Maria Vera1, Bibhusita Pani1, Lowri A Griffiths2, Christian Muchardt3, Catherine M Abbott2, Robert H Singer4, Evgeny Nudler1. 1. Department of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, United States. 2. Medical Genetics Section, Molecular Medicine Centre, Institute of Genetics and Molecular Medicine, Western General Hospital, University of Edinburgh, Edinburgh, United Kingdom. 3. Département de Biologie du Développement et Cellules Souches, Institut Pasteur, CNRS URA2578, Paris, France. 4. Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, New York, United States.
Abstract
Translation elongation factor eEF1A has a well-defined role in protein synthesis. In this study, we demonstrate a new role for eEF1A: it participates in the entire process of the heat shock response (HSR) in mammalian cells from transcription through translation. Upon stress, isoform 1 of eEF1A rapidly activates transcription of HSP70 by recruiting the master regulator HSF1 to its promoter. eEF1A1 then associates with elongating RNA polymerase II and the 3'UTR of HSP70 mRNA, stabilizing it and facilitating its transport from the nucleus to active ribosomes. eEF1A1-depleted cells exhibit severely impaired HSR and compromised thermotolerance. In contrast, tissue-specific isoform 2 of eEF1A does not support HSR. By adjusting transcriptional yield to translational needs, eEF1A1 renders HSR rapid, robust, and highly selective; thus, representing an attractive therapeutic target for numerous conditions associated with disrupted protein homeostasis, ranging from neurodegeneration to cancer.
Translation elongation factor eEF1A has a well-defined role in protein synthesis. In this study, we demonstrate a new role for eEF1A: it participates in the entire process of the heat shock response (HSR) in mammalian cells from transcription through translation. Upon stress, isoform 1 of eEF1A rapidly activates transcription of HSP70 by recruiting the master regulator HSF1 to its promoter. eEF1A1 then associates with elongating RNA polymerase II and the 3'UTR of HSP70 mRNA, stabilizing it and facilitating its transport from the nucleus to active ribosomes. eEF1A1-depleted cells exhibit severely impaired HSR and compromised thermotolerance. In contrast, tissue-specific isoform 2 of eEF1A does not support HSR. By adjusting transcriptional yield to translational needs, eEF1A1 renders HSR rapid, robust, and highly selective; thus, representing an attractive therapeutic target for numerous conditions associated with disrupted protein homeostasis, ranging from neurodegeneration to cancer.
All organisms respond to environmental stress by activating genes that encode molecular chaperones and other cytoprotective heat shock proteins (HSPs) in a process known as the heat shock response (HSR) (Lindquist and Craig, 1988). In mammalian cells, HSR is regulated at the level of transcription by the heat shock factor 1 (HSF1) (Guertin and Lis, 2010; Anckar and Sistonen, 2011). In coordination with their augmented transcription, the stability, transport, and translation of HSP mRNAs (especially HSP70) are sharply increased during HSR, accounting for the robust production of HSPs (Theodorakis and Morimoto, 1987; Zhao et al., 2002). HSP70 is the best-studied example, which is among the most inducible HSPs in terms of promptness and robustness of the response (Theodorakis and Morimoto, 1987; Lindquist and Craig, 1988; Cuesta et al., 2000). The mechanism of such a rapid and synchronized reaction to stress remains unknown, but is particularly remarkable considering that upon stress, the majority of other genes are inhibited at the level of transcription, RNA export, and translation (Laroia et al., 1999; Gallouzi et al., 2000; Mariner et al., 2008).Our previous in vitro studies demonstrated that translation elongation factor eEF1A enhances the binding of HSF1 to a DNA containing an artificial HSE sequence via a mechanism that requires a non-coding RNA (HSR1) (Shamovsky et al., 2006). eEF1A1 has a well-defined role in protein synthesis, it delivers aminoacylated tRNAs to the A site of ribosome during translation elongation in a GTP-dependent manner (Mateyak and Kinzy, 2010; Li et al., 2013). While the majority of eEF1A1 associates with the cytoplasmic cytoskeleton and translational machinery (Ejiri, 2002), eEF1A1 is able to enter the nucleus to mediate the export of tRNAs and SNAG-containing proteins under normal growth conditions (Bohnsack et al., 2002; Calado et al., 2002; Mingot et al., 2013). Also, eEF1A can directly bind mammalian mRNAs (Liu et al., 2002; Mickleburgh et al., 2006) and mediate stability of viral and cellular RNAs by binding to their 3′ regions (Yan et al., 2008; Li et al., 2013).eEF1A expression in mammalian cells happens in one of two isoforms, eEF1A1 and eEF1A2. These two isoforms are 98% similar at the amino acid level and share the same canonical function. Each isoform is the product of expression of a specific locus and shows a distinct expression pattern except in transformed cells, which express both. While the majority of cells express eEF1A1 isoform, adult neuronal and muscle cells express eEF1A2 (Newbery et al., 2007; Abbott et al., 2009). In this study, we report that eEF1A1 isoform, but not the tissue-specific variant eEF1A2 is required for the HSP70 induction during heat shock. It mediates transcription-activation of HSP70 mRNA, its stability, transport, and translation, thereby synchronizing HSP70 transcriptional output to translational needs.
Results
Transcription of HSPs genes is impaired in cells knocked down for eEF1A1
To determine the role of eEF1A1 in HSR in vivo, we designed a strategy for its selective and efficient knockdown without compromising overall translation and cell viability. eEF1A is one of the most abundant cellular proteins, compromising 1–3% of total cytosolic proteins, and is present in large excess to its protein synthesis partners (molar ratios for eEF1A:eEF1B and eEF1A:ribosomes of 10:1 and 25:1 respectively) (Slobin, 1980). Therefore, a ∼70% knockdown of eEF1A1 did not compromise cell viability under non-stress conditions and overall translation under control or mild-heat shock conditions (Figure 1—figure supplement 1A,B). The levels of eEF1A1 and HSF1 (positive control), but not those of GAPDH, were greatly reduced after efficient transfection of humanbreast cancer cells (MDA-MB231), primary human fibroblasts (WI38), immortalized mouse embryonic fibroblast (MEFs), or mouseNSC34 motor spinal cord/neuroblastoma fusion cells, with specific and un-related sets of siRNAs (Figure 1A [siRNA pair A], Figure 1—figure supplement 2A [siRNA pair B], Figure 1—figure supplement 3A,B [siRNA C]). After heat shock, knock down of eEF1A1 (∼30% of control remaining) or HSF1, (<25% of control remaining), markedly reduced the induction of HSP70 (Figure 1A, Figure 1—figure supplement 2A, Figure 1—figure supplement 3A,B) and HSP27 (Figure1—figure supplement 3C), and resulted in loss of thermo-tolerance (Figure 1B). To rule out the possibility that the loss of induction of HSPs in eEF1A1-deficient cells was potentially due to overall compromised translation, de novo protein synthesis was analyzed in a pulse-chase experiment with [35S]-methionine. We observed a general decrease in protein synthesis after HS, but no significant difference between mock-transfected cells and cells depleted of either HSF1 or eEF1A1 (Figure 1—figure supplement 1A). Consistently, HSP70 and HSP27 mRNA levels were significantly decreased in eEF1A1-knocked down heat-shocked cells (Figure 1C, Figure 1—figure supplement 2B, Figure 1—figure supplement 3D,E). Impaired mRNA induction upon heat shock due to eEF1A1deficiency was observed for several classes of HSP genes (Figure1—figure supplement 3F). It is known that HSP70 mRNA induction occurs upon chemical inhibition of translation. To verify that the action of eEF1A1 is independent of its role in translation inhibition, we tested eEF1A1 knockdown conditions in combination with inhibitors of translation elongation. eEF1A1-depleted cells treated with the HSR-stimulating inhibitors of translation, cycloheximide (CHX) or doxycycline (DOX) failed to accumulate HSP70 mRNA (Figure 1—figure supplement 3G). In contrast, knocking down eEF1A2 isoform had no effect on HSP70 mRNA induction or protein amount (Figure 1—figure supplement 4A,B). These results demonstrate that isoform 1 of eEF1A specifically controls HSPs gene expression irrespective of its role in translation.
Figure 1—figure supplement 1.
Knock down of eEF1A1 does not affect general translation or cell viability.
(A) Knock down of HSF1 or eEF1A1 by DsiRNA does not affect overall protein synthesis. Pulse-chase experiment with [35S]-methionine in mock transfected cells (−), or cells knocked down for HSF1 (H), or eEF1A1 (E). Cells were kept at 37°C (C) or heat-shocked for 45 min at 40°C followed by a 30 min incubation at 40°C with 50 μCi/ml of [35S] (HS). Numbers at the left indicate molecular weight in kDa. (B) Inhibition of HSF1 or eEF1A1 does not affect normal cell growth. Quantification of cell viability by the MTT assay was performed on mock-transfected cells (Si:NT) or cells depleted of eEF1A1 or HSF1 under normal cell growth conditions. ns = Non significant differences with Si:NT cells.
DOI:
http://dx.doi.org/10.7554/eLife.03164.004
Figure 1.
eEF1A1 regulates HSP70 expression and thermotolerance.
(A) Knock down of eEF1A1 decreases HSP70 protein expression upon heat shock. Western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of MDA-MB231 cells transfected with siRNA (pair A) against eEF1A1 or HSF1, or mock-transfected (Si:NT with no target). Control (C)—unstressed cells kept at 37°C. Heat shock (HS)—cells kept for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (B) HSF1- or eEF1A1-knocked down cells are less thermo-tolerant. Cell death was quantified by FACS analysis after propidium iodide staining. Thermotolerance was induced in mock-transfected (Si:NT) or eEF1A1/HSF1-depleted cells by two heat treatments (1 hr at 43°C, 12 hr at 37°C, and 1 hr at 45°C), followed by 12 hr of recovery. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05. (C) Knock down of eEF1A1 decreases HSP70 mRNA expression during heat shock. Total RNA from heat shocked MDA-MB231 cells was reverse-transcribed with random hexamer primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP70 mRNA in cells depleted of eEF1A1 relative to that obtained for mock-transfected cells (Si:NT). 1 is the value of HSP70 mRNA in Si:NT cells at 1 hr of heat shock. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05. (D) eEF1A1 controls RNAPII occupancy at the HSP70 gene after stress as determined by ChIP-QPCR. Schematic of the HSPA1A locus is shown at the top. Arrowheads indicate the regions amplified by QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1) on RNAPII occupancy relative to input Ct value under non-heat shock conditions (control) and after 30 min of heat shock. The relative value for the IgG is indicated for each of the PCR fragments on top of the plot. Values below that of the IgG mean non-specific binding. Mock-transfected cells (Si:NT). By comparison, GAPDH showed no change with si;eEF1A1. Data from three independent experiments are presented as the mean ± SEM. (*p < 0.05). (E) eEF1A1 mediates HSP70 transcription upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 30 min after HS, cells were fixed and HSP70 mRNA detected by FISH. Nuclei were stained with DAPI. Merged images show Cherry-eEF1A1 in red, HSP70 TS in gray and nucleus in blue. White arrows indicate cells knocked down of eEF1A1. Bar = 10 microns. (F) eEF1A1 mediates HSP70 transcription upon HS. Plots are the quantification of the intensity of HSP70 transcription, per cell or per TS, detected by FISH and quantified by airlocalize. A total of seventy cells per condition were analyzed from three independent experiments. NT = non-transfected cells. eEF1A1 = cells transfected with siRNA for eEF1A1.
DOI:
http://dx.doi.org/10.7554/eLife.03164.003
(A) Knock down of HSF1 or eEF1A1 by DsiRNA does not affect overall protein synthesis. Pulse-chase experiment with [35S]-methionine in mock transfected cells (−), or cells knocked down for HSF1 (H), or eEF1A1 (E). Cells were kept at 37°C (C) or heat-shocked for 45 min at 40°C followed by a 30 min incubation at 40°C with 50 μCi/ml of [35S] (HS). Numbers at the left indicate molecular weight in kDa. (B) Inhibition of HSF1 or eEF1A1 does not affect normal cell growth. Quantification of cell viability by the MTT assay was performed on mock-transfected cells (Si:NT) or cells depleted of eEF1A1 or HSF1 under normal cell growth conditions. ns = Non significant differences with Si:NT cells.
DOI:
http://dx.doi.org/10.7554/eLife.03164.004
(A) Knock down of eEF1A1 decreases HSP70 protein expression upon heat shock. Western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of MBS-MEF cells transfected with siRNA (pair B) against eEF1A1 or mock-transfected (Si:NT with no target). Control (C)—unstressed cells kept at 37°C. Heat shock (HS)—cells kept for 1 hr at 43°C followed by 2 hr of recovery (short induction) or 6 hr of recovery (long induction) at 37°C. Low panels—ponceau staining of the membranes. Numbers indicate molecular weight. Plots show the relative fluorescence intensity of bands as compared to mock-transfected non-stressed cells. (B) Knock down of eEF1A1 decreases HSP70 mRNA expression during HS. Total RNA from heat shocked MDA-MB231 cells was reverse-transcribed with random hexamer primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP70 mRNA in cells depleted of eEF1A1 relative to that obtained for mock-transfected cells (Si:NT). 1 is the value of HSP70 mRNA in Si:NT cells at 1 hr of heat shock. Data from three independent experiments are presented as the mean ± SEM, *p < 0.05. (C) eEF1A1 controls RNAPII occupancy at the HSP70 promoter after stress as determined by ChIP-QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1) on RNAPII occupancy relative to the input Ct value after 30 min of heat shock. The relative value for the IgG is indicated for each of the PCR fragments on top of the plot. Values below that of the IgG mean non-specific binding. Mock-transfected cells (Si:NT). Data from two independent experiments are presented as the mean ± SEM. (D) eEF1A1 mediates HSP70 transcription upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 30 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Yellow arrows indicate TS. Bar = 10 microns. (E) eEF1A1 mediates HSP70 transcription upon HS. Plots are the quantification of the intensity of HSP70 transcription, per cell or per TS, detected by FISH and quantified by airlocalize. A total of 25 cells per condition were analyzed from three independent experiments. NT = non-transfected cells. eEF1A1 = cells transfected with siRNA for eEF1A1.
DOI:
http://dx.doi.org/10.7554/eLife.03164.005
(A) Knock down of eEF1A1 decreases the production of HSP70 in NSC-34 cells (mouse neuroblastoma/spinal cord fusion cell line). The panel indicates expression of eEF1A1 and HSP70 normalized to GAPDH in heat-shocked samples transfected with eEF1A1 siRNAs and the scrambled non-targeting negative control. Two different RNAi were used to inhibit eEF1A1 isoform (pair C): 1A1-a UGACAAUCCAGAACAGGAGCGUAGC; 1A1-b AAGUGGAGGGUAGUCAGAGAAGCUC. Cells were transfected with separate siRNAs (Invitrogen) using siLentFect (Bio-Rad), allowed to recover for 24 hr, incubated at 43°C for 2 hr, and then recovered again for 16 hr. Control cells remained at 37°C for the duration of the experiment. Western-blots were analyzed separately for each siRNA and the values related to those of scrambled control. Data are the mean ± SEM is from three independent experiments. (B) Knock down of eEF1A1 suppresses HSP70 protein induction upon heat shock. The panels show western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of WI38 human fibroblast cells mock-transfected (Si:NT) or knocked down of eEF1A1. Cells were heat-shocked for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (C) Knock down of eEF1A1 decreases HSP27 protein induction upon heat shock. The panels show SDS-PAGE and immunoblots of HSP27, eEF1A, and GAPDH from total cell lysates of mock-transfected (Si:NT) MDA-MB231 cells or cells depleted of eEF1A. Cells were heat-shocked for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (D) Knock down of eEF1A1 diminishes HSP70 mRNA expression during heat shock. Total RNA from heat-shocked WI38 cells was reverse-transcribed with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the mean ± SEM amount of HSP70 mRNA from three different experiments in cells depleted of eEF1A1 relative to that detected in mock-transfected cells (Si:NT = 1). *p < 0.05. (E) Knock down of eEF1A1 diminishes HSP27 mRNA expression during heat shock. Total RNA from heat-shocked MDA-MB-231 cells was reverse-transcribed with random primers followed by quantification of GAPDH and HSP27 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the mean ± SEM amount of HSP27 mRNA in cells depleted of eEF1A1 relative to that detected in mock-transfected cells (Si:NT = 1). *p < 0.05. (F) eEF1A1 controls transcription of various heat shock genes. Knock down of eEF1A1 compromises mRNA induction of several major heat-shock genes during heat shock. Total RNA from heat-shocked or unstressed MDA-MB231 cells was reverse-transcribed with random primers followed by quantification of GAPDH and the indicated mRNAs by QPCR. mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP mRNAs in cells inhibited of eEF1A1 relative to that in mock-transfected cells (Si:NT = 1) at 2 hr of heat shock. Means ± SEM are from three independent experiments. *p < 0.05. (G) Role of eEF1A1 in HSR is independent of its role in translation elongation. Quantification of induction of HSP70 mRNA by RT-QPCR after 1 hr of heat shock or treatment with the translation inhibitors cycloheximide (CHX, 50 μg/ml) or doxycycline (DOX, 5 μg/ml) in mock transfected cells or cells knocked down of eEF1A. Data are the mean ± SEM comparing mock transfected with Si:eEF1A1. *p < 0.05 and **p < 0.01.
