Literature DB >> 25249439

Novel locked nucleic acid (LNA)-based probe for the rapid identification of Chlamydia suis using real-time PCR.

Paweł Lis, Aleksandra Kumala, Mirosław Spalinski, Krzysztof Rypula.   

Abstract

BACKGROUND: As the importance of chlamydial infections in pigs has become more obvious, a rapid and sensitive method to study the prevalence of Chlamydia suis in pig herds is required. Such a method should permit routine diagnostic tests for herds with clinical and subclinical infections, without the need for Chlamydia culture.
RESULTS: The main objective of this study was to develop a specific and rapid method for detecting C. suis in swine herds. A real-time PCR assay using a single locked nucleic acid (LNA)-containing probe specific for C. suis was developed based on the previously described 28S rDNA fragment used to identify Chlamydiales. Use of LNA nucleotides enabled the single probe to target a short, specific fragment of the 23S rRNA. The probe showed high specificity for C. suis and did not show any cross-reactivity with other Chlamydia or Chlamydophila species nor with swine DNA. All of the 86 tested field isolates, earlier identified as C. suis, were confirmed as positive using the newly developed assay.
CONCLUSIONS: Using single LNA-based C. suis-specific probe allowed rapid and simple identification of this pathogen without requiring sequencing analysis and culturing. The proposed method may be used to study the prevalence of C. suis infection in pig herds and as a routine diagnostic test for herds with clinical and subclinical infection.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25249439      PMCID: PMC4177436          DOI: 10.1186/s12917-014-0225-4

Source DB:  PubMed          Journal:  BMC Vet Res        ISSN: 1746-6148            Impact factor:   2.741


Background

Chlamydia suis, Chlamydophila abortus, Chlamydophila psittaci and Chlamydophila pecorum infections have been identified in pigs. Recent studies indicate that these infections occur more frequently than originally thought [1-4]. In particular, the study ‘Animal Chlamydiosis and its zoonotic implications’ by Action 855 of the European Cooperation in Science and Technology brought the economic importance of chlamydial infections in pigs into sharp focus. Chlamydial infections have been implicated in a wide spectrum of clinical disorders, including reproductive disorders, ocular and respiratory problems (e.g. conjunctivitis and pneumonia), enteritis, pleuritis, and polyarthritis [4]. Chlamydia can cause both acute and latent disease forms, and very often, chlamydial diseases are asymptomatic. C. suis appears to be both common and widespread, often occurring in mixed infections with Cp. abortus, Cp. psittaci, and Cp. pecorum [5]. The pig intestine is considered to be the natural reservoir for C. suis [6]. The latent presence of chlamydia in the alimentary tract can result in systemic infection when the bacteria reach the epithelial and cellular layers. When the lymph system is affected, the process is called chlamydiosis [7]. C. suis has been identified with high prevalence in growing pigs with or without diarrhoea, as well as in finisher pigs with or without conjunctivitis [4]. A correlation has been noted between samples with a high degree of infection and the presence of clinical signs of chlamydial disease. The use of intensive pig production systems might increase the risk of chlamydial disease in pigs [6]. In gnotobiotic pig challenge studies, C. suis caused diarrhoea in young piglets, and chlamydial antigens were identified in these animals. Chlamydia was also found in enterocytes isolated from the intestinal tissue and faeces [7,8]. Experimental aerosol challenge of 7-day-old pigs with C. suis confirmed the pathogenic potential of C. suis in the porcine respiratory system. All infected animals showed clinical signs, including dry cough, serous nasal discharge, and severe dyspnoea with wheezing, shortness of breath, and breathlessness. The body temperatures of the infected animals rose above 40°C [9,10]. Another study conducted in Germany and Switzerland demonstrated a high prevalence of C. suis in the eyes of pigs with ocular symptoms [11]. C. suis has been investigated in pigs in association with reproductive disorders, such as return to oestrus (with early embryonic death in >50% of sows) and inferior semen quality (with decreased sperm cell motility and death of >50% of sperm cells). These pathologies have been demonstrated on farms in Belgium, Cyprus, Estonia, Germany, Israel, and Switzerland [1,12-14]. C. suis alone may be responsible for diarrhoea in young piglets, resulting in the partial loss of litters and increased owner costs incurred on veterinary care. However, the clinical importance of these disorders appears to decrease in concert with the growth of the animals [8]. Necropsy and pathological investigations may be a first step in the analysis of the source of losses. In a study of field infections, however, pathogen (C. suis)-related lesions appeared in 50% of the samples examined [4]. Using a locked nucleic acid (LNA)-containing probe, in this study, we evaluated a real-time PCR assay specific for C. suis. This assay is based on the previously described 28S rDNA that was used for the identification of Chlamydiales [15]. The LNA nucleotides, which have an additional methylene bridge between the 2′ oxygen and the 4′ carbon of the ribose ring, exhibit much higher binding affinity than unmodified nucleotides. Compared to standard DNA probes, the locked structure results in higher sensitivity and increased specificity of the LNA-containing probes [16]. These characteristics enable the use of much shorter probes (7–10 nucleotides) and simplify the identification of appropriate regions for probe hybridization.

