treatments, tetracycline-injected females were crossed with tetracycline-injected males. The F1 generation was reared and used to identify the ovary phenotype. Nearly 29% of the F1 female still showed an abnormal ovary morphology.

Ovary phenotype of F1 generation females after tetracycline treatment. The injected H2O group was used as control. Tetracycline was injected with a lower dose of 0.1 mg per silkworm. After antibiotic treatments, tetracycline-injected females were crossed with tetracycline-injected males. The F1 generation was reared and used to identify the ovary phenotype. Nearly 29% of the F1 female still showed an abnormal ovary morphology.

Discussion

Wolbachia infects a wide variety of insects and plays important roles in host reproduction. As it was previously reported that Wolbachia was not detected in silkworm (Puttaraju and Madhu, 2002; Prakash and Puttaraju, 2007), we conducted a study on both wild type and domesticated silkworm strains using PCR assays for the Wolbachia-specific wsp gene and subsequent sequencing. This is the first study to detect the presence of Wolbachia in silkworm. Interestingly, in the PCR screening of the wsp gene we found that the band of a PCR fragment in lanes 1 and 6–8 in Figure 1B showed a stronger signal, suggesting that the wsp gene could easily be amplified and detected by PCR in these four samples. It has previously been reported that Wolbachia infections in some species could be detected by common PCR, while in others long PCR assays under strict conditions were necessary (Jeyaprakash and Hoy, 2000). These results may imply a difference in the density of Wolbachia infecting the hosts. As reported, Wolbachia can play important roles in lepidopteran insects. In the butterfly Eurema hecabe, a female-biased sex-ratio distortion was observed due to feminization of genetic males by Wolbachia (Hiroki ). In the Mediterranean flour moth, Ephestia kuehniella Lewis showed that Wolbachia-infected males transfer fewer fertile sperm at mating than un-infected ones in their heteromorphic, sperm, and that Wolbachia may affect fertile sperm production. In the adzuki bean borer, Ostrinia scapulalis (Walker), Wolbachia selectively kills male progeny. This Wolbachia strain appears to have a feminizing effect since antibiotic treatment of infected female moths gave rise to male progeny with sexually mosaic phenotypes (Kageyama ). In Wolbachia-induced sexual mosaics of O. scapulalis, which are genetically male, the female-specific isoform of the sex determining gene Osdsx was shown to be expressed in addition to the male-specific isoform (Sugimoto ). This finding indicated that Wolbachia manipulates the sex of its host by interfering either with the sex-specific splicing of Osdsx itself or with another upstream sex determination process.. By injection of different antibiotics for elimination of Wolbachia in the silkworm, we could show that the elimination of large amounts of Wolbachia by tetracycline and ciprofloxacin can, cause abnormal development of the silkworm ovary. Apparently, Wolbachia thus plays an important role in silkworm ovary development and that the biological role of Wolbachia in silkworm is different from that in other lepidopteran insects. These results provide some first clues to address the role of Wolbachia silkworm biology and possibly also in other lepidopteran insects.

Supplementary Material

The following online material is available for this article: Figure S1 - Alignment of wsp sequences from Wolbachia infecting wild silkworms. Figure S2 - Alignment of wsp sequences from Wolbachia infecting domesticated silkworms. Table S1 - Strains of the silkworms used in this study. Table S2 - Sequences of wsp genes downloaded from GenBank. Table S3 - Statistics of experimental treatment with four antibiotics. This material is available as part of the online article from http://www.scielo.br/gmb.
  32 in total

1.  Presence of Wolbachia endosymbionts in different silkworm species and races and in their uzi fly parasites.

Authors:  H P Puttaraju; M Madhu
Journal:  J Invertebr Pathol       Date:  2002-02       Impact factor: 2.841

2.  Standardized determination of real-time PCR efficiency from a single reaction set-up.

Authors:  Ales Tichopad; Michael Dilger; Gerhard Schwarz; Michael W Pfaffl
Journal:  Nucleic Acids Res       Date:  2003-10-15       Impact factor: 16.971

3.  Expression of a doublesex homologue is altered in sexual mosaics of Ostrinia scapulalis moths infected with Wolbachia.