DOI:
http://dx.doi.org/10.7554/eLife.03164.006
(A) eEF1A1, but not eEF1A2, mediates HSP70 induction upon heat shock. The levels of HSP70 mRNA with respect to GAPDH were determined by RT-QPCR after 1 hr of heat shock in mock-transfected cells (si: nt) or cells knocked down of eEF1A1 or eEF1A2. The HSP70 mRNA level is taken as 100% in mock transfected cells. Data are the mean ± SEM from three experiments. *p < 0.05. (B) Knocking down eEF1A2, does not decrease HSP70 protein induction in NSC-34 cells (mouse neuroblastoma/spinal cord fusion cell line). Panel indicates expression of eEF1A2 and HSP70 normalized to GAPDH in heat-shocked samples transfected with eEF1A2 siRNAs and the scrambled non-targeting negative control. Two different RNAi were used to inhibit eEF1A2 isoform: 1A2-a UUAACGGACACAUUCUUCACAUUGA; 1A2-b CAAUCUUGUACACAUCCUGCAGAGG. Cells were transfected with separate siRNAs (Invitrogen) using siLentFect (Bio-Rad), allowed to recover for 24 hr, incubated at 43°C for 2 hr, and then recovered again for 16 hr. Control cells remained at 37°C for the duration of the experiment. Western-blots were analyzed separately for each siRNA and the values related to those of scrambled control. Data are the mean ± SEM is from three independent experiments. (C) Motor neurons express eEF1A2, but not eEF1A1. Immunofluorescence imaging of eEF1A1 (red) and eEF1A2 (green) in the mouse spinal cord shows non-overlapping cytoplasmic staining. eEF1A2 is present only in motor neurons (white arrow). eEF1A1 is present only in smaller interneurons and white matter (glia cells) (yellow arrow). Right panel shows the magnified area (white box in left image). Images were captured at 40x magnification.
DOI:
http://dx.doi.org/10.7554/eLife.03164.007
(A) Schematic of the HSPA1A locus is shown at the top. Plot shows the occupancy of RNAPII relative to input Ct value in eEF1A1 depleted (Si:eEF1A1) and mock-transfected human fibroblast WI38 cells (Si:NT) as determined by ChIP-QPCR. The values for the IgG control are indicated for each PCR fragment. Media ± SEM values lower than those numbers mean no occupancy. (B) Nuclear run-on analysis of HSPA1A and GAPDH transcription in heat shocked (43°C, 20 min) control fibroblasts (NT) or eEF1A1-knocked down cells (eEF1A1) with two unrelated siRNAs (pair A or pair B). Numbers on the left represent the hybridization probe position. Numbers on the right represent % of run-on transcripts in eEF1A1-knocked down cells as compared to mock-transfected cells. (C) eEF1A1 controls RNAPII occupancy at the HSP70 promoter after stress as determined by ChIP-QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1 [pair B]) on RNAPII occupancy relative to the input Ct value under non-HS conditions (C) or after 30 min of heat shock (HS) on HSP70 and GAPDH promoters. Mock-transfected cells (Si:NT). Data from two independent experiments are presented as the mean ± SEM.
DOI:
http://dx.doi.org/10.7554/eLife.03164.008
(A) Panels show Western blots of eEF1A1, Flag and GAPDH from total cell lysates of immortalized MEFs (Lionnet et al., 2011) infected with a lentivirus expressing eEF1A1 fused to Cherry and Flag on its N terminus. Wt indicate non-infected cells, sorted are cells sorted to get a homogenous population expressing cherry-eEF1A. Image shows the expression of Cherry-eEF1A1 by fluorescence microscopy after fixation. (B) Percentage of cells with active TS for HSP70 detected by FISH. Data represent median ± SEM from four independent experiments. Time in minutes indicate the length MEF cells were at 43°C before fixation and FISH. TS were counted after microscopy. (C) Percentage of TS for HSP70 detected by FISH. Date represent media ± SEM from four independent experiments. Time in minutes indicate the length MEF cells were heated at 43°C before fixation and FISH.
DOI:
http://dx.doi.org/10.7554/eLife.03164.009
Figure 1—figure supplement 2.
eEF1A1 regulates HSP70 expression (all experiments in this figure were done with an alternative pair of siRNAs [pair B] to rule out off-target effects).
(A) Knock down of eEF1A1 decreases HSP70 protein expression upon heat shock. Western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of MBS-MEF cells transfected with siRNA (pair B) against eEF1A1 or mock-transfected (Si:NT with no target). Control (C)—unstressed cells kept at 37°C. Heat shock (HS)—cells kept for 1 hr at 43°C followed by 2 hr of recovery (short induction) or 6 hr of recovery (long induction) at 37°C. Low panels—ponceau staining of the membranes. Numbers indicate molecular weight. Plots show the relative fluorescence intensity of bands as compared to mock-transfected non-stressed cells. (B) Knock down of eEF1A1 decreases HSP70 mRNA expression during HS. Total RNA from heat shocked MDA-MB231 cells was reverse-transcribed with random hexamer primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP70 mRNA in cells depleted of eEF1A1 relative to that obtained for mock-transfected cells (Si:NT). 1 is the value of HSP70 mRNA in Si:NT cells at 1 hr of heat shock. Data from three independent experiments are presented as the mean ± SEM, *p < 0.05. (C) eEF1A1 controls RNAPII occupancy at the HSP70 promoter after stress as determined by ChIP-QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1) on RNAPII occupancy relative to the input Ct value after 30 min of heat shock. The relative value for the IgG is indicated for each of the PCR fragments on top of the plot. Values below that of the IgG mean non-specific binding. Mock-transfected cells (Si:NT). Data from two independent experiments are presented as the mean ± SEM. (D) eEF1A1 mediates HSP70 transcription upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 30 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Yellow arrows indicate TS. Bar = 10 microns. (E) eEF1A1 mediates HSP70 transcription upon HS. Plots are the quantification of the intensity of HSP70 transcription, per cell or per TS, detected by FISH and quantified by airlocalize. A total of 25 cells per condition were analyzed from three independent experiments. NT = non-transfected cells. eEF1A1 = cells transfected with siRNA for eEF1A1.
DOI:
http://dx.doi.org/10.7554/eLife.03164.005
Figure 1—figure supplement 3.
Knock down of eEF1A1 reduces HSPs expression in mouse and human cells.
(A) Knock down of eEF1A1 decreases the production of HSP70 in NSC-34 cells (mouse neuroblastoma/spinal cord fusion cell line). The panel indicates expression of eEF1A1 and HSP70 normalized to GAPDH in heat-shocked samples transfected with eEF1A1 siRNAs and the scrambled non-targeting negative control. Two different RNAi were used to inhibit eEF1A1 isoform (pair C): 1A1-a UGACAAUCCAGAACAGGAGCGUAGC; 1A1-b AAGUGGAGGGUAGUCAGAGAAGCUC. Cells were transfected with separate siRNAs (Invitrogen) using siLentFect (Bio-Rad), allowed to recover for 24 hr, incubated at 43°C for 2 hr, and then recovered again for 16 hr. Control cells remained at 37°C for the duration of the experiment. Western-blots were analyzed separately for each siRNA and the values related to those of scrambled control. Data are the mean ± SEM is from three independent experiments. (B) Knock down of eEF1A1 suppresses HSP70 protein induction upon heat shock. The panels show western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of WI38 human fibroblast cells mock-transfected (Si:NT) or knocked down of eEF1A1. Cells were heat-shocked for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (C) Knock down of eEF1A1 decreases HSP27 protein induction upon heat shock. The panels show SDS-PAGE and immunoblots of HSP27, eEF1A, and GAPDH from total cell lysates of mock-transfected (Si:NT) MDA-MB231 cells or cells depleted of eEF1A. Cells were heat-shocked for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (D) Knock down of eEF1A1 diminishes HSP70 mRNA expression during heat shock. Total RNA from heat-shocked WI38 cells was reverse-transcribed with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the mean ± SEM amount of HSP70 mRNA from three different experiments in cells depleted of eEF1A1 relative to that detected in mock-transfected cells (Si:NT = 1). *p < 0.05. (E) Knock down of eEF1A1 diminishes HSP27 mRNA expression during heat shock. Total RNA from heat-shocked MDA-MB-231 cells was reverse-transcribed with random primers followed by quantification of GAPDH and HSP27 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the mean ± SEM amount of HSP27 mRNA in cells depleted of eEF1A1 relative to that detected in mock-transfected cells (Si:NT = 1). *p < 0.05. (F) eEF1A1 controls transcription of various heat shock genes. Knock down of eEF1A1 compromises mRNA induction of several major heat-shock genes during heat shock. Total RNA from heat-shocked or unstressed MDA-MB231 cells was reverse-transcribed with random primers followed by quantification of GAPDH and the indicated mRNAs by QPCR. mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP mRNAs in cells inhibited of eEF1A1 relative to that in mock-transfected cells (Si:NT = 1) at 2 hr of heat shock. Means ± SEM are from three independent experiments. *p < 0.05. (G) Role of eEF1A1 in HSR is independent of its role in translation elongation. Quantification of induction of HSP70 mRNA by RT-QPCR after 1 hr of heat shock or treatment with the translation inhibitors cycloheximide (CHX, 50 μg/ml) or doxycycline (DOX, 5 μg/ml) in mock transfected cells or cells knocked down of eEF1A. Data are the mean ± SEM comparing mock transfected with Si:eEF1A1. *p < 0.05 and **p < 0.01.
DOI:
http://dx.doi.org/10.7554/eLife.03164.006
Figure 1—figure supplement 4.
eEF1A2 does not support HSR.
(A) eEF1A1, but not eEF1A2, mediates HSP70 induction upon heat shock. The levels of HSP70 mRNA with respect to GAPDH were determined by RT-QPCR after 1 hr of heat shock in mock-transfected cells (si: nt) or cells knocked down of eEF1A1 or eEF1A2. The HSP70 mRNA level is taken as 100% in mock transfected cells. Data are the mean ± SEM from three experiments. *p < 0.05. (B) Knocking down eEF1A2, does not decrease HSP70 protein induction in NSC-34 cells (mouse neuroblastoma/spinal cord fusion cell line). Panel indicates expression of eEF1A2 and HSP70 normalized to GAPDH in heat-shocked samples transfected with eEF1A2 siRNAs and the scrambled non-targeting negative control. Two different RNAi were used to inhibit eEF1A2 isoform: 1A2-a UUAACGGACACAUUCUUCACAUUGA; 1A2-b CAAUCUUGUACACAUCCUGCAGAGG. Cells were transfected with separate siRNAs (Invitrogen) using siLentFect (Bio-Rad), allowed to recover for 24 hr, incubated at 43°C for 2 hr, and then recovered again for 16 hr. Control cells remained at 37°C for the duration of the experiment. Western-blots were analyzed separately for each siRNA and the values related to those of scrambled control. Data are the mean ± SEM is from three independent experiments. (C) Motor neurons express eEF1A2, but not eEF1A1. Immunofluorescence imaging of eEF1A1 (red) and eEF1A2 (green) in the mouse spinal cord shows non-overlapping cytoplasmic staining. eEF1A2 is present only in motor neurons (white arrow). eEF1A1 is present only in smaller interneurons and white matter (glia cells) (yellow arrow). Right panel shows the magnified area (white box in left image). Images were captured at 40x magnification.
DOI:
http://dx.doi.org/10.7554/eLife.03164.007
eEF1A1 regulates HSP70 expression and thermotolerance.
(A) Knock down of eEF1A1 decreases HSP70 protein expression upon heat shock. Western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of MDA-MB231 cells transfected with siRNA (pair A) against eEF1A1 or HSF1, or mock-transfected (Si:NT with no target). Control (C)—unstressed cells kept at 37°C. Heat shock (HS)—cells kept for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (B) HSF1- or eEF1A1-knocked down cells are less thermo-tolerant. Cell death was quantified by FACS analysis after propidium iodide staining. Thermotolerance was induced in mock-transfected (Si:NT) or eEF1A1/HSF1-depleted cells by two heat treatments (1 hr at 43°C, 12 hr at 37°C, and 1 hr at 45°C), followed by 12 hr of recovery. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05. (C) Knock down of eEF1A1 decreases HSP70 mRNA expression during heat shock. Total RNA from heat shocked MDA-MB231 cells was reverse-transcribed with random hexamer primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP70 mRNA in cells depleted of eEF1A1 relative to that obtained for mock-transfected cells (Si:NT). 1 is the value of HSP70 mRNA in Si:NT cells at 1 hr of heat shock. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05. (D) eEF1A1 controls RNAPII occupancy at the HSP70 gene after stress as determined by ChIP-QPCR. Schematic of the HSPA1A locus is shown at the top. Arrowheads indicate the regions amplified by QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1) on RNAPII occupancy relative to input Ct value under non-heat shock conditions (control) and after 30 min of heat shock. The relative value for the IgG is indicated for each of the PCR fragments on top of the plot. Values below that of the IgG mean non-specific binding. Mock-transfected cells (Si:NT). By comparison, GAPDH showed no change with si;eEF1A1. Data from three independent experiments are presented as the mean ± SEM. (*p < 0.05). (E) eEF1A1 mediates HSP70 transcription upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 30 min after HS, cells were fixed and HSP70 mRNA detected by FISH. Nuclei were stained with DAPI. Merged images show Cherry-eEF1A1 in red, HSP70 TS in gray and nucleus in blue. White arrows indicate cells knocked down of eEF1A1. Bar = 10 microns. (F) eEF1A1 mediates HSP70 transcription upon HS. Plots are the quantification of the intensity of HSP70 transcription, per cell or per TS, detected by FISH and quantified by airlocalize. A total of seventy cells per condition were analyzed from three independent experiments. NT = non-transfected cells. eEF1A1 = cells transfected with siRNA for eEF1A1.DOI:
http://dx.doi.org/10.7554/eLife.03164.003
Knock down of eEF1A1 does not affect general translation or cell viability.
(A) Knock down of HSF1 or eEF1A1 by DsiRNA does not affect overall protein synthesis. Pulse-chase experiment with [35S]-methionine in mock transfected cells (−), or cells knocked down for HSF1 (H), or eEF1A1 (E). Cells were kept at 37°C (C) or heat-shocked for 45 min at 40°C followed by a 30 min incubation at 40°C with 50 μCi/ml of [35S] (HS). Numbers at the left indicate molecular weight in kDa. (B) Inhibition of HSF1 or eEF1A1 does not affect normal cell growth. Quantification of cell viability by the MTT assay was performed on mock-transfected cells (Si:NT) or cells depleted of eEF1A1 or HSF1 under normal cell growth conditions. ns = Non significant differences with Si:NT cells.DOI:
http://dx.doi.org/10.7554/eLife.03164.004
eEF1A1 regulates HSP70 expression (all experiments in this figure were done with an alternative pair of siRNAs [pair B] to rule out off-target effects).