Methods

Sample collection

This study included 86 field archival isolates of C. suis from years 2011–2013, which were derived from clinically healthy animals and pigs with clinical disorders (i.e. conjunctivitis cases and reproductive disorders in sows). The research was conducted in closed-loop farms with 20–120 adult sows in each basic herd. Ten farms were tested. The required sample size was computed in WinEpiscope 2.0 (EPIDECON), assuming an expected prevalence of 30% and a confidence level of 95%. Conjunctival swabs from both eyes and a swab from the vaginal vestibule were collected from each sow. The specimens were stabilized by using the PAXgene Tissue Stabilizer (Qiagen, Poland) and stored at −80°C. Reference strains of positive DNA for other chlamydial organisms were as follows: C. suis VR-1474 (ATCC, USA), Chlamydia trachomatis and Chlamydophila abortus (NRVI, Puławy, Poland), Chlamydophila felis strain 905 (Merial, France), and Chlamydophila psittaci (field isolate obtained from birds, shared by Dr. T. Piasecki, Wroclaw University of Environmental and Life Sciences, Poland). Mycoplasma spp. ATCC 2391 (LGC Standards, Poland) and S. epidermidis ATCC 35984 (PAN, Wroclaw, Poland) were included as controls. DNA was extracted and purified with a GeneJET Viral DNA and RNA Purification Kit, according to the manufacturer’s manual (Thermo Scientific, Lithuania). All DNA samples were tested by using the qPCR procedure described by Everett et al. [15] and sequencing the obtained products.

Design of the assay

Primers and probe were designed by using the chlamydial sequences available in GenBank and were evaluated with Primer3 [17]. Table 1 shows the list of sequences of the 23S rRNA gene and the genome sequences from GenBank used in the development of the primers and probes. Sequences were aligned and analysed using MEGA6 software [18]. Figure 1 shows the sequence recognized by the C. suis-specific LNA probe and the homologous sequences from the closely related C. trachomatis and Cp. abortus genomes.
Table 1

Sequences from GenBank used in the development of primers and probe

Species Strain NCBI accession number
Chlamydia muridarum Nigg CM972CP006975.1
Chlamydia suis R19AF481047.1
R24U68428.1
R27U68429.1
MS04DQ118376.1
H5U68427.1
Chlamydia trachomatis C/TW-3CP006945.1
Chlamydophila abortus S26/3CR848038.1
Chlamydophila caviae GPICAE015925.1
Chlamydophila felis Fe/C-56NR_076260.1
Chlamydophila pecorum P787CP004035.1
Chlamydophila pneumoniae CWL029NR_076161.1
Chlamydophila psittaci WS/RT/E30CP003794.1
Figure 1

Sequence recognized by the designed specific LNA probe and primers, taking into account analogous sequences in the closely related ( , , ).

Sequences from GenBank used in the development of primers and probe Sequence recognized by the designed specific LNA probe and primers, taking into account analogous sequences in the closely related ( , , ). Products obtained with real-time PCR were sequenced (Genomed, Poland) and identified using BLAST (blast.ncbi.nlm.nih.gov). Oligonucleotides were synthesized by Sigma-Aldrich. Primer and probe sequences used for verification of the diagnostic method are provided in Table 2.
Table 2

Sequences of primers and probes used during the study

Sequence (5′-3′) Source
CS1FAATCGAAGAGATTCCCTGTGTThis study
CS1RCCACCTTTCCAGATGTGTTCThis study
CS1PRFAM– T [+G] A [+A] [+G] A [+A] GC [+G] [+A] G –BHQ1This study
TQFGAAAAGAACCCTTGTTAAGGGAGEverett et al. [15]
TQRCTTAACTCCCTGGCTCATCATGEverett et al. [15]
ProbeFAM-CAAAAGGCACGCCGTCAAC-TAMRAEverett et al. [15]

[+N] – LNA BASES.