Authors:  Takafumi N Sugimoto; Takeshi Fujii; Takumi Kayukawa; Hironori Sakamoto; Yukio Ishikawa
Journal:  Insect Biochem Mol Biol       Date:  2010-08-20       Impact factor: 4.714

4.  A draft sequence for the genome of the domesticated silkworm (Bombyx mori).

Authors:  Qingyou Xia; Zeyang Zhou; Cheng Lu; Daojun Cheng; Fangyin Dai; Bin Li; Ping Zhao; Xingfu Zha; Tingcai Cheng; Chunli Chai; Guoqing Pan; Jinshan Xu; Chun Liu; Ying Lin; Jifeng Qian; Yong Hou; Zhengli Wu; Guanrong Li; Minhui Pan; Chunfeng Li; Yihong Shen; Xiqian Lan; Lianwei Yuan; Tian Li; Hanfu Xu; Guangwei Yang; Yongji Wan; Yong Zhu; Maode Yu; Weide Shen; Dayang Wu; Zhonghuai Xiang; Jun Yu; Jun Wang; Ruiqiang Li; Jianping Shi; Heng Li; Guangyuan Li; Jianning Su; Xiaoling Wang; Guoqing Li; Zengjin Zhang; Qingfa Wu; Jun Li; Qingpeng Zhang; Ning Wei; Jianzhe Xu; Haibo Sun; Le Dong; Dongyuan Liu; Shengli Zhao; Xiaolan Zhao; Qingshun Meng; Fengdi Lan; Xiangang Huang; Yuanzhe Li; Lin Fang; Changfeng Li; Dawei Li; Yongqiao Sun; Zhenpeng Zhang; Zheng Yang; Yanqing Huang; Yan Xi; Qiuhui Qi; Dandan He; Haiyan Huang; Xiaowei Zhang; Zhiqiang Wang; Wenjie Li; Yuzhu Cao; Yingpu Yu; Hong Yu; Jinhong Li; Jiehua Ye; Huan Chen; Yan Zhou; Bin Liu; Jing Wang; Jia Ye; Hai Ji; Shengting Li; Peixiang Ni; Jianguo Zhang; Yong Zhang; Hongkun Zheng; Bingyu Mao; Wen Wang; Chen Ye; Songgang Li; Jian Wang; Gane Ka-Shu Wong; Huanming Yang
Journal:  Science       Date:  2004-12-10       Impact factor: 47.728

5.  Genome fragment of Wolbachia endosymbiont transferred to X chromosome of host insect.

Authors:  Natsuko Kondo; Naruo Nikoh; Nobuyuki Ijichi; Masakazu Shimada; Takema Fukatsu
Journal:  Proc Natl Acad Sci U S A       Date:  2002-10-17       Impact factor: 11.205

6.  Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species.

Authors:  A Jeyaprakash; M A Hoy
Journal:  Insect Mol Biol       Date:  2000-08       Impact factor: 3.585

7.  Wolbachia infection suppresses both host defence and parasitoid counter-defence.

Authors:  Anastasia Fytrou; Peter G Schofield; Alex R Kraaijeveld; Stephen F Hubbard
Journal:  Proc Biol Sci       Date:  2006-04-07       Impact factor: 5.349

8.  Widespread lateral gene transfer from intracellular bacteria to multicellular eukaryotes.

Authors:  Julie C Dunning Hotopp; Michael E Clark; Deodoro C S G Oliveira; Jeremy M Foster; Peter Fischer; Mónica C Muñoz Torres; Jonathan D Giebel; Nikhil Kumar; Nadeeza Ishmael; Shiliang Wang; Jessica Ingram; Rahul V Nene; Jessica Shepard; Jeffrey Tomkins; Stephen Richards; David J Spiro; Elodie Ghedin; Barton E Slatko; Hervé Tettelin; John H Werren
Journal:  Science       Date:  2007-08-30       Impact factor: 47.728

Review 9.  The genetics and genomics of the silkworm, Bombyx mori.