(A) Knock down of eEF1A1 decreases HSP70 protein expression upon heat shock. Western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of MBS-MEF cells transfected with siRNA (pair B) against eEF1A1 or mock-transfected (Si:NT with no target). Control (C)—unstressed cells kept at 37°C. Heat shock (HS)—cells kept for 1 hr at 43°C followed by 2 hr of recovery (short induction) or 6 hr of recovery (long induction) at 37°C. Low panels—ponceau staining of the membranes. Numbers indicate molecular weight. Plots show the relative fluorescence intensity of bands as compared to mock-transfected non-stressed cells. (B) Knock down of eEF1A1 decreases HSP70 mRNA expression during HS. Total RNA from heat shocked MDA-MB231 cells was reverse-transcribed with random hexamer primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP70 mRNA in cells depleted of eEF1A1 relative to that obtained for mock-transfected cells (Si:NT). 1 is the value of HSP70 mRNA in Si:NT cells at 1 hr of heat shock. Data from three independent experiments are presented as the mean ± SEM, *p < 0.05. (C) eEF1A1 controls RNAPII occupancy at the HSP70 promoter after stress as determined by ChIP-QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1) on RNAPII occupancy relative to the input Ct value after 30 min of heat shock. The relative value for the IgG is indicated for each of the PCR fragments on top of the plot. Values below that of the IgG mean non-specific binding. Mock-transfected cells (Si:NT). Data from two independent experiments are presented as the mean ± SEM. (D) eEF1A1 mediates HSP70 transcription upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 30 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Yellow arrows indicate TS. Bar = 10 microns. (E) eEF1A1 mediates HSP70 transcription upon HS. Plots are the quantification of the intensity of HSP70 transcription, per cell or per TS, detected by FISH and quantified by airlocalize. A total of 25 cells per condition were analyzed from three independent experiments. NT = non-transfected cells. eEF1A1 = cells transfected with siRNA for eEF1A1.DOI:
http://dx.doi.org/10.7554/eLife.03164.005
Knock down of eEF1A1 reduces HSPs expression in mouse and human cells.
(A) Knock down of eEF1A1 decreases the production of HSP70 in NSC-34 cells (mouseneuroblastoma/spinal cord fusion cell line). The panel indicates expression of eEF1A1 and HSP70 normalized to GAPDH in heat-shocked samples transfected with eEF1A1siRNAs and the scrambled non-targeting negative control. Two different RNAi were used to inhibit eEF1A1 isoform (pair C): 1A1-a UGACAAUCCAGAACAGGAGCGUAGC; 1A1-b AAGUGGAGGGUAGUCAGAGAAGCUC. Cells were transfected with separate siRNAs (Invitrogen) using siLentFect (Bio-Rad), allowed to recover for 24 hr, incubated at 43°C for 2 hr, and then recovered again for 16 hr. Control cells remained at 37°C for the duration of the experiment. Western-blots were analyzed separately for each siRNA and the values related to those of scrambled control. Data are the mean ± SEM is from three independent experiments. (B) Knock down of eEF1A1 suppresses HSP70 protein induction upon heat shock. The panels show western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of WI38 human fibroblast cells mock-transfected (Si:NT) or knocked down of eEF1A1. Cells were heat-shocked for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (C) Knock down of eEF1A1 decreases HSP27 protein induction upon heat shock. The panels show SDS-PAGE and immunoblots of HSP27, eEF1A, and GAPDH from total cell lysates of mock-transfected (Si:NT) MDA-MB231 cells or cells depleted of eEF1A. Cells were heat-shocked for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (D) Knock down of eEF1A1 diminishes HSP70 mRNA expression during heat shock. Total RNA from heat-shocked WI38 cells was reverse-transcribed with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the mean ± SEM amount of HSP70 mRNA from three different experiments in cells depleted of eEF1A1 relative to that detected in mock-transfected cells (Si:NT = 1). *p < 0.05. (E) Knock down of eEF1A1 diminishes HSP27 mRNA expression during heat shock. Total RNA from heat-shocked MDA-MB-231 cells was reverse-transcribed with random primers followed by quantification of GAPDH and HSP27 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the mean ± SEM amount of HSP27 mRNA in cells depleted of eEF1A1 relative to that detected in mock-transfected cells (Si:NT = 1). *p < 0.05. (F) eEF1A1 controls transcription of various heat shock genes. Knock down of eEF1A1 compromises mRNA induction of several major heat-shock genes during heat shock. Total RNA from heat-shocked or unstressed MDA-MB231 cells was reverse-transcribed with random primers followed by quantification of GAPDH and the indicated mRNAs by QPCR. mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP mRNAs in cells inhibited of eEF1A1 relative to that in mock-transfected cells (Si:NT = 1) at 2 hr of heat shock. Means ± SEM are from three independent experiments. *p < 0.05. (G) Role of eEF1A1 in HSR is independent of its role in translation elongation. Quantification of induction of HSP70 mRNA by RT-QPCR after 1 hr of heat shock or treatment with the translation inhibitors cycloheximide (CHX, 50 μg/ml) or doxycycline (DOX, 5 μg/ml) in mock transfected cells or cells knocked down of eEF1A. Data are the mean ± SEM comparing mock transfected with Si:eEF1A1. *p < 0.05 and **p < 0.01.DOI:
http://dx.doi.org/10.7554/eLife.03164.006
eEF1A2 does not support HSR.
(A) eEF1A1, but not eEF1A2, mediates HSP70 induction upon heat shock. The levels of HSP70 mRNA with respect to GAPDH were determined by RT-QPCR after 1 hr of heat shock in mock-transfected cells (si: nt) or cells knocked down of eEF1A1 or eEF1A2. The HSP70 mRNA level is taken as 100% in mock transfected cells. Data are the mean ± SEM from three experiments. *p < 0.05. (B) Knocking down eEF1A2, does not decrease HSP70 protein induction in NSC-34 cells (mouseneuroblastoma/spinal cord fusion cell line). Panel indicates expression of eEF1A2 and HSP70 normalized to GAPDH in heat-shocked samples transfected with eEF1A2siRNAs and the scrambled non-targeting negative control. Two different RNAi were used to inhibit eEF1A2 isoform: 1A2-a UUAACGGACACAUUCUUCACAUUGA; 1A2-b CAAUCUUGUACACAUCCUGCAGAGG. Cells were transfected with separate siRNAs (Invitrogen) using siLentFect (Bio-Rad), allowed to recover for 24 hr, incubated at 43°C for 2 hr, and then recovered again for 16 hr. Control cells remained at 37°C for the duration of the experiment. Western-blots were analyzed separately for each siRNA and the values related to those of scrambled control. Data are the mean ± SEM is from three independent experiments. (C) Motor neurons express eEF1A2, but not eEF1A1. Immunofluorescence imaging of eEF1A1 (red) and eEF1A2 (green) in the mouse spinal cord shows non-overlapping cytoplasmic staining. eEF1A2 is present only in motor neurons (white arrow). eEF1A1 is present only in smaller interneurons and white matter (glia cells) (yellow arrow). Right panel shows the magnified area (white box in left image). Images were captured at 40x magnification.DOI:
http://dx.doi.org/10.7554/eLife.03164.007
Knock down of eEF1A1 decreases overall transcription of HSP70.
(A) Schematic of the HSPA1A locus is shown at the top. Plot shows the occupancy of RNAPII relative to input Ct value in eEF1A1 depleted (Si:eEF1A1) and mock-transfected human fibroblast WI38 cells (Si:NT) as determined by ChIP-QPCR. The values for the IgG control are indicated for each PCR fragment. Media ± SEM values lower than those numbers mean no occupancy. (B) Nuclear run-on analysis of HSPA1A and GAPDH transcription in heat shocked (43°C, 20 min) control fibroblasts (NT) or eEF1A1-knocked down cells (eEF1A1) with two unrelated siRNAs (pair A or pair B). Numbers on the left represent the hybridization probe position. Numbers on the right represent % of run-on transcripts in eEF1A1-knocked down cells as compared to mock-transfected cells. (C) eEF1A1 controls RNAPII occupancy at the HSP70 promoter after stress as determined by ChIP-QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1 [pair B]) on RNAPII occupancy relative to the input Ct value under non-HS conditions (C) or after 30 min of heat shock (HS) on HSP70 and GAPDH promoters. Mock-transfected cells (Si:NT). Data from two independent experiments are presented as the mean ± SEM.DOI:
http://dx.doi.org/10.7554/eLife.03164.008
Characterization of MEFS expressing Cherry-Flag-eEF1A1.
(A) Panels show Western blots of eEF1A1, Flag and GAPDH from total cell lysates of immortalized MEFs (Lionnet et al., 2011) infected with a lentivirus expressing eEF1A1 fused to Cherry and Flag on its N terminus. Wt indicate non-infected cells, sorted are cells sorted to get a homogenous population expressing cherry-eEF1A. Image shows the expression of Cherry-eEF1A1 by fluorescence microscopy after fixation. (B) Percentage of cells with active TS for HSP70 detected by FISH. Data represent median ± SEM from four independent experiments. Time in minutes indicate the length MEF cells were at 43°C before fixation and FISH. TS were counted after microscopy. (C) Percentage of TS for HSP70 detected by FISH. Date represent media ± SEM from four independent experiments. Time in minutes indicate the length MEF cells were heated at 43°C before fixation and FISH.DOI:
http://dx.doi.org/10.7554/eLife.03164.009Analyses of the distribution of RNA polymerase II (RNAPII) along the HSP70 gene as a function of the presence of eEF1A1 supported this conclusion, arguing that eEF1A1 is an activator of transcription upon stress. Chromatin immunoprecipitation (ChIP) and run-on assays demonstrated that knock down of eEF1A1 reduced recruitment of RNAPII throughout the HSP70 gene, indicative of both impaired RNAPII initiation and elongation during heat shock (Figure 1D, Figure 1—figure supplement 2C, Figure 1—figure supplement 5A–C). Under the same conditions, there was no effect of eEF1A1 depletion on RNAPII at the GAPDH gene (Figure 1D, Figure 1—figure supplement 2C). Knock down of eEF1A1 did not change the relative occupancy of RNAPII on HSP70 and GAPDH genes under non-heat shock conditions (Figure 1D).
Figure 1—figure supplement 5.
Knock down of eEF1A1 decreases overall transcription of HSP70.
(A) Schematic of the HSPA1A locus is shown at the top. Plot shows the occupancy of RNAPII relative to input Ct value in eEF1A1 depleted (Si:eEF1A1) and mock-transfected human fibroblast WI38 cells (Si:NT) as determined by ChIP-QPCR. The values for the IgG control are indicated for each PCR fragment. Media ± SEM values lower than those numbers mean no occupancy. (B) Nuclear run-on analysis of HSPA1A and GAPDH transcription in heat shocked (43°C, 20 min) control fibroblasts (NT) or eEF1A1-knocked down cells (eEF1A1) with two unrelated siRNAs (pair A or pair B). Numbers on the left represent the hybridization probe position. Numbers on the right represent % of run-on transcripts in eEF1A1-knocked down cells as compared to mock-transfected cells. (C) eEF1A1 controls RNAPII occupancy at the HSP70 promoter after stress as determined by ChIP-QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1 [pair B]) on RNAPII occupancy relative to the input Ct value under non-HS conditions (C) or after 30 min of heat shock (HS) on HSP70 and GAPDH promoters. Mock-transfected cells (Si:NT). Data from two independent experiments are presented as the mean ± SEM.
DOI:
http://dx.doi.org/10.7554/eLife.03164.008
We used single molecule fluorescence in situ hybridization (smFISH) and airlocalize software (Lionnet et al., 2011) to assess the kinetics of HSP70 transcription (from control growth conditions to 2 hr of HS) and quantify the number of HSP70 transcription sites (TS) per cell and the transcription activity per TS in the presence or absence of eEF1A1. eEF1A1 knock down was monitored in immortalized mouse embryonic fibroblast (MEFs) from the homozygous Actb-MBSmouse strain (Lionnet et al., 2011) expressing eEF1A1 fused to cherry and Flag, by the decrease in cherry detection (Figure 1E, Figure 1—figure supplement 1D, Figure 1—figure supplement 6A). At 30 min of HS, 80% of cells showed a strong nuclear FISH signal that accounted for active HSP70 transcription in at least 1 of its 4 alleles (MEFs are tetraploid) (Figure 1E, Figure 1—figure supplement 1D, Figure 1—figure supplement 6B,C). Cells knocked down for eEF1A1 showed half (pair A) or third (pair B) of the intensity of transcription per cell (Figure 1F, Figure 1—figure supplement 1E). This result is in perfect correlation with the quantification of HSP70 mRNA, nuclear run-on and ChIP experiments. This decrease of transcription intensity per cell is due to both a decrease in the intensity quantified per TS (Figure 1F, Figure1—figure supplement 1D) and a reduction in the number of TS per cell from a mean of 3 TS per cell in non-transfected cells to 2.6 TS in cells knocked down for eEF1A1 (siRNA pair A) and from 2.8 to 2.1 (siRNA pair B).
Figure 1—figure supplement 6.
Characterization of MEFS expressing Cherry-Flag-eEF1A1.
(A) Panels show Western blots of eEF1A1, Flag and GAPDH from total cell lysates of immortalized MEFs (Lionnet et al., 2011) infected with a lentivirus expressing eEF1A1 fused to Cherry and Flag on its N terminus. Wt indicate non-infected cells, sorted are cells sorted to get a homogenous population expressing cherry-eEF1A. Image shows the expression of Cherry-eEF1A1 by fluorescence microscopy after fixation. (B) Percentage of cells with active TS for HSP70 detected by FISH. Data represent median ± SEM from four independent experiments. Time in minutes indicate the length MEF cells were at 43°C before fixation and FISH. TS were counted after microscopy. (C) Percentage of TS for HSP70 detected by FISH. Date represent media ± SEM from four independent experiments. Time in minutes indicate the length MEF cells were heated at 43°C before fixation and FISH.
DOI:
http://dx.doi.org/10.7554/eLife.03164.009
eEF1A1 enhances the binding of HSF1 to HSP70 promoter
To gain further insight in the mechanism by which eEF1A1 regulates transcription of HSP genes, we explored the activation of HSF1. Upon stress, HSF1 quickly trimerizes, acquires the ability to bind HSE (Baler et al., 1993; Sarge et al., 1993; Guertin and Lis, 2010; Anckar and Sistonen, 2011), and reactivates paused RNAPII via a mechanism involving recruitment of the Mediator complex, the CTD kinase P-TEFb (Park et al., 2001; Ni et al., 2004; Shen et al., 2009) and the SWI/SNF chromatin remodeling complex (Corey et al., 2003). In MDA-MB231 cells, as in other cell lines, HSF1 is localized in the nucleus under normal growth conditions. In mammalian cells, HSE binding activity assessed by EMSA is entirely due to HSF1 (Figure 2D, Figure 2—figure supplement 1B). This binding activity was reduced in the protein extract (10 μg) from eEF1A1-knocked down cells (Figure 2A). Likewise, knock down of eEF1A1 also resulted in a significant reduction in recruitment of HSF1 to the HSP70 promoter, as determined by ChIP assays (Figure 2B). The low levels of HSF1 binding to HSP70 promoter under control conditions did not change in cells knocked down of eEF1A1. These results indicate that eEF1A1 enhances the binding of HSF1 to HSP70 promoter and suggest an interaction between eEF1A1 and HSF1 during HS.
Figure 2.
eEF1A1 mediates HSF1 recruitment to HSP70 promoter.