Sequences of primers and probes used during the study [+N] – LNA BASES. To validate each new set of primers, a classic PCR was performed, followed by qPCR with SYBR Green. Next, the qPCR was tested with the designed LNA probe. The primer sets proposed in this study were specific for the 23S rRNA gene. Each sample was tested in triplicate. Serial 10-fold dilutions were performed on the C. suis-positive sample to assess the test sensitivity. The spectrophotometrically determined mean DNA concentration of the reference strain was 6 ng/μl.

PCR procedures

The classic PCR was performed using 2.5 μl of DreamTaq Green buffer, 0.5 μl of dNTPs (10 mM), 1 μl of CS1F (10 μM), 1 μl of CS1R (10 μM), 0.2 μl of DreamTaq DNA polymerase (Thermo Scientific), and 18.8 μl of water. Each reaction included 1 μl of matrix DNA. The cycling conditions were 3:00 at 95°C; 40 cycles of 95°C for 0:30, 48°C for 0:30, 72°C for 0:30; and 5:00 at 72°C. Reaction mixtures for real-time PCR with the TQF/TQR primers and probe, as described by Everett et al. [15], contained 10 μl of KAPA PROBE FAST Bio-Rad iCycler 2× qPCR Master Mix (KapaBiosystems, USA), 0.3 μl of each primer (10 μM), 0.2 μl of the probe (10 μM), 4.2 μl of miliQ water, and 5 μl of genomic DNA. The real-time PCR cycling included 40 cycles of 0:15 at 95°C and 1:00 at 60.5°C, with an initial denaturation for 3:00 at 94°C. Real-time PCR was performed in a Bio-Rad iQ5 (Bio-Rad, Poland). The following reaction mixture was used for the real-time PCR with the CS1PR probe: 10 μl of KAPA PROBE FAST Bio-Rad iCycler 2× qPCR Master Mix, 0.4 μl of each primer (10 μM), 0.4 μl of probe (10 μM), 7.8 μl of miliQ water, and 1 μl of gDNA. The cycling conditions were 40 cycles of 0:03 at 95°C and 0:20 at 48°C, with an initial denaturation of 3 min at 94°C. Real-time PCR was performed using a Bio-Rad iQ5. The SYBR Green assay was performed using the same parameters and the KAPA SYBR® FAST Bio-Rad iCycler 2× qPCR Master Mix.

Ethic statement

The Ethical Committee for Animal Experiments, Wrocław, Poland, approved this study and all owners provided informed consent prior to initiation.

Results

Traditional PCR reactions were conducted to test the specificity of the designed primers. The CS1F and CS1R primers amplified a 128-bp fragment of the 23S rRNA gene, showing a positive signal in PCRs using C. suis, Cp. abortus, C. trachomatis, and Cp. felis DNA. No products were observed in reactions containing Cp. psittaci, M. felis, S. epidermidis, or swine DNA (Figure 2).
Figure 2

Results of the amplification of the fragment of 23S rRNA gene using CS1F/CS1R primers. On the gel, from the left: 100 bp ladder; C. suis; Cp. abortus; C. trachomatis; Cp. felis; Cp. psittaci; M. felis; S.epidermidis; swine DNA; NTC.

Results of the amplification of the fragment of 23S rRNA gene using CS1F/CS1R primers. On the gel, from the left: 100 bp ladder; C. suis; Cp. abortus; C. trachomatis; Cp. felis; Cp. psittaci; M. felis; S.epidermidis; swine DNA; NTC. Subsequently, real-time PCR was performed using the CS1F and CS1R primers and C. suis gDNA. One clear peak was visible in the melting curve analysis, indicating that a single amplicon was obtained in the real-time PCR procedure (Figure 3).
Figure 3

Melting curve of the product of the amplification of the 23S rRNA gene fragment using CS1F/CS1R primers.