Authors:  Marian R Goldsmith; Toru Shimada; Hiroaki Abe
Journal:  Annu Rev Entomol       Date:  2005       Impact factor: 19.686

10.  Feminization of genetic males by a symbiotic bacterium in a butterfly, Eurema hecabe (Lepidoptera: Pieridae).

Authors:  Masato Hiroki; Yoshiomi Kato; Takehiko Kamito; Kazuki Miura
Journal:  Naturwissenschaften       Date:  2002-04
View more
  9 in total

1.  Effects of Wolbachia elimination and B-vitamin supplementation on bed bug development and reproduction.

Authors:  Mauri L Hickin; Madhavi L Kakumanu; Coby Schal
Journal:  Sci Rep       Date:  2022-06-17       Impact factor: 4.996

Review 2.  Wolbachia: endosymbiont of onchocercid nematodes and their vectors.

Authors:  Ranju Ravindran Santhakumari Manoj; Maria Stefania Latrofa; Sara Epis; Domenico Otranto
Journal:  Parasit Vectors       Date:  2021-05-07       Impact factor: 3.876

3.  Molecular Detection and Phylogenetic Analysis of Endosymbiont Wolbachia pipientis (Rickettsiales: Anaplasmataceae) Isolated from Dirofilaria immitis in Northwest of Iran.

Authors:  Majid Khanmohammadi; Reza Falak; Ahmad Reza Meamar; Mehdi Arshadi; Lame Akhlaghi; Elham Razmjou
Journal:  J Arthropod Borne Dis       Date:  2019-03-30       Impact factor: 1.198

4.  Molecular phylogeny of heritable symbionts and microbiota diversity analysis in phlebotominae sand flies and Culex nigripalpus from Colombia.

Authors:  Rafael J Vivero-Gomez; Víctor A Castañeda-Monsalve; María Claudia Atencia; Richard Hoyos-Lopez; Gregory D Hurst; Gloria Cadavid-Restrepo; Claudia Ximena Moreno-Herrera
Journal:  PLoS Negl Trop Dis       Date:  2021-12-20

5.  Mito-nuclear discordance at a mimicry color transition zone in bumble bee Bombus melanopygus.

Authors:  Briana E Wham; Sarthok Rasique Rahman; Marena Martinez-Correa; Heather M Hines
Journal:  Ecol Evol       Date:  2021-12-08       Impact factor: 2.912

6.  Antibiotics accelerate growth at the expense of immunity.

Authors:  Juan A Galarza; Liam Murphy; Johanna Mappes
Journal:  Proc Biol Sci       Date:  2021-10-20       Impact factor: 5.349

7.  Effects of Sublethal Concentrations of Tetracycline Hydrochloride on the Biological Characteristics and Wolbachia Titer in Parthenogenesis Trichogramma pretiosum.

Authors:  Xiaoge Nian; Xiaobing Tao; Zhuangting Xiao; Desen Wang; Yurong He
Journal:  Insects       Date:  2022-06-20       Impact factor: 3.139

8.  A Comparison of Wolbachia Infection Frequencies in Varroa With Prevalence of Deformed Wing Virus.

Authors:  Thorben Grau; Annely Brandt; Sara DeLeon; Marina Doris Meixner; Jakob Friedrich Strauß; Gerrit Joop; Arndt Telschow
Journal:  J Insect Sci       Date:  2017-05-01       Impact factor: 1.857

9.  A bioinformatics approach to identifying Wolbachia infections in arthropods.

Authors:  Jane Pascar; Christopher H Chandler
Journal:  PeerJ       Date:  2018-09-03       Impact factor: 2.984

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.