(A) eEF1A1 enhances HSF1 DNA binding upon heat shock. Mock-transfected, eEF1A1 or HSF1-knocked down MDA-MB231 cells were heat-shocked for 30 min at 43°C and analyzed by HSF1-HSE EMSA (top panel). 10 μg of total protein were loaded in the EMSA. HSF1, eEF1A1, and GAPDH levels were determined by immunoblotting (lower panel). (B) eEF1A1 is required for HSF1 promoter binding in vivo. ChIP-QPCR was performed on mock-transfected (Si:NT) or eEF1A1-knocked down (Si:eEF1A1) cells. Panel shows the effect of eEF1A1 depletion on HSF1 occupancy at the HSP70 promoter (relative to the input Ct value) under non-heat shock conditions (C) and after 30 min of heat shock (HS). The reference value for IgG control is indicated on top of the plot. Values below those numbers mean non-specific binding. Data from three independent experiments are represented as the mean ± SEM. (*p < 0.05). (C) Stress-induced formation of the eEF1A1-HSF1 complex in vivo. Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells IPed with eEF1A1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting. (D) eEF1A1-HSF1 complex formation at HSE. Panels show the super-shift of HSF1-HSE EMSA caused by specified antibodies. MDA-MB231 cells were heat-shocked for 20 min at 43°C (HS). Extracts were incubated with antibodies to HSF1, HSF2 (positive control), or eEF1A1 antibodies, or IgG (mock). HSE-HSF1 indicates specific binding of HSF1 to labeled HSE; NS—a non-specific band. (E) Direct binding of eEF1A1 to HSP70 promoter DNA. Radiolabeled fragment of the region −141 to −91 of the human HSP70 promoter was incubated with purified eEF1A1 (lanes 1–3), chased with fivefold molar excess of cold oligonucleotide (lanes 4 and 5), or mutant fragment of the same region (lane 6). Arrows mark the specific eEF1A1 shift. (F) eEF1A1 binds the HSP70 promoter before and after stress. Mock transfected or eEF1A1-knocked down (Si:eEF1A) MDA-MB231 cells were kept at 37°C or heat-shocked (HS) for 20 min at 43°C. Chromatin IP with eEF1A1 or IgG antibodies and amplified by PCR for the HSP70 (HSPA1A) and GAPDH promoters. Relative value of the control IgG vs input for HSPA1A is 0.04 and for GAPDH is 0.05. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05.
DOI:
http://dx.doi.org/10.7554/eLife.03164.010
(A) Stress-induced formation of the eEF1A1-HSF1 complex in vivo. Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells IP with HSF1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting. (B) RNA-dependent formation of the eEF1A-HSF1-HSE complex is specific to heat shock. Top panel shows the super-shift of HSF1-HSE EMSA caused by specified antibodies. MDA-MB-231 cells were heat shocked for 20 min at 43°C (HS) or treated with 80 μM arsenite for 2 hr (right panel). Cell extracts were incubated with HSF1 or eEF1A1 antibodies or IgG (mock). In parallel, cells were also treated with RNAse A prior to EMSA (lower panel). (C) Chromatin from MDA-MB231 cells was IP with eEF1A1 and IgG antibodies and amplified by PCR targeting the HSP27 promoter region. Control—cells kept at 37°C, HS—cells heat shocked at 43°C for 30 min. Values below IgG number mean no occupancy.
DOI:
http://dx.doi.org/10.7554/eLife.03164.011
Figure 2—figure supplement 1.
eEF1A1 interacts with HSF1 at HSE upon stress and binds HSP27 promoter.
(A) Stress-induced formation of the eEF1A1-HSF1 complex in vivo. Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells IP with HSF1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting. (B) RNA-dependent formation of the eEF1A-HSF1-HSE complex is specific to heat shock. Top panel shows the super-shift of HSF1-HSE EMSA caused by specified antibodies. MDA-MB-231 cells were heat shocked for 20 min at 43°C (HS) or treated with 80 μM arsenite for 2 hr (right panel). Cell extracts were incubated with HSF1 or eEF1A1 antibodies or IgG (mock). In parallel, cells were also treated with RNAse A prior to EMSA (lower panel). (C) Chromatin from MDA-MB231 cells was IP with eEF1A1 and IgG antibodies and amplified by PCR targeting the HSP27 promoter region. Control—cells kept at 37°C, HS—cells heat shocked at 43°C for 30 min. Values below IgG number mean no occupancy.
DOI:
http://dx.doi.org/10.7554/eLife.03164.011
eEF1A1 mediates HSF1 recruitment to HSP70 promoter.
(A) eEF1A1 enhances HSF1 DNA binding upon heat shock. Mock-transfected, eEF1A1 or HSF1-knocked down MDA-MB231 cells were heat-shocked for 30 min at 43°C and analyzed by HSF1-HSE EMSA (top panel). 10 μg of total protein were loaded in the EMSA. HSF1, eEF1A1, and GAPDH levels were determined by immunoblotting (lower panel). (B) eEF1A1 is required for HSF1 promoter binding in vivo. ChIP-QPCR was performed on mock-transfected (Si:NT) or eEF1A1-knocked down (Si:eEF1A1) cells. Panel shows the effect of eEF1A1 depletion on HSF1 occupancy at the HSP70 promoter (relative to the input Ct value) under non-heat shock conditions (C) and after 30 min of heat shock (HS). The reference value for IgG control is indicated on top of the plot. Values below those numbers mean non-specific binding. Data from three independent experiments are represented as the mean ± SEM. (*p < 0.05). (C) Stress-induced formation of the eEF1A1-HSF1 complex in vivo. Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells IPed with eEF1A1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting. (D) eEF1A1-HSF1 complex formation at HSE. Panels show the super-shift of HSF1-HSE EMSA caused by specified antibodies. MDA-MB231 cells were heat-shocked for 20 min at 43°C (HS). Extracts were incubated with antibodies to HSF1, HSF2 (positive control), or eEF1A1 antibodies, or IgG (mock). HSE-HSF1 indicates specific binding of HSF1 to labeled HSE; NS—a non-specific band. (E) Direct binding of eEF1A1 to HSP70 promoter DNA. Radiolabeled fragment of the region −141 to −91 of the humanHSP70 promoter was incubated with purified eEF1A1 (lanes 1–3), chased with fivefold molar excess of cold oligonucleotide (lanes 4 and 5), or mutant fragment of the same region (lane 6). Arrows mark the specific eEF1A1 shift. (F) eEF1A1 binds the HSP70 promoter before and after stress. Mock transfected or eEF1A1-knocked down (Si:eEF1A) MDA-MB231 cells were kept at 37°C or heat-shocked (HS) for 20 min at 43°C. Chromatin IP with eEF1A1 or IgG antibodies and amplified by PCR for the HSP70 (HSPA1A) and GAPDH promoters. Relative value of the control IgG vs input for HSPA1A is 0.04 and for GAPDH is 0.05. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05.DOI:
http://dx.doi.org/10.7554/eLife.03164.010
eEF1A1 interacts with HSF1 at HSE upon stress and binds HSP27 promoter.
(A) Stress-induced formation of the eEF1A1-HSF1 complex in vivo. Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells IP with HSF1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting. (B) RNA-dependent formation of the eEF1A-HSF1-HSE complex is specific to heat shock. Top panel shows the super-shift of HSF1-HSE EMSA caused by specified antibodies. MDA-MB-231 cells were heat shocked for 20 min at 43°C (HS) or treated with 80 μM arsenite for 2 hr (right panel). Cell extracts were incubated with HSF1 or eEF1A1 antibodies or IgG (mock). In parallel, cells were also treated with RNAse A prior to EMSA (lower panel). (C) Chromatin from MDA-MB231 cells was IP with eEF1A1 and IgG antibodies and amplified by PCR targeting the HSP27 promoter region. Control—cells kept at 37°C, HS—cells heat shocked at 43°C for 30 min. Values below IgG number mean no occupancy.DOI:
http://dx.doi.org/10.7554/eLife.03164.011Consistent with the above observations, HSF1 co-immunoprecipitated with eEF1A1 upon HS (Figure 2C, Figure 2—figure supplement 1A). Moreover, eEF1A1 formed a ternary complex with HSF1 and DNA. Heat shock or arsenic treatments induce HSF1 DNA binding, as detected by EMSA. Under these conditions, anti-HSF1 and anti-eEF1A1, but not mouse IgG, super-shifted the HSF1–DNA complex (Figure 2D, Figure 2—figure supplement 1B). We noted that the super-shifts with anti-eEF1A1 and anti-HSF2 antibodies were similar. Considering that HSF2 binds HSE only when forming a hetero-trimer with HSF1 (Ostling et al., 2007), this observation indicates further that eEF1A1 associates directly with DNA-bound HSF1. Moreover, in vitro binding of recombinant eEF1A1 to a DNA fragment of HSP70 promoter suggests direct and specific, albeit a relatively weak, interaction of eEF1A1 to HSP70 promoter (Figure 2E). We further confirmed the presence of eEF1A1 at the HSP70 locus by ChIP-QPCR experiments with an eEF1A1-specific antibody (Figure 2F, Figure 2—figure supplement 1C). Occupancy of HSP70 and HSP27 promoters by eEF1A1 was significantly higher (p < 0.05) than at the GAPDH promoter. These results demonstrate that eEF1A1 binds specifically to promoters of at least two HSP genes before and after stress.Together, the above results demonstrate that eEF1A1 recruits HSF1 to the HSP70 promoter upon stress and triggers HSR by functioning as a transcriptional co-activator.
eEF1A1 localizes to HSP70 transcription sites and interacts with RNAPII
Observations described above strongly suggest that eEF1A1 is in the nucleus of the cell at the TS of HSP70. To gain further insight in the cellular localization of eEF1A1 regarding HSP70 mRNA, we used fluorescence in situ hybridization (FISH). We used the MEFs expressing eEF1A1 fused to Cherry and Flag (Figure 1—figure supplement 5A), and we infected human diploid fibroblasts (TIGs) to also express recombinant eEF1A1 protein fused to Cherry and Flag (Figure 3—figure supplement 1). MEFs were subjected to different times of HS (from 0 to 60 min) before visualizing HSP70 mRNA. From 30 to 60 min of HS ∼80% of the cells showed a strong nuclear FISH signal that accounted for active HSP70 transcription (Figure 3A, Figure 1—figure supplement 5B,C). After 30 min of heat shock, we quantified the dots representing Cherry-eEF1A1 concentrated at several HSP70 TS (Figure 3A, Figure 3—figure supplement 2). Percentages of HSP70 TS with a positive signal for Cherry-eEF1A1 were quantified by airlocalize™ software (Lionnet et al., 2011). The percent of Cherry-eEF1A colocalizing with the HSP TS increased from 27% to −64% for 30 to 60 min (Figure 3C). Using probes for β-actin TS instead of those for HSP70 (Figure 3B), we did not see any co-localization with eEF1A nuclear dots. The Cherry-eEF1A dots were not a result of bleed through of the FISH signal because when HSP70 FISH was performed in MEFs that do not express Cherry-eEF1A1, nuclear dots in the red channel were rarely apparent, and when FISH was not performed the Cherry-eEF1A1 dots remained evident (Figure 3—figure supplement 3) The presence of eEF1A1 at HSP70 TS was further confirmed in a human fibroblast cell line (TIG) (Figure 3—figure supplement 1).
Figure 3—figure supplement 1.
eEF1A1 localizes to HSP70 TS in the human fibroblast cell line TIG.
eEF1A1 localizes to HSP70 TS upon HS. TIGs (human fibroblast cell line) cells were infected with a lentivirus that expresses Cherry-eEF1A1. After 30 min of HS cells were fixed and subjected to FISH to the HSP70 mRNA. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrows indicate TS for HSP70 where cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with colocalization for eEF1A1. Bar = 10 microns.
DOI:
http://dx.doi.org/10.7554/eLife.03164.013
Figure 3.
eEF1A1 localizes at HSP70 TS and interacts with RNAPII upon HS.
(A) eEF1A1 localizes to HSP70 TS upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At the indicated times after HS, cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. The nascent mRNA signal is much brighter than the Cherry-eEF1A1 because there were many nascent chains each detected with 48 probes (48 fluors), compared to a single fluorescent protein for eEF1A1, further diminished by fixation. Yellow arrows indicate TS for HSP70 where Cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with co-localization for eEF1A1. Bar = 10 microns. (B) eEF1A1 localizes in nuclear dots. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At 1 hr of HS cells were fixed and FISH was carried out to detect β-actin mRNA. Nucleus DAPI stained. Merged images show HSP70 FISH in green and Cherry-eEF1A1 in red. Arrowhead = inset location. Note that nuclear localization of Cherry-eEF1A1 does not coincide with the β-actin mRNA TS. (C) Quantification of co-localization between eEF1A1 and HSP70 TS. Percentages of co-localization were quantified by airlocalize software at the indicated HS times. Average of three different experiments. Total n = (80–90) cells per time point. (D) DRB decreases RNAPIIS2 and eEF1A1 occupancy within the HSP70 gene in HS cells. Data are the mean ± SEM from three independent experiments. MEF cells expressing eEF1A1 tagged with Cherry and Flag were kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 µM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for RNAPII phosphorylated at Ser2 (RNAPS2) and Flag eEF1A1 followed by QPCR with the indicated primers. (E) eEF1A1 binds RNAPII during heat shock. Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells were IP with an eEF1A1 antibody or IgG (mock). IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting with RNAPII and eEF1A1 antibodies. (*) Indicates the hyperphosphorylated form of RNAPII.
DOI:
http://dx.doi.org/10.7554/eLife.03164.012
eEF1A1 localizes to HSP70 TS upon HS. TIGs (human fibroblast cell line) cells were infected with a lentivirus that expresses Cherry-eEF1A1. After 30 min of HS cells were fixed and subjected to FISH to the HSP70 mRNA. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrows indicate TS for HSP70 where cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with colocalization for eEF1A1. Bar = 10 microns.
DOI:
http://dx.doi.org/10.7554/eLife.03164.013
MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At the indicated times after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrows indicate TS for HSP70 where cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with colocalization for eEF1A1. Bar = 10 microns.
DOI:
http://dx.doi.org/10.7554/eLife.03164.014
The upper panels show immortalized MEFs expressing Cherry-eEF1A1 treated for FISH without adding any probe. Cells were heated for 40 min at 43°C before fixation. Nucleus stained with DAPI. Yellow arrows indicate dots of cherry-eEF1A accumulation in the nucleus. The lower panels show FISH for HSP70 mRNA in inmortalized MEFs non-expressing Cherry-eEF1A1. Cells were heated for 40 min at 43°C before fixation and FISH. Yellow arrows indicate HSP70 TS.
DOI:
http://dx.doi.org/10.7554/eLife.03164.015
(A). Data are the mean ± SEM from three independent experiments. MEF cells expressing eEF1A1 tagged with Cherry and Flag were kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 μM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for total RNAPII followed by QPCR with primers for the indicated regions. (B) DRB decreases eEF1A1 occupancy within the HSP70 gene upon HS. Data are the mean ± SEM from three independent experiments. Transformed MEFs were mock treated and kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 μM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for eEF1A1 and Flag (in Flag–cells) or IgG followed by QPCR with the indicated primers.
DOI:
http://dx.doi.org/10.7554/eLife.03164.016
Figure 3—figure supplement 2.
eEF1A1 localizes to HSP70 TS upon HS.
MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At the indicated times after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrows indicate TS for HSP70 where cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with colocalization for eEF1A1. Bar = 10 microns.
DOI:
http://dx.doi.org/10.7554/eLife.03164.014
Figure 3—figure supplement 3.
eEF1A1 localizes to HSP70 TS upon HS-negative controls.
The upper panels show immortalized MEFs expressing Cherry-eEF1A1 treated for FISH without adding any probe. Cells were heated for 40 min at 43°C before fixation. Nucleus stained with DAPI. Yellow arrows indicate dots of cherry-eEF1A accumulation in the nucleus. The lower panels show FISH for HSP70 mRNA in inmortalized MEFs non-expressing Cherry-eEF1A1. Cells were heated for 40 min at 43°C before fixation and FISH. Yellow arrows indicate HSP70 TS.