Melting curve of the product of the amplification of the 23S rRNA gene fragment using CS1F/CS1R primers. The PCR product was sequenced, and the identified sequence was identical to the C. suis R19 23S rRNA gene fragment sequence obtained from GenBank (AF481047.1). The CS1PR probe was designed to recognize C. suis specifically, while excluding other chlamydial sequences available in GenBank to avoid any cross-reactivity. Use of LNA nucleotides enabled us to develop a short (12 nt), yet specific, probe. Real-time PCR using the CS1PR probe showed no positive signals when DNA isolated from C. trachomatis, Cp. abortus, Cp. psittaci, Cp. felis, M. felis, S. epidermidis, or swine DNA was used as a template. Six serial 10-fold dilutions of C. suis gDNA isolated from pure culture were used to determine the assay sensitivity. The range of detection of the assay was between a CT of 13 (6 ng of genomic DNA) and a CT of 36 (60 fg of genomic DNA), indicating that the lowest amount of genomic DNA detectable by the assay was 60 fg (about 50 copies; Figure 4). Correlation coefficients of the standard curves were all above 0.96, and the efficiency of the reaction was 98.9% (slope: −3.349 ± 0.3727). All 86 of the field isolates selected with the Chlamydiaceae-specific probe and identified as C. suis by sequencing of the PCR product as in Everett et al. [15] were confirmed as positive by the CS1PR probe.
Figure 4

Real time-PCR assay with CS1PR probe performed on serial 10-fold dilutions of genomic DNA (6 ng to 60 fg of DNA).

Real time-PCR assay with CS1PR probe performed on serial 10-fold dilutions of genomic DNA (6 ng to 60 fg of DNA).

Discussion

The rate of Chlamydiaceae seroprevalence in pig farms across European countries, including Germany, Belgium, and Switzerland, differs greatly. Frequently, seroprevalence depends on the age of pigs examined, although seropositivity has been confirmed in all phases of pig production. The lowest rate (6.9%) was observed in piglets younger than 4 weeks old, whereas the rate reached 48.1% in older pigs [1]. In sows specifically, the reported seroprevalence ranges from 33% to 72% [12]. In Belgian fattening farms, sow seropositivity has been reported to be as high as 96.5% [2]. A previous study reported seropositivity to C. suis in pigs from all 11 farms investigated, with seropositivity rates ranging from 20% to 100% [19]. Guscetti et al. [20] investigated C. suis infection in gnotobiotic piglets. Animals were inoculated with egg-grown chlamydiae at 2–3 days of age and were observed for clinical signs. Animals were sacrificed and necropsied at 2–13 days post-inoculation, and serological tests were performed (complement fixation test and ELISA). Clinical symptoms, including diarrhoea, slight and transient anorexia, weakness, and body weight loss, were observed. Immunohistochemistry and ELISA revealed that chlamydial replication was particularly marked at 2–4 post-inoculation and primarily located in the small intestine. However, all sera were negative for antichlamydial antibodies [20]. In general, intensively kept pigs are predisposed to ocular chlamydial infection associated with conjunctivitis [11]. Cell culture is widely regarded as the gold standard in chlamydial diagnosis. However, this method has numerous limitations, particularly in the case of C. suis, which displays limited growth in commercial cell lines [21]. In commercial laboratories, the species-specific identification of pathogens is uncommon because specimens collected in the field are generally diagnosed only to the Chlamydiaceae family level. Consequently, the epidemiological situation remains largely unknown, as individual pathogens are not considered. As a diagnostic approach, PCR detection of C. suis provides more satisfactory results than direct culture, particularly if percent positivity is considered (42% vs. 33%) [22]. The sensitivity and specificity of the reaction proposed by Sachse et al. were 94.4% and 81.0%, respectively [22]. The very high sensitivity of real-time PCR enables direct identification from swabs without prior propagation of the pathogen by cell culture. Current PCR tests proposed by various researchers for the identification of Chlamydiaceae in pigs target the ompA, 16S-23S rRNA, or incA gene. Species-specific real-time PCR tests proposed for pigs detect the ribosomal intergenic spacer and domain I of the 23S rRNA gene [6]. Using the PCR-RFLP method described by Demkin and Zimin [23], we were unable to obtain product using material isolated from swabs, indicating that classical PCR is was not sensitive enough for identification of Chlamydiaceae from this type of material without culturing (unpublished data). In this study, we designed a real-time PCR assay for the identification of C. suis. To our knowledge, this is the first report of a C. suis-specific real-time PCR method that allows the highly specific and sensitive detection and species-level identification of the pathogen with a single oligonucleotide LNA-based probe and without requiring sequencing analysis. Using LNA nucleotides allowed us to target a short, specific fragment of the 23S rRNA gene for development of the C. suis-specific probe. The proposed method may be used to study the prevalence of C. suis infection in pig herds and as a routine diagnostic test for herds with clinical and subclinical infection. Species-specific identification may be important therapeutically, because the only known stable tetracycline-resistant strains of Chlamydia are C. suis.