DOI:
http://dx.doi.org/10.7554/eLife.03164.015
eEF1A1 localizes at HSP70 TS and interacts with RNAPII upon HS.
(A) eEF1A1 localizes to HSP70 TS upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At the indicated times after HS, cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. The nascent mRNA signal is much brighter than the Cherry-eEF1A1 because there were many nascent chains each detected with 48 probes (48 fluors), compared to a single fluorescent protein for eEF1A1, further diminished by fixation. Yellow arrows indicate TS for HSP70 where Cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with co-localization for eEF1A1. Bar = 10 microns. (B) eEF1A1 localizes in nuclear dots. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At 1 hr of HS cells were fixed and FISH was carried out to detect β-actin mRNA. Nucleus DAPI stained. Merged images show HSP70 FISH in green and Cherry-eEF1A1 in red. Arrowhead = inset location. Note that nuclear localization of Cherry-eEF1A1 does not coincide with the β-actin mRNA TS. (C) Quantification of co-localization between eEF1A1 and HSP70 TS. Percentages of co-localization were quantified by airlocalize software at the indicated HS times. Average of three different experiments. Total n = (80–90) cells per time point. (D) DRB decreases RNAPIIS2 and eEF1A1 occupancy within the HSP70 gene in HS cells. Data are the mean ± SEM from three independent experiments. MEF cells expressing eEF1A1 tagged with Cherry and Flag were kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 µM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for RNAPII phosphorylated at Ser2 (RNAPS2) and FlageEF1A1 followed by QPCR with the indicated primers. (E) eEF1A1 binds RNAPII during heat shock. Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells were IP with an eEF1A1 antibody or IgG (mock). IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting with RNAPII and eEF1A1 antibodies. (*) Indicates the hyperphosphorylated form of RNAPII.DOI:
http://dx.doi.org/10.7554/eLife.03164.012
eEF1A1 localizes to HSP70 TS in the human fibroblast cell line TIG.
eEF1A1 localizes to HSP70 TS upon HS. TIGs (human fibroblast cell line) cells were infected with a lentivirus that expresses Cherry-eEF1A1. After 30 min of HS cells were fixed and subjected to FISH to the HSP70 mRNA. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrows indicate TS for HSP70 where cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with colocalization for eEF1A1. Bar = 10 microns.DOI:
http://dx.doi.org/10.7554/eLife.03164.013
eEF1A1 localizes to HSP70 TS upon HS.
MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At the indicated times after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrows indicate TS for HSP70 where cherry-eEF1A1 was also detected. Inset location indicated by white arrowheads. n = total number of cells analyzed from three independent experiments. (%) = percentage of TS with colocalization for eEF1A1. Bar = 10 microns.DOI:
http://dx.doi.org/10.7554/eLife.03164.014
eEF1A1 localizes to HSP70 TS upon HS-negative controls.
The upper panels show immortalized MEFs expressing Cherry-eEF1A1 treated for FISH without adding any probe. Cells were heated for 40 min at 43°C before fixation. Nucleus stained with DAPI. Yellow arrows indicate dots of cherry-eEF1Aaccumulation in the nucleus. The lower panels show FISH for HSP70 mRNA in inmortalized MEFs non-expressing Cherry-eEF1A1. Cells were heated for 40 min at 43°C before fixation and FISH. Yellow arrows indicate HSP70 TS.DOI:
http://dx.doi.org/10.7554/eLife.03164.015
DRB decreases RNAPII and eEF1A1 occupancy within the HSP70 gene upon HS.
(A). Data are the mean ± SEM from three independent experiments. MEF cells expressing eEF1A1 tagged with Cherry and Flag were kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 μM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for total RNAPII followed by QPCR with primers for the indicated regions. (B) DRB decreases eEF1A1 occupancy within the HSP70 gene upon HS. Data are the mean ± SEM from three independent experiments. Transformed MEFs were mock treated and kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 μM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for eEF1A1 and Flag (in Flag–cells) or IgG followed by QPCR with the indicated primers.DOI:
http://dx.doi.org/10.7554/eLife.03164.016Since several molecules of eEF1A need to accumulate in a discrete site to be detected by microscopy, we hypothesized that the presence of eEF1A at HSP70 TS not only depends on its interaction with HSF1, but also on the increase in transcription. ChIP analysis of heated MEF cells (expressing Flag-eEF1A1 or not) showed that eEF1A1 occupancy of HSP70 gene increases in the ORF and 3′UTR upon HS, as does RNAPIIS2 and RNAPII (Figure 3D, Figure 3—figure supplement 4A,B). When RNAPII elongation was inhibited by DRB treatment before HS, RNAPIIS2 occupancy on HSP70 gene was abolished (Figure 3D). Interestingly, the eEF1A1 occupancy inside HSP70 locus was reduced (p = 0.0585) as it was for total RNAPII (p = 0.0316) (Figure 3D, Figure 3—figure supplement 4A,B)
Figure 3—figure supplement 4.
DRB decreases RNAPII and eEF1A1 occupancy within the HSP70 gene upon HS.
(A). Data are the mean ± SEM from three independent experiments. MEF cells expressing eEF1A1 tagged with Cherry and Flag were kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 μM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for total RNAPII followed by QPCR with primers for the indicated regions. (B) DRB decreases eEF1A1 occupancy within the HSP70 gene upon HS. Data are the mean ± SEM from three independent experiments. Transformed MEFs were mock treated and kept under normal growth conditions (control) or heat-shocked for 40 min at 43°C (HS) or treated with 100 μM DRB for 15 min followed by HS (HS+DRB). ChIP was performed using antibodies for eEF1A1 and Flag (in Flag–cells) or IgG followed by QPCR with the indicated primers.
DOI:
http://dx.doi.org/10.7554/eLife.03164.016
This result together with the fact that eEF1A1 co-immunoprecipitates with the RNAPII (Figure 3E) suggests that eEF1A1 interacts with the transcription elongation complex during HSP70 transcription.
eEF1A1 binds to the 3′UTR of HSP70 and regulates its stability
Detection of eEF1A1 at the 3′ end of HSP70 gene suggests a role for this protein beyond transcription. Thus, we investigated the interaction between eEF1A1 and HSP70 mRNA in the soluble chromatin fraction of control and HS cells. HSP70 mRNA association with eEF1A was detected by RNA-IP in HS cells (Figure 4A). In RNA-IP experiments from total cell lysates, we also detected HSP70 mRNA associated with eEF1A1 and other known HSP70 mRNA-binders, poly(A)-binding protein 1 (PABP1) and nuclear pore complex (NPC) protein TPR1 (Skaggs et al., 2007; Figure 4B).
Figure 4.
eEF1A1 binds the 3′UTR of HSP70 mRNA and stabilizes it.
(A) eEF1A1 binds chromatin-associated HSP70 mRNA. Native ChIP samples were IPed using anti-eEF1A1 antibodies and reverse transcribed followed by HSP70 mRNA quantification. Data are represented as mean ± SEM from three independent experiments. (B) eEF1A1 interacts with the HSP70 mRNA in vivo as detected by RNA-IP. The panel shows the RT-PCR products of HSP70 and GAPDH mRNA from control (C) and heat-shocked (HS) cells after IP with indicated antibodies. IgG indicates the mock control. Input is total RNA. (C) Interaction between the HSP70 mRNA 3′UTR and eEF1A1 as detected by RNA-EMSA. 4 μg of purified eEF1A1 were incubated with 105 cpm of the 3′UTR or 5′UTR of HSP70 mRNA or a 200 nt fragment of the β-actin ORF radiolabeled by in vitro transcription. Only the 3′UTR of HSP70 mRNA was shifted by eEF1A1 (red line) and further super-shifted by 4 μg of antibody against eEF1A1 (red star). (D) Knock down of eEF1A1 diminishes HSP70 mRNA stability. Actinomycin D (Ac) was added 30 min after the onset of heat shock. The level of HSP70 and GAPDH mRNA at this time was taken as 100%. Data are represented as mean ± SEM from three experiments. *p < 0.05. (E) eEF1A1-mediates luciferase expression cloned in a HSP70 backbone plasmid. Mock transfected (si:NT) or eEF1A1-knocked down (si:EF) MDA-MB231 cells were transfected with plasmids expressing the SV40- or HSP70-driven luciferase gene fused to the HSP70 3′UTR, and a SV40-renilla luciferase plasmid used as a control. Luciferase activity was measured in cells heat-shocked for 1 hr at 43°C followed by 4 hr of recovery at 37°C. The values were normalized to those of renilla in the same cellular extracts. Bars represent luciferase activity in eEF1A1-deficient cells relative to that obtained for mock-transfected cells. Data are represented as mean ± SEM from three experiments. *p < 0.05.
DOI:
http://dx.doi.org/10.7554/eLife.03164.017
(A) Knock down of eEF1A1 diminishes HSP70 mRNA stability. Actinomycin D (Ac) was added 30 min after the onset of heat shock. The level of HSP70 and GAPDH mRNA at this time point was taken as 100%. Data are represented as mean ± SEM from two experiments. (B) eEF1A1 binds to stem-loop 2 of the HSP70 3′UTR as determined by EMSA. Indicated concentrations of purified eEF1A1 were incubated with 20 kcpm of in vitro transcribed, end labeled HSPA1A 3′UTR RNA (∼0.1 pmol/µl) for 30 min at room temperature. Probe Wt refers to HSPA1A 3′UTR sequence, ΔSL1 is the deletion of nt 7–34, ΔSL2 is the deletion of nt 83–93, 151–158, ΔSL3 is the deletion of nt 217–226, 246–255. M-fold predicted structure for HSPA1A 3′UTR is shown. The stem-loops are marked SL1, SL2, and SL3. The deletion regions are indicated by red rectangles. (C) Determination of the dissociation constant for eEF1A1-HSP70 3′UTR. Experiment was performed as in B.
DOI:
http://dx.doi.org/10.7554/eLife.03164.018
eEF1A1 binds the 3′UTR of HSP70 mRNA and stabilizes it.
(A) eEF1A1 binds chromatin-associated HSP70 mRNA. Native ChIP samples were IPed using anti-eEF1A1 antibodies and reverse transcribed followed by HSP70 mRNA quantification. Data are represented as mean ± SEM from three independent experiments. (B) eEF1A1 interacts with the HSP70 mRNA in vivo as detected by RNA-IP. The panel shows the RT-PCR products of HSP70 and GAPDH mRNA from control (C) and heat-shocked (HS) cells after IP with indicated antibodies. IgG indicates the mock control. Input is total RNA. (C) Interaction between the HSP70 mRNA 3′UTR and eEF1A1 as detected by RNA-EMSA. 4 μg of purified eEF1A1 were incubated with 105 cpm of the 3′UTR or 5′UTR of HSP70 mRNA or a 200 nt fragment of the β-actin ORF radiolabeled by in vitro transcription. Only the 3′UTR of HSP70 mRNA was shifted by eEF1A1 (red line) and further super-shifted by 4 μg of antibody against eEF1A1 (red star). (D) Knock down of eEF1A1 diminishes HSP70 mRNA stability. Actinomycin D (Ac) was added 30 min after the onset of heat shock. The level of HSP70 and GAPDH mRNA at this time was taken as 100%. Data are represented as mean ± SEM from three experiments. *p < 0.05. (E) eEF1A1-mediates luciferase expression cloned in a HSP70 backbone plasmid. Mock transfected (si:NT) or eEF1A1-knocked down (si:EF) MDA-MB231 cells were transfected with plasmids expressing the SV40- or HSP70-driven luciferase gene fused to the HSP70 3′UTR, and a SV40-renilla luciferase plasmid used as a control. Luciferase activity was measured in cells heat-shocked for 1 hr at 43°C followed by 4 hr of recovery at 37°C. The values were normalized to those of renilla in the same cellular extracts. Bars represent luciferase activity in eEF1A1-deficient cells relative to that obtained for mock-transfected cells. Data are represented as mean ± SEM from three experiments. *p < 0.05.DOI:
http://dx.doi.org/10.7554/eLife.03164.017(A) Knock down of eEF1A1 diminishes HSP70 mRNA stability. Actinomycin D (Ac) was added 30 min after the onset of heat shock. The level of HSP70 and GAPDH mRNA at this time point was taken as 100%. Data are represented as mean ± SEM from two experiments. (B) eEF1A1 binds to stem-loop 2 of the HSP70 3′UTR as determined by EMSA. Indicated concentrations of purified eEF1A1 were incubated with 20 kcpm of in vitro transcribed, end labeled HSPA1A 3′UTR RNA (∼0.1 pmol/µl) for 30 min at room temperature. Probe Wt refers to HSPA1A 3′UTR sequence, ΔSL1 is the deletion of nt 7–34, ΔSL2 is the deletion of nt 83–93, 151–158, ΔSL3 is the deletion of nt 217–226, 246–255. M-fold predicted structure for HSPA1A 3′UTR is shown. The stem-loops are marked SL1, SL2, and SL3. The deletion regions are indicated by red rectangles. (C) Determination of the dissociation constant for eEF1A1-HSP70 3′UTR. Experiment was performed as in B.DOI:
http://dx.doi.org/10.7554/eLife.03164.018We then used RNA-EMSA to test for a direct interaction between eEF1A1 and HSP70 mRNA. eEF1A1 altered the mobility of the 3′UTR HSP70 mRNA probe, but not that of the 5′ portion of the HSP70 mRNA or of an unrelated RNA (200 nt β-actin ORF) (Figure 4C). These observations prompted us to investigate a role for eEF1A1 in stabilizing HSP mRNA. We monitored HSP70 and GAPDH mRNA decay after inhibition of transcription by actinomycin D (Figure 4D, Figure 4—figure supplement 1A). After 30 min of HS treatment, the rate of HSP70 mRNA decay increased substantially in eEF1A1-depleted cells, as compared to mock-transfected cells. In contrast, no change in the rate of GAPDH mRNA decay was observed.
Figure 4—figure supplement 1.
eEF1A1 binds the 3′UTR of HSP70 mRNA and stabilizes it.
(A) Knock down of eEF1A1 diminishes HSP70 mRNA stability. Actinomycin D (Ac) was added 30 min after the onset of heat shock. The level of HSP70 and GAPDH mRNA at this time point was taken as 100%. Data are represented as mean ± SEM from two experiments. (B) eEF1A1 binds to stem-loop 2 of the HSP70 3′UTR as determined by EMSA. Indicated concentrations of purified eEF1A1 were incubated with 20 kcpm of in vitro transcribed, end labeled HSPA1A 3′UTR RNA (∼0.1 pmol/µl) for 30 min at room temperature. Probe Wt refers to HSPA1A 3′UTR sequence, ΔSL1 is the deletion of nt 7–34, ΔSL2 is the deletion of nt 83–93, 151–158, ΔSL3 is the deletion of nt 217–226, 246–255. M-fold predicted structure for HSPA1A 3′UTR is shown. The stem-loops are marked SL1, SL2, and SL3. The deletion regions are indicated by red rectangles. (C) Determination of the dissociation constant for eEF1A1-HSP70 3′UTR. Experiment was performed as in B.