Conclusions

We designed a single LNA-based C. suis-specific probe that allowed rapid and simple identification of this pathogen using real-time PCR, without requiring sequencing analysis and culturing. 86 C. suis-positive samples were tested and successfully identified using the newly designed probe, showing high specificity and sensitivity of the described method. The proposed assay may be used to study the prevalence of C. suis infection and as a routine diagnostic test for herds with clinical and subclinical infection.
  22 in total

1.  [Prevalence of Chlamydia infections in breeding sows and their importance in reproductive failure].

Authors:  G Eggemann; M Wendt; L E Hoelzle; C Jäger; R Weiss; K Failing
Journal:  Dtsch Tierarztl Wochenschr       Date:  2000-01

2.  Pathogenicity of the microorganisms of the family Chlamydiaceae respecting the changes in their classification.

Authors:  K Niemczuk; M Truszczyński
Journal:  Pol J Vet Sci       Date:  2002       Impact factor: 0.821

3.  Chlamydial infections of domestic ruminants and swine: new nomenclature and new knowledge.

Authors:  David Longbottom
Journal:  Vet J       Date:  2004-07       Impact factor: 2.688

4.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

5.  Rapid detection of the Chlamydiaceae and other families in the order Chlamydiales: three PCR tests.

Authors:  K D Everett; L J Hornung; A A Andersen
Journal:  J Clin Microbiol       Date:  1999-03       Impact factor: 5.948

6.  Small intestinal Chlamydia infection in piglets.

Authors:  J C Nietfeld; B H Janke; P Leslie-Steen; D J Robison; D H Zeman
Journal:  J Vet Diagn Invest       Date:  1993-01       Impact factor: 1.279

7.  Lung and nasal lesions caused by a swine chlamydial isolate in gnotobiotic pigs.

Authors:  D G Rogers; A A Andersen; B D Hunsaker
Journal:  J Vet Diagn Invest       Date:  1996-01       Impact factor: 1.279

8.  Diagnostic investigation into the role of Chlamydiae in cases of increased rates of return to oestrus in pigs.

Authors:  U Camenisch; Z H Lu; L Vaughan; L Corboz; D R Zimmermann; M M Wittenbrink; A Pospischil; T Sydler
Journal:  Vet Rec       Date:  2004-11-06       Impact factor: 2.695

9.  Detection of Chlamydia suis from clinical specimens: comparison of PCR, antigen ELISA, and culture.

Authors:  Konrad Sachse; Ernst Grossmann; Cornelie Jäger; Roland Diller; Helmut Hotzel
Journal:  J Microbiol Methods       Date:  2003-08       Impact factor: 2.363

10.  Immunoblotting, ELISA and culture evidence for Chlamydiaceae in sows on 258 Belgian farms.

Authors:  Daisy Vanrompay; Tom Geens; Ann Desplanques; Tran Q T Hoang; L De Vos; Marnix Van Loock; E Huyck; Cora Mirry; Eric Cox
Journal:  Vet Microbiol       Date:  2004-03-26       Impact factor: 3.293

View more
  3 in total

1.  Development of a Real-Time Reverse Transcription-PCR Assay for Global Differentiation of Yellow Fever Virus Vaccine-Related Adverse Events from Natural Infections.

Authors:  Holly R Hughes; Brandy J Russell; Eric C Mossel; John Kayiwa; Julius Lutwama; Amy J Lambert
Journal:  J Clin Microbiol       Date:  2018-05-25       Impact factor: 5.948

2.  Chlamydia prevalence in Polish pig herds.

Authors:  K Rypuła; A Kumala; K Płoneczka-Janeczko; E Karuga-Kuźniewska; K Dudek; P Chorbiński
Journal:  Epidemiol Infect       Date:  2016-05-13       Impact factor: 4.434

3.  Locked Nucleic Acid Probe-Based Real-Time PCR Assay for the Rapid Detection of Rifampin-Resistant Mycobacterium tuberculosis.

Authors:  Yong Zhao; Guilian Li; Chongyun Sun; Chao Li; Xiaochen Wang; Haican Liu; Pingping Zhang; Xiuqin Zhao; Xinrui Wang; Yi Jiang; Ruifu Yang; Kanglin Wan; Lei Zhou
Journal:  PLoS One       Date:  2015-11-24       Impact factor: 3.240

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.