DOI:
http://dx.doi.org/10.7554/eLife.03164.018
To roughly map the region within HSP70 3′UTR that binds eEF1A1, we generated three deletion constructs of stem-loops according to the m-fold predicted structure (Figure 4—figure supplement 1B). The deletions ΔSL1 (Δ7–34) or ΔSL3 (Δ217–226, Δ246–255) did not reduce eEF1A1 binding to the 3′UTR significantly (Figure 4—figure supplement 1B), whereas the deletions in stem-loop 2 (ΔSL2–Δ83–93, Δ151–158) abolished eEF1A1 binding, indicating that this region was the primary interacting site for eEF1A1. The Kd for the eEF1A1-HSP70 3UTR complex was estimated to be ∼100 nM (Figure 4—figure supplement 1C).Since we observed eEF1A1 associated specifically with the HSP70 promoter and then with the RNAPII elongation complex, we examined if HSP70 mRNA stabilization by eEF1A1 required both the cognate promoter and the 3′UTR. To test this, we placed the luciferase ORF, with or without the HSP70 3′UTR, under regulation of the SV40 or HSP70 promoter. Upon heat shock, only the presence of both the HSP70 promoter and 3′UTR resulted in a steep decrease of luciferase activity in eEF1A1-knocked down cells (Figure 4E). In contrast, when HSP70 containing its 3′UTR was expressed from an SV40 promoter, no decay was evident. This supports the model that eEF1A1-mediated mRNA stabilization resulted from the recruitment of eEF1A1 during transcription and its subsequent association with the 3′UTR.
eEF1A1 facilitates HSP70 mRNA nuclear export
It is well established that export of non-HSP RNAs is inhibited during HS (Carmody et al., 2010). We observed HSP70 mRNA in the cytoplasm of HS cells shortly after transcription activation (Figure 3A, Figure 3—figure supplement 2, second panel from the left [30 min of HS]). Since eEF1A1 has been reported to be a component of mammalian nuclear export machinery (Khacho et al., 2008), we investigated whether it plays a role in HSP70 mRNA transport. To gain further insight in the cellular localization of HSP70 mRNA, we used FISH in the immortalized MEFs expressing eEF1A1 fused to Cherry and Flag (Figure 1—figure supplement 5A). Cells knocked down for eEF1A1 showed a stronger FISH signal in the nucleus than non-transfected cells, where most of the HSP70 mRNA was localized in the cytoplasm (Figure 5A, Figure 5—figure supplement 1A,B). Therefore, we quantified the effect of eEF1A1 in the partitioning of HSP70 mRNA between nucleus and cytosol after heat shock using RT-QPCR. After 2 hr of heat shock more than 95% of the total HSP70 mRNA has been exported to the cytoplasm of mock-transfected cells. In contrast, cells knocked down for eEF1A1 have accumulated ∼30% of the total synthesized HSP70 mRNA in the nucleus (Figure 5B). We did not find any significant difference for GAPDH mRNA accumulation in the nucleus (∼15% in mock transfected cells vs ∼12% in cells knocked down for eEF1A1).
Figure 5.
eEF1A1 is required for HSP70 mRNA export from the nucleus.
(A) eEF1A1 mediates HSP70 mRNA export upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 120 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show cherry-eEF1A1 in red and nucleus in blue. Gray image shows HSP70 mRNA FISH. Bar = 10 microns. (B) HSP70 mRNA retention in the nucleus of eEF1A1-knocked down cells. The plot shows total (T) and nuclear (N) HSP70 mRNA in control (Si:NT) or eEF1A1-knocked down cells after heat shock. RNA from HeLa cells was RT with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. Total or nuclear HSP70 mRNA was normalized to that of total GAPDH. Data are represented as the mean ± SEM from three independent experiments. *p < 0.05. (C) Knock down of eEF1A1 suppresses binding of TPR1 to HSP70 mRNA. HSP70 mRNA was co-IPed with antibodies against eEF1A1 or TPR1 from heat-shocked HeLa cells knocked down of eEF1A1 or mock transfected. Total and IP RNA was RT with random primers and GAPDH and HSP70 mRNAs were quantified by QPCR. Total and IP HSP70 mRNA was normalized against total GAPDH mRNA. Data are represented as the mean ± SEM from three experiments. (D) MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At 120 min of HS, cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrowheads indicate areas with high density of HSP70 mRNA and brighter signal for cherry-eEF1A1. (E) eEF1A1 contributes to loading of HSP70 mRNA into polysomes. RNA collected from light and heavy polysome fractions was reverse-transcribed with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. Values relate to those obtained from total RNA (Input). Data are presented as the mean ± SEM from three independent experiments.
DOI:
http://dx.doi.org/10.7554/eLife.03164.019
(A and B) eEF1A1 mediates HSP70 mRNA export upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA (pair A for A and pair B for B). At 120 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show cherry-eEF1A1 in red and nucleus in blue. Gray image shows HSP70 mRNA FISH. Bar = 10 microns. Yellow arrowheads indicate areas with high density of HSP70 mRNA and brighter signal for cherry-eEF1A1. (C) Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells (60 min at 43°C) were IPed with eEF1A1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting with the indicated antibodies. (D) MDA-MB-231 cells were mock-transfected (Si:NT) or knocked-down eEF1A1 (Si:eEF1A1). 48 hr after transfection cells were heat-shocked at 43°C for 30 min and left for recovery at 37°C for 30 min. Cell lysates were laid on 10–55% sucrose gradients and sedimented for 2 hr at 30,000 rpm (43). This allows the separation of larger ribosome-associated mRNAs from translationally inactive sub-polysomal mRNAs. Gradients were collected in 750 μl fractions (the vertical lines in the figure indicate each fraction). Collection was done in an ISCO fraction collector while monitoring the absorbance at 254 nm (y axis). The positions of absorbance peaks corresponding to monosome (40S, 60S, and 80S), and polysomes 1 (2-, 3-, 4-ribosomes per mRNA molecule) and polysomes 2 (5-, 6-, 7-ribosomes per RNA molecule) are indicated. Cells knocked-down for eEF1A1 showed the same polysome profile as Si:NT cells.
DOI:
http://dx.doi.org/10.7554/eLife.03164.020
Figure 5—figure supplement 1.
eEF1A1 facilitates the export of HSP70 mRNA.
(A and B) eEF1A1 mediates HSP70 mRNA export upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA (pair A for A and pair B for B). At 120 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show cherry-eEF1A1 in red and nucleus in blue. Gray image shows HSP70 mRNA FISH. Bar = 10 microns. Yellow arrowheads indicate areas with high density of HSP70 mRNA and brighter signal for cherry-eEF1A1. (C) Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells (60 min at 43°C) were IPed with eEF1A1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting with the indicated antibodies. (D) MDA-MB-231 cells were mock-transfected (Si:NT) or knocked-down eEF1A1 (Si:eEF1A1). 48 hr after transfection cells were heat-shocked at 43°C for 30 min and left for recovery at 37°C for 30 min. Cell lysates were laid on 10–55% sucrose gradients and sedimented for 2 hr at 30,000 rpm (43). This allows the separation of larger ribosome-associated mRNAs from translationally inactive sub-polysomal mRNAs. Gradients were collected in 750 μl fractions (the vertical lines in the figure indicate each fraction). Collection was done in an ISCO fraction collector while monitoring the absorbance at 254 nm (y axis). The positions of absorbance peaks corresponding to monosome (40S, 60S, and 80S), and polysomes 1 (2-, 3-, 4-ribosomes per mRNA molecule) and polysomes 2 (5-, 6-, 7-ribosomes per RNA molecule) are indicated. Cells knocked-down for eEF1A1 showed the same polysome profile as Si:NT cells.
DOI:
http://dx.doi.org/10.7554/eLife.03164.020
eEF1A1 is required for HSP70 mRNA export from the nucleus.
(A) eEF1A1 mediates HSP70 mRNA export upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 120 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show cherry-eEF1A1 in red and nucleus in blue. Gray image shows HSP70 mRNA FISH. Bar = 10 microns. (B) HSP70 mRNA retention in the nucleus of eEF1A1-knocked down cells. The plot shows total (T) and nuclear (N) HSP70 mRNA in control (Si:NT) or eEF1A1-knocked down cells after heat shock. RNA from HeLa cells was RT with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. Total or nuclear HSP70 mRNA was normalized to that of total GAPDH. Data are represented as the mean ± SEM from three independent experiments. *p < 0.05. (C) Knock down of eEF1A1 suppresses binding of TPR1 to HSP70 mRNA. HSP70 mRNA was co-IPed with antibodies against eEF1A1 or TPR1 from heat-shocked HeLa cells knocked down of eEF1A1 or mock transfected. Total and IP RNA was RT with random primers and GAPDH and HSP70 mRNAs were quantified by QPCR. Total and IPHSP70 mRNA was normalized against total GAPDH mRNA. Data are represented as the mean ± SEM from three experiments. (D) MEFs were infected with a lentivirus expressing Cherry-eEF1A1. At 120 min of HS, cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show HSP70 FISH in green and cherry-eEF1A1 in red. Yellow arrowheads indicate areas with high density of HSP70 mRNA and brighter signal for cherry-eEF1A1. (E) eEF1A1 contributes to loading of HSP70 mRNA into polysomes. RNA collected from light and heavy polysome fractions was reverse-transcribed with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. Values relate to those obtained from total RNA (Input). Data are presented as the mean ± SEM from three independent experiments.DOI:
http://dx.doi.org/10.7554/eLife.03164.019
eEF1A1 facilitates the export of HSP70 mRNA.
(A and B) eEF1A1 mediates HSP70 mRNA export upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA (pair A for A and pair B for B). At 120 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Merged images show cherry-eEF1A1 in red and nucleus in blue. Gray image shows HSP70 mRNA FISH. Bar = 10 microns. Yellow arrowheads indicate areas with high density of HSP70 mRNA and brighter signal for cherry-eEF1A1. (C) Extracts from unstressed (C) or heat-shocked (HS) MDA-MB231 cells (60 min at 43°C) were IPed with eEF1A1 antibody or IgG. IP samples or total protein (Input) were subjected to SDS-PAGE and immunoblotting with the indicated antibodies. (D) MDA-MB-231 cells were mock-transfected (Si:NT) or knocked-down eEF1A1 (Si:eEF1A1). 48 hr after transfection cells were heat-shocked at 43°C for 30 min and left for recovery at 37°C for 30 min. Cell lysates were laid on 10–55% sucrose gradients and sedimented for 2 hr at 30,000 rpm (43). This allows the separation of larger ribosome-associated mRNAs from translationally inactive sub-polysomal mRNAs. Gradients were collected in 750 μl fractions (the vertical lines in the figure indicate each fraction). Collection was done in an ISCO fraction collector while monitoring the absorbance at 254 nm (y axis). The positions of absorbance peaks corresponding to monosome (40S, 60S, and 80S), and polysomes 1 (2-, 3-, 4-ribosomes per mRNA molecule) and polysomes 2 (5-, 6-, 7-ribosomes per RNA molecule) are indicated. Cells knocked-down for eEF1A1 showed the same polysome profile as Si:NT cells.DOI:
http://dx.doi.org/10.7554/eLife.03164.020TPR1 is a nuclear pore complex (NPC) factor essential for HSP70 mRNA export (Skaggs et al., 2007). We postulated that eEF1A1 mediated the stress-induced binding of the HSP70 mRNA 3′UTR to TPR1. RNA-IP followed by RT-QPCR showed that eEF1A1 depletion greatly diminished the percentage of HSP70 mRNA bound to TPR1 upon heat shock (Figure 5C). Furthermore, both proteins co-immunoprecipitate (Figure 5—figure supplement 1C) during heat shock. This suggests a role for eEF1A1 in docking HSP70 mRNA to TPR1 in the NPC.Once in the cytoplasm, HSP70 is selectively translated (Cuesta et al., 2000). We observed that the areas in the cytoplasm, both perinuclear and the leading edges, with higher density of HSP70 mRNAs corresponded to a brighter signal from cherry-eEF1A1 (Figure 5A,D, Figure 5—figure supplement 1A, [yellow arrows]). We did not observe such a high-density accumulation of HSP70 mRNAs in cells knocked down for eEF1A1 (Figure 5A,D
Figure 5—figure supplement 1A,B). This could be explained by the decreased amount of HSP70 mRNA, but also by a less efficient loading of HSP70 mRNA into polysomes. Upon heat shock, the polysome profile MDA-MB231 cells knocked down for eEF1A1 was similar to that from mock transfected cells but, we detected a smaller amount of HSP70 mRNA in the pooled fraction of light ribosomes in cells knocked down for eEF1A1 (Figure 5E, Figure 5—figure supplement 1C), suggesting that eEF1A1 helped the loading of HSP70 mRNA into polysomes.
Discussion
eEF1A1 coordinates the heat shock response
HSR is a tightly regulated and synchronized process that is essential for cell survival under stress. While many HSP mRNAs, such as HSP70, are present in only very low amounts in unchallenged cells, their synthesis, stability, and translation amplify dramatically upon stress (Theodorakis and Morimoto, 1987; Lindquist and Craig, 1988; Cuesta et al., 2000; Zhao et al., 2002). We observed that each of these steps gets impaired when eEF1A1 is partially depleted. It is the sum of the effects on HSP70 mRNA synthesis, stability, and transport that accounts for a ∼70% reduction of the HSP70 protein level and compromised thermotolerance in cells partially knocked down for eEF1A1. It is likely that the remaining eEF1A1 supports the residual HSP70 expression.We have monitored the mRNA expression of the HSP70 by single molecule FISH in cells expressing Cherry-eEF1A1 (Figures 3A, 5A,C, Figure 3—figure supplement 2). We have found that although the expression of HSP70 during heat shock is synchronized, not all the cells respond with the same intensity at the same time. Indeed, induction of HSP70 transcription within the TSs of the same cell is stochastic (Figure 3A, Figure 1—figure supplement 5B,C, Figure 3—figure supplement 2). Nonetheless, most cells switched from almost undetectable levels of HSP70 mRNA under non-stress conditions to a massive induction of transcription from 30 to 60 min of heat shock, when mRNA can also be detected in the cytoplasm. Although the stimulus persisted, transcription ends at 2 hr of heat-shock. At this time point the majority of HSP70 mRNA is located in the cytoplasm. Our results suggest that eEF1A1 tags HSP70 mRNA during its transcription to ensure its rapid and efficient translation in contrast to non-HSP mRNAs (Figure 6). This hypothesis is in agreement with recent publications showing that the fate of the messenger is predetermined from transcription (Harel-Sharvit et al., 2010; Bregman et al., 2011; Dahan et al., 2011; Trcek et al., 2011; Haimovich et al., 2013).
Figure 6.
eEF1A1 synchronizes the expression of HSP70 mRNA from transcription to translation.
The cartoon summarizes the results of this study, implicating eEF1A1 at each stage of HSPs induction. Prior to stress, eEF1A1 resides mostly in the cytoplasm where it is an essential component of the translation machinery (top left quadrant). Upon heat shock (bottom left quadrant), a fraction of eEF1A1 is detected in the HSP70 locus where it recruits HSF1 to an HSP70 promoter, thus activating transcription. eEF1A1 interacts with elongating RNAP II and binds the 3′UTR of HSP70 mRNA to stabilize the transcript and to export it to cytoplasm for efficient translation. By synchronizing all the major steps of HSP70 gene expression, eEF1A1 renders the process of HSR exceptionally robust and coordinated. In cells knocked down for eEF1A1 HSP70 remain at low levels even when cells are stressed (right hand quadrants).
DOI:
http://dx.doi.org/10.7554/eLife.03164.021
eEF1A1 synchronizes the expression of HSP70 mRNA from transcription to translation.
The cartoon summarizes the results of this study, implicating eEF1A1 at each stage of HSPs induction. Prior to stress, eEF1A1 resides mostly in the cytoplasm where it is an essential component of the translation machinery (top left quadrant). Upon heat shock (bottom left quadrant), a fraction of eEF1A1 is detected in the HSP70 locus where it recruits HSF1 to an HSP70 promoter, thus activating transcription. eEF1A1 interacts with elongating RNAP II and binds the 3′UTR of HSP70 mRNA to stabilize the transcript and to export it to cytoplasm for efficient translation. By synchronizing all the major steps of HSP70 gene expression, eEF1A1 renders the process of HSR exceptionally robust and coordinated. In cells knocked down for eEF1A1HSP70 remain at low levels even when cells are stressed (right hand quadrants).DOI:
http://dx.doi.org/10.7554/eLife.03164.021eEF1A1 delivers aminoacylated tRNAs to the A site of ribosome during translation elongation (Li et al., 2013). We found that upon HS, when translation elongation is paused to protect cellular homeostasis (Slobin, 1980; Morimoto et al., 1997), eEF1A1accumulates in discrete dots in the nucleus that correspond to HSP70 TS (Figure 3A, Figure 3—figure supplement 2). eEF1A1 participates in the regulation of transcription by recruiting and activating HSF1 (Figure 2A,B). Formation of the HSF1-eEF1A1-DNA complex in vitro and in vivo requires an RNA component (Figure 2—figure supplement 1B), which is thought to function as a thermosensor (Shamovsky et al., 2006). eEF1A1 also interacts with the hyperphosphorylated form of RNAPII upon heat shock (Figure 3E), suggesting that it travels with RNAPII during elongation of HSP mRNA (Figure 3D, Figure 3—figure supplement 4). Although it is possible that binding of eEF1A1 to HSP70 mRNA can be independent of transcription elongation, the association of eEF1A1 with RNAPII (Figure 3E) may facilitate relocation of eEF1A1 from the promoter to the 3′UTR of HSP mRNA (Figure 3D, Figure 3—figure supplement 4D) and thus may be crucial for the stability and transport of HSP mRNAs (Figures 4 and 5).The stability of HSP70 mRNA sharply increases upon stress via a highly conserved mechanism involving cis-acting AU rich elements (ARE) in the 3′UTR (Theodorakis and Morimoto, 1987; Zhao et al., 2002). Heat shock inhibits ARE-facilitated mRNA decay by stabilizing HSP70-AUF1 (ARE/poly(U)-binding/degradation factor 1) and PABP1 binding to the 3′UTR (Laroia et al., 1999; Wang and Kiledjian, 2000). Also, PKR (double-stranded RNA-dependent protein kinase) plays a significant role in stabilizing HSP70 mRNA upon stress (Zhao et al., 2002). eEF1A1 binds directly to the 3′UTR of HSP70 mRNA during heat shock (Figure 4C, Figure 4—figure supplement 1B). Knock down of eEF1A1 results in selective destabilization of HSP70 mRNA (Figure 4D, figure 4—figure supplement 1B). The interaction of eEF1A1 with trans-acting factors, such as AUF1 and PABP1, as well as the phosphorylation and/or methylation status of eEF1A1 in response to different stimuli is likely to determine the stability of specific mRNAs and the interaction of eEF1A1 with HSP70 mRNA. It is also possible that PKR influences the stability of HSP70 mRNA (Zhao et al., 2002) via phosphorylation of eEF1A1 (Xue et al., 2008).Once HSP mRNAs have been properly processed they must be promptly exported from the nucleus to ribosomes in the cytoplasm. HSF1-mediated recruitment of the NPC protein TPR1 stimulates export of HSP70 mRNA from the nucleus (Skaggs et al., 2007). Inhibition of the HSF1–TPR1 interaction suppresses HSP70 mRNA export without decreasing mRNA stability (Skaggs et al., 2007). Since eEF1A1 interacts with TPR1 during heat shock (Figure 5—figure supplement 1C) and is required for TPR1 binding to HSP70 mRNA (Figure 5C) and export of HSP70 mRNA from the nucleus (Figure 5A,B), the transport mechanism appears to rely on eEF1A1-mediated activation of HSF1 and formation of the ternary complex of TPR1-HSF1-eEF1A1 with HSP mRNA.Decreased transport correlated with poor loading of HSP mRNAs into active ribosomes (Figure 5E, Figure 5—figure supplement 1D), whereas both, polysome profiles and general protein synthesis, were unaffected in cells knocked down for eEF1A1 (Figure 1A—figure supplement 1C), suggesting a selective effect of eEF1A1 on HSP70 translation. It is likely that eEF1A1 modulates the expression of many genes controlled by HSF1. Our results with HSP27 and other HSPs support this hypothesis (Figure 1—figure supplement 2C,D,F, Figure 5—figure supplement 1D).
Clinical implications
Deregulation of HSR is associated with numerous pathologies ranging from cancer to neurodegenerative conditions. A large effort has been made to develop pharmacological approaches to either inhibit or stimulate HSR to, respectively, kill rogue cells or protect normal cells (Calderwood et al., 2006; Demidenko et al., 2006; Galluzzi et al., 2009; Whitesell and Lindquist, 2009; Neef et al., 2011). The induction of HSP70 in transgenic mouse models of spinal bulbar muscular atrophy (SBMA) and amyotrophic lateral sclerosis (ALS) ameliorated disease symptoms and prolonged lifespan (Bruening et al., 1999; Adachi et al., 2003). The present findings illuminate eEF1A1 as a promising tool for the treatment of these diseases. eEF1A has two isoforms, 1 and 2, expressed from two different genes that are 96% similar at the protein level. In contrast to most other cell types, mature motor neurons express only eEF1A2 instead of eEF1A1 (Figure 1—figure supplement 3C; Newbery et al., 2007). Because eEF1A2 does not support HSR (Figure 1—figure supplement 3A,B), our results provide an explanation of why motor neurons do not induce HSPs upon stress, even though they express high levels of HSF1 (Batulan et al., 2003). Our findings also suggest a novel therapeutic strategy for these neurodegenerative diseases by enabling eEF1A1 expression in motor neurons.In summary, the isoform 1 of translation elongation factor eEF1A has been established as a key component of HSR that controls each stage of the HSP70 induction from transcription activation to mRNA stabilization, nuclear transport, and translation (Figure 6). This remarkable feature of eEF1A1 makes it an attractive target for the treatment of many pathological conditions associated with HSR deregulation.
Materials and methods
Cell culture, treatments, and transfections
293T, TIGs, MDA-MB231, and HeLa cells were obtained from ATCC (ATCC, Manassas, VA, USA); NSC34 cells were obtained from Cedarlane (Cederlane, Burlington, NC, USA). MEFs from the homozygous Actb-MBSmouse strain have been previously described (Lionnet et al., 2011). All cell lines were cultured in DMEM supplemented with 5% FBS and P/S at 37°C in an atmosphere of 5% CO2.To induce HSR, cells grown in tissue-culture flasks were submerged in a water bath at 42°C or 43°C (for cells of human or mouse origin respectively) for the indicated time intervals. Translation was inhibited by cycloheximide (CHX, 50 μg/ml) or doxycycline (DOX, 5 μg/ml) (Sigma, Saint Louis, MO, USA). Arsenite stress was induced with 0.1 mM arsenite (Sigma, Saint Louis, MO, USA). Transcription was inhibited with 5 μg/ml of actinomycin D (Sigma, Saint Louis, MO, USA) or 100 μM of DRB (Cayman, Ann Harbor, Michigan, USA).DsiRNA for eEF1A1 (NM_001402.5–Homo sapiens, NM_010106.2–Mus musculus), eEF1A2 (NM_001958.2–H. sapiens), and HSF1 (NM_005526.2–H. sapiens) were designed by IDT (IDT, Coralville, Iowa, USA) (http://www.idtdna.com/catalog/DicerSubstrate/Page1.aspx). Two DsiRNAs were selected for each gene: NM_001402.5 (1 and 10 [pair A] and 3 and 5 [pair B]) (Yan et al., 2008) NM_010106.2 (1 and 6 [pair A] and 3 and 5 [pair B]) NM_005526.2 (1 and 2) and NM_001958.2 (1 and 2). Inhibition of the desired gene was obtained 48 hr after the second co-transfection of each DsiRNA at a final concentration of 0.6 nM with the recommended amount of trifectin transfection reagent according to the manufacturer's instructions (or 10 nM of each siRNA transfected with SilenFect [Biorad, UK)]). Consecutive co-transfections were performed at 48 hr intervals in antibiotic free media. DS scrambled negative (IDT), which did not target any gene (Si:NT), was used as a negative control.Transfection of expression plasmids was performed with lipofectamine 2000 (Invitrogen Life Technologies, Van Allen Way, Carlsbad, CA, USA) according to the manufacturer's instructions.
Plasmid constructions
Renilla and firefly luciferase expression plasmid were pGL-3 control (Promega, Madison, WI, USA). SV40 promoter on Luciferase-pGL3 was substituted by HSP70 promoter fragment obtained after digestion of p1730R (Enzo Life Sciences, Farmigdale, NY, USA) with XhoI and HindIII. The HSP70 (HSPA1A) (NM_005345.2) 3′UTR sequence was obtained by PCR with specific primers (Supplementary file 1A), from total HeLa cell DNA, cloned in pJet 1.2/blunt (Fermentas Thermosicentific, Pittburg, PA, USA) and re-cloned with XbaI in pGL3-control.eEF1A1 cDNA was obtained by RT, followed by PCR with specific primers (Supplementary file 1A), from total HeLa cell RNA. eEF1A1 cDNA was cloned with BamHI and ClaI into pHAGE-Ubc-RIG lentiviral vector (a gift from Gustavo Mostolslavsky) to achieve the expression of eEF1A fused to cherry and Flag in its N terminus (phage-ubc-cherry-flag-eEF1A1).
Lentivirus production and cell sorting
30 μg of Phage-ubc-cherry-flag-eEF1A1 was transfected together with rev, gag/pol, tat and vsg plasmid using lipofectamine2000 (Life Technologies, Van Allen Way, Carlsbad, CA, USA) in 293T cells growing at 80% of confluence. Lentivirus were collected every 24 hr for 3 days after transfection, combined, and concentrated to 1 ml with lenti-X concentrator (Clontech, Mountain View, CA, USA). 2 × 106 MEFs or TIGs were infected with 300 ml of lentivirus and 4 days after infection cells were sorted for cherry expression in the flow cytometry core facility at the Albert Einstein College of Medicine.
In vitro transcription
In vitro transcription and labeling of the 5′UTR and 3′UTR of HSP70 (NM_005345.2) mRNA, and a 200nt region of the ORF of β-actin (NM_00,101.3) RNA was performed with [32P] CTP (MP Biomedicals, Santa Ana, CA, USA) and the MEGAscript T7 kit (Ambion, Grand Island, NY, USA) from PCR products (Supplementary file 1A). PCR was performed using cDNA templates previously cloned in the pJem1.2/blunt vector from CloneJet PCR Kit (Fermentas Thermosicentific, Pittburg, PA, USA). PCR conditions for Takara polymerase were 32 × (95:15″, 60:15″, and 72:45″). PCR products were purified with the minElute PCR purification kit (Qiagen, Valencia, CA, USA). The sequences of all cDNA products were verified by sequencing (Macrogen, New York, NY, USA) from the T7 promoter (pJem1.2, Fermentas Thermosicentific, Pittburg, PA, USA) and internal regions using specific primers.
RNA EMSA and EMSA
Specific RNA probes for EMSA were synthesized in vitro and radiolabeled as described above. eEF1A1 protein was purified as follows: 50 ml of the HeLa S-100 lysate was applied to a 80-ml Q Sepharose column whose outlet was connected to a 40-ml CM Sepharose column. Both columns were equilibrated with 7.5/0 buffer (50 mM Tris–HCl, pH 7.5, 0.5 mM EDTA, 2 mM DTT, 10% glycerol) at a flow rate of 1 ml/min. The column was washed with 7.5/0 buffer until most of the unbound protein appeared in the flow-through (as determined at A280). The Q Sepharose column was then disconnected, and the CM Sepharose column was developed with 10 column volumes of a 50–650 mM gradient of KCl in 7.5/0 buffer at a flow rate of 1 ml/min, while fractions of 4 ml were collected. Fractions containing eEF1A were identified by immunoblotting, pooled, dialyzed against buffer containing 50 mM Tris–HCl, pH 7.5, 100 mM KCl, 0.5 mM EDTA, 2 mM DTT, 10% glycerol, and concentrated with Millipore Centrifugal Filter units (3 kDa MWCO). The concentrated protein was flash-frozen in liquid nitrogen and stored at −80°C. RNA EMSA was accomplished according to the protocol described by Yan et al. (2008). Briefly, RNA probes were in vitro transcribed, end labeled, and gel purified. Indicated concentrations of purified eEF1A1 were incubated with 20 kcpm of HSPA1A 3′UTR RNA (∼0.1 pmol/µl) in the presence of 50 µM GTP for 30 min at room temperature.EMSA and RNAse treatments were performed as described previously (Shamovsky et al., 2006; Yan et al., 2008). For supershift experiments, 10 μg of cell extracts were incubated with 1 μg of the specific antibody (HSF1 and HSF2 [Enzo Life Sciences, Farmigdale, NY, USA], eEF1A [Millipore, Billerica, MA, USA], IgG [Abcam, Cambridge, MA, USA]) for 1 hr prior to incubation with radiolabel HSE.
RT, PCR, and QPCR
Total cell RNA was extracted with the RNAeasy mini kit (Qiagen, Valencia, CA, USA). 2 μg of RNA were treated with turbo DNAse (Ambion, Grand Island, NY, USA) and reverse transcribed with random primers or oligo dT using MLV-RT (Promega, Madison, WI, USA). 5 μl of a 1:15 dilution of cDNA were used for QPCR with specific primers (Supplementary file 1A) and Power SYBR GreenPCR master mix 2× (Applied Biosystems, Forest City, CA, USA) for 40 cycles in a 7300 real-time PCR system (Applied Biosystems, Forest City, CA, USA) according to the manufacturer's instructions. HSP70 Ct was normalized to GAPDH Ct for each condition and this value was related to the control value.Takara polymerase (TaKara, Moonachie, NJ, USA) was used for PCR following the instructions of the manufacturer.For ChIP experiments Real-time QPCR was performed in a Stratagene Mx3005p with Brilliant II SYBR Green kits (Stratagene, Netherlands) according to the manufacturer's instructions ans specific primers (Supplementary file 1A). Data were computed as described (Saint-Andre et al., 2011).
Polysome gradients and RNA extraction
Mock-transfected or eEF1A1 knocked down MDA-MB-231 cells were heat shocked for 45 min at 43°C and allowed to recover for 45 min at 37°C. At this time cells were treated with 100 μg/ml of cycloheximide for 15 min and collected for polysome purification using the protocol, centrifuge and ISCO fraction collector described by Ramirez-Valle et al. (2008) without modifications. Total RNA or RNA collected from polysome fractions was reverse transcribed and quantified as described above.
Metabolic labeling
Cells were labeled with 50 μCi of [35S]-methionine per ml (Easytag Express Protein Labeling Mix, Dupont/NEN) as described (Cuesta et al., 2000) for both control and heat-shock conditions.
Cell viability and death
Cell viability was measured by the MTT assay (Promega), and the OD was measured in an Infinite M200 96 well plate reader (Tecan) 24 hr after the second round of siRNA transfection. Cell death was quantified by flow cytometry (Becton Dickinson FACScalibur) after cells were stained with propidium iodide buffer (PI) (Life Technologies, Van Allen Way Carlsbad, CA, USA). Data were analyzed with Sumit software.
Immunoblotting
Cells were washed twice in 1× PBS, snap-frozen in liquid nitrogen and resuspended in RIPA buffer (50 mM Tris–HCl, pH 7.5, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, 150 mM NaCl, 1× protease inhibitor cocktail [Roche, Bransburg, NJ, USA] and 1× phosphostop [Roche, Bransburg, NJ, USA]) for 10 min at 4°C. 10 μg of protein were resolved on 4–12% SDSPAGE (Life Technologies, Van Allen Way Carlsbad, CA, USA) and transferred to a Nitrobound nitrocellulose membrane 0.45-μm pore size (Fisher). The membrane was blocked in 1× PBS-0.05% Tween 20 and 5% nonfat dry milk for 1 hr at room temperature and then incubated overnight at 4°C with specific antibodies (HSP70, HSF1, HSP27 (Enzo Life Sciences, Farmigdale, NY, USA), eEF1A1 (Millipore, Billerica, MA, USA), eEF1A2 (a gift from Jonathan Lee (Khacho et al., 2008) and GAPDH (Sigma, Sigma, Grand Island, NY, USA) and RNAPII (Santa Cruz, Dallas, Texas, USA)). After three washes in 1× PBS—0.05% Tween 20 membranes were incubated with horseradish peroxidase-conjugated goat-anti-mouse or goat-anti-rabbit antibody (GE-Healthcare, GE-Heathcare, Ho-Ho-Kus, NJ, USA), washed three times, and exposed to Kodak films using the ECL chemiluminescence system (GE-Heathcare, Ho-Ho-Kus, NJ, USA). Alternatively, IRD-ye and VRD-ye secondary antibodies were used before detection and quantification with the Odyssey infrared imaging system (LI-COR bioscience, Lincoln, Nebraska, USA).
Co-immunoprecipitation (co-IP)
Cells were lysed in nonidet lysis buffer (25 mM Hepes, pH 7.9, 100 mM NaCl, 5 mM EDTA, 0.5% nonidet P40, 1× complete [Roche, Bransburg, NJ, USA], and phosphatase inhibitors [Roche, Bransburg, NJ, USA]) for 1 hr at 4°C. Lysates were clarified of non-protein components by centrifugation for 5 min at 14,000×g and pre-cleared with 25 μl of Dynabeads protein G (Life Technologies, Van Allen Way Carlsbad, CA, USA) washed three times with B150 buffer (20 mM Tris, pH7.4, 1 mM EDTA, 10% glycerol, 150 mM NaCl and 0.1% Triton) for 1 hr at 4°C. 1 mg of pre-cleared protein was IP overnight at 4°C with 5 μg of anti-eEF1A1 (Millipore, Billerica, MA, USA) or normal rabbit or mouse IgG (Abcam, Cambridge, MA, USA) followed by a 1-hr incubation with 50 μl of Dynabeads protein G (Life Technologies, Van Allen Way Carlsbad, CA, USA). After five washes in B150, the proteins were resolved by SDS-PAGE and analyzed by immunoblotting.
RNA-IP, Chromatin-IP (ChIP), and Native RNA-ChIP
RNA-IP experiments were performed as described previously (Skaggs et al., 2007; Saint-Andre et al., 2011). For each RNA-IP 5 μg of specific antibody: eEF1A (Millipore, Billerica, MA, USA), TPR1 (Santa Cruz Dallas, Texas, USA), PABP (Abcam, Cambridge, MA, USA), or IgG (Abcam, Cambridge, MA, USA) was used. Samples were analyzed by RT-QPCR or RT-PCR with specific primers (Supplementary file 1A).ChIP analysis were performed as described by Saint-Andre et al. (2011) Antibodies were: rabbit or mouse IgG (Sigma, Grand Island, NY, USA), RNAPII (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Santa Cruz, Dallas, Texas, USA), RNAPII S2 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Abcam, Cambridge, MA, USA), eEF1A (4 μg of Antibody for 80 μg of relative amount of chromatin A260) (Designed in Nudler lab and produced in rabbits and purified by Prosci incorporated), HSF1 (2 μg of Antibody for 20 μg of relative amount of chromatin A260) (Enzo life sciences, Farmigdale, NY, USA), or Flag (2 μg of Antibody for 80 μg of relative amount of chromatin A260) (Sigma, Sigma, Grand Island, NY, USA). Pellets were resuspended in 40 μl of water and 1 μl analyzed by QPCR with specific primers (Supplementary file 1A). Percentage input for each data point was calculated by comparing the Ct value of sample to a standard curve generated from Ct of a 5-point serial dilution of input chromatin. Each immunoprecipitation was performed and assayed at least three times from independent samples.
Nuclear run on
Transcriptional run-on assays were performed as described in Banerji et al. (1984) using nuclei prepared from primary fibroblasts knocked down of eEF1A1 and heat shocked for 20 min at 43°C; radioactively α-32P-labeled RNA was prepared and hybridized to single-stranded oligos immobilized on nitrocellulose filters and visualized by PhosphorImager, quantitated by ImageJ.
RNA-FISH
We performed RNA FISH on cultured cells to a protocol modified from previously published protocols (Lionnet et al., 2011). A set of Stellaris FISH probes single-labeled (quasar 670) oligonucleotides were designed to selectively bind to humanHSPA1A or mouseHSPA1A (Supplementary file 1B) (Biosearch technologies, Petaluma, CA, USA) or MS2 (Lionnet et al., 2011).We grew MEFs on coverslips in DMEM 10% FBS 1% pen-strep, then fixed them in 4% paraformaldehyde for 15 min at room temperature before washing and storing in PBSM (PBS supplemented with 5 mM MgCl2) at 4°C. Before hybridization, we permeabilized the cells 10 min in 0.5% triton X-100 in PBS, then washed them in PBS 10 min and incubated 60 min at 37°C in prehybridization solution (20% formamide, 2× SSC, 2 mg ml−1 BSA, and 200 mM vanadyl ribonucleoside complex). We then hybridized the probes to the cells for 4 hr in hybridization solution (10% dextran sulfate, 2× SSC, 10% formamide, 2 mg ml−1 BSA, 0.2 mg/ml E. coli tRNA, 200 mM vanadyl ribonucleoside complex, and 2U of RNAsin) supplemented with 10 ng DNA probe (for MS2) or 1.25 mM (for human and mouseHSPA1A) per coverslip. We washed coverslips twice 20 min at 37°C with prehybridization solution, then 10 min at room temperature in 2× SSC, and 10 min at room temperature in PBSM. We counterstained DNA with DAPI (0.5 mg l−1 in PBS). After a final wash in PBS, we mounted coverslips mounted on slides using ProLong gold reagent (Life Technologies, Van Allen Way Carlsbad, CA, USA).
Image acquisition and analysis
Images were acquired on an Olympus BX61 epifluorescence microscope with PlanApo 60×, 1.4NA, and UPlanApo 100×, 1.35NA, oil-immersion objectives (Olympus). An X-Cite 120 PC (Lumen Dynamics, Canada) light source was used for illumination, with filter sets 31,000 (DAPI, CMAC), 41007a (Cy3) and 41,008 (Cy5) (Chroma Technology, Bellows Falls, VT, USA). We acquired data using 21 optical sections with a z-step size of 0.2 μm using a CoolSNAP HQ camera (Photometrics) with a 6.4 μm-pixel size CCD. MetaMorph (Molecular Devices) software was used for instrument control as well as image acquisition.We automatically quantified the position and intensity of transcription sites within the nucleus of MEFs using software described in detail in Lionnet et al. (2011). Briefly, the two-part algorithm begins by identifying the approximate position of transcription sites by applying a spatial bandpass filter to the image. The software identifies clustered pixels above a user-determined threshold as transcription sites. Then, the software fits a two-dimensional Gaussian, which approximates a point spread function, to determine the spatial position and intensity of each transcription site, after subtracting a local estimate of the fluorescent background. After the center position of TS spots in each channel were identified in 3-dimensional space, colocalization events were assigned when the distances between the closest spot of different colors were within two pixels.
Statistical analysis
Values were expressed as standard error mean (SEM). Statistical significance was assessed by paired t test or ANOVA test.eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.Thank you for choosing to send your work entitled “eEF1A1 couples HSP70 transcription to translation during heat shock response” for consideration at eLife. Your full submission has been evaluated by James Manley (Senior editor) and 2 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the decision was reached after discussions between the reviewers. As you will see in the reviews below, both reviewers raised a number of substantive issues that we feel precludes publication of the current version of your manuscript. Revisions for eLife papers are intended to be performed within 2-3 months and we believe that the amount of experimentation required to fully address the reviewers' comment will take more than that amount of time. However, eLife would be willing to consider a re-submitted manuscript that fully addresses the reviewers' comments.Reviewer #:In this manuscript Vera et al. report a new role for the translation elongation factor eEF1A in the heat shock response. They find that eEF1Aacts at multiple steps in expression of heat shock proteins. First, they show that eEF1A binds to heat shock genes, such as HSP70, and helps recruit the heat shock transcription factor HSF1 to the promoter. They further show that eEF1A is associated with RNA POL II and the 3' UTR of HSP70 mRNA, stabilizing and facilitating it for nuclear transport and ultimately to active ribosomes.The following issues should be addressed prior to publication.1) In RNAi experiments such as those performed in this manuscript, it is essential to show that similar results are obtained using two unrelated siRNAs (or shRNAs) against the same target gene to rule out off-target effects. Ideally, this should be done for all experiments in the manuscript, but minimally this needs to be done for the key experiments in the manuscript from which the main conclusions are drawn.2) Figure 1D. It would be nice to see the results minus and plus heat shock.3) Figure 2D. Have the authors performed these in vitro DNA binding experiments with purified HSF and eEF1A (Figure 2E uses only purified eEF1A).4) Figure 2F. Isn't the fold-increase following heat-shock expected to be larger? Is there a comparable experiment for HSF1?5) Figure 3C. Why isn't time zero shown?6) Figure 3D. Isn't this experiment better suited to Figure 1. Why does DRB cause decreased occupancy of RNA pol II and eEF1A at the promoter?7) Figure 4A. What does relative on the Y-axis mean?8) Figure 4A, B. Has HSF been tested in the RNA-IP assay.9) Figure 4C. It would be nice to see the eEF1A binding site in the 3' UTR further localized.10) Figure 4E. It is not clear why the promoter is needed here. Doesn't the in vitro RNA binding data of Figure 4C show that eEF1A can recognize and bind directly to the 3' UTR?11) For several of the panels (Figure 3D, 4A, 5E) statistics need to be provided.Reviewer #2:The manuscript by Vera et al claims the translation factor eEF1A participates at multiple steps in the human and mouse heat shock response (HSR): recruiting the HSF1 regulator to the promoter, associating with elongating Pol II and the 3'UTR of HSp70 mRNA, stabilizing the mRNA, and facilitating its export from the nucleus and to active ribosomes. These extraordinary claims, which in effect state that, “eEF1A orchestrates the entire heat shock response”, require extraordinary evidence. The authors provide a lot of experimental results in their effort to support all of these eEF1A1 functions. Some experiments are well-controlled and show reasonably convincing effects. Others are much less convincing.How can a single 50 kDa factor do all of this? I am concerned that other general mechanisms, which do not require a direct mechanistic role in each of these very specific steps, might account for the numerous effects seen. Could the depletion of such a super abundant protein (1-3% of total cytosolic proteins) lead to general pleiotropic effects that make general cellular mechanisms sluggish? eEF1A1 is also known to have chaperone function (see J. Biol. Chem. 2007, 282:4076), and its depletion might have a broad array of effects including those seen here. The previously documented role of eEF1A1 by this group as having a role in trimerization and activation of HSF1 could be consistent with such a chaperone role. These general concerns and the lack of a mapping of specific functions to distinct parts or mutations of the protein, lead me to the view that this grand view of eEF1A is too ambitious for a single paper and for the data in hand. This is already a bulky paper and it may be better suited being published as a couple of more focused papers in more specialized journals than eLife. However, publication either in eLife or elsewhere requires addressing these general concerns and specific concerns below:Specific concerns:1) The claim that translation is not affected by knockdown of eEF1A1 is not adequately supported by the data. The authors show that total translation is unaffected in cells where eEF1A1 was reduced to ∼35% of normal levels (Figure1–figure supplement 1A). The heat shock for this experiment was done at 40C instead of 43C. All the other experiments were done at full heat shock temperatures 43C or 45C. The 40C appears not to be a typo, because, under their 40C heat shock, there is not the change in protein patterns expected for a normal heat shock. A broad effect on general translation in full heat shock conditions caused by.eEF1A1 could lead to reduced HSPs.2) With no standard curve to show their Western assays are linear, it is inappropriate to ascribe the accuracy implied by a statement “knock down of eEF1A1 <38%” and in other numbers in Figures 1 and supplemental figures. It's not sufficient to normalize to a GAPDH band.3) Figure 1E needs more controls. Is the complete loss of the red eEF1A only in the cytoplasm due to a 65% knock down of this protein??4) Are there no error bars associated with the control in Figure 1–figure supplements 2 & 3? If there are bars in proportion to the measurement of eEF1A1, then are the differences as significant as the authors’ state?5) With eEF1A1 being so abundant, can many of the interactions observed with other proteins and RNAs in the cell be non-specific or low affinity (Figure 2C-F). Perhaps more quantification and use of other proteins as controls that are similarly abundant would help.6) In the binding of eEF1A1 to Hsp70 RNA, a single high concentration of protein is used. A binding curve and estimate of the Kd should be provided, if this is claimed to be an RNA binder.7) It was recently reported that inhibition of translation inactivates Hsf1 (Santagata et al. Science, 2013). If the translation is found to be compromised in eEF1A1 knockdown cells, then many observations reported in this manuscript can be explained by the possibility of unaccounted effect of eEF1A1 knockdown in inactivation of Hsf1 and hence, attenuation of Hsp70 and other heat shock proteins expression upon heat shock.8) Finally, is the proposed role of eEF1A1 in recruitment and activation of Hsf1 limited to major Heat Shock Protein genes or is it much broader and applicable for all Hsf1 regulated genes? Evidence exists for Hsf1 regulating expression of genes other than HSPs (Trinklein et al., 2004 & Mendilli et al., 2012) and I think it would be quite informative, if authors could include few of these genes and examine the role of eEF1A1 knockdown in their induction upon heat shock.[Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.]Thank you for resubmitting your work entitled “eEF1A1 couples HSP70 transcription to translation during heat shock response” for further consideration at eLife. Your revised article has been favorably evaluated by James Manley (Senior editor), a member of the Board of Reviewing Editors, and an outside expert. The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below.The authors have addressed or clarified many of the concerns of the reviewers. The remaining concerns need to be addressed, but they can probably be dealt with by textual revisions.1) The previous Impact Statement stated “eEF1A1 orchestrates the entire process of the heat shock response, from transcription activation of HSP70 gene, to HSP70 mRNA stabilization, nuclear export, and translation”. I apologize for abbreviating this to “eEF1A orchestrates the entire heat shock response”. The current Impact Statement now is “eEF1A1 orchestrates the process of heat shock response, from transcription activation of the HSP70 gene, to HSP70 mRNA stabilization, nuclear export, and translation”. The word “entire” is now deleted, which helps, but this is still an overstatement, especially considering the complexity of the heat shock response. First, the “process of the heat shock response” is too broad, as this study focuses on Hsp70. Second, the work “orchestrates” gives eEF1A1 a status of a major regulator like HSF1. While the paper provides data supporting an eEF1A1 contribution to the Hsp70 heat shock response at multiple stages, this factor has not acquired the regulatory support of an Hsf1, which has been demonstrated to have more than 10 times larger effects than those reported here on transcription (and protein production) of major heat shock genes.2) The incomplete binding curve of Figure 2E, which does not show saturation, is only able to provide an upper estimate of eEF1A1 affinity for Hsp70 promoter of >300nM. So eEF1A1 is a very weak binder relative to a typical sequence specific DNA binding factor, which would be useful to emphasize for the reader. I agree that there seems to be some specificity from various controls, and the new Figure 4,S1B helps.3) While the data support the conclusion that KD of eEF1A1 causes a ∼2-fold decrease in Hsp70 mRNA and a striking decrease in nuclear export, the case made for eEF1A1 having a role on loading Hsp70 mRNA on polysomes is considerably weaker (Figure 5E). The effect on Hsp70 mRNA in polysomes could be a consequence of lower cytoplasmic Hsp70 mRNA, and the difference between light and heavy is modest especially when considering error bars. Therefore, the authors should drop or tone down the conclusion that eEF1A1 affects Hsp70 translation.4) It's interesting that, with eEF1A1 affecting significantly so many processes in Hsp70 expression, the overall reduction in Hsp70 protein is only about 70% of the si:NT control (Figure 1,S2A). The authors should discuss this quantitatively and evaluate what this may mean about mechanisms governing this multistep pathway.[Editors’ note: the author responses to the first round of peer review follow.]Reviewer #1:[…] The following issues should be addressed prior to publication.1) In RNAi experiments such as those performed in this manuscript, it is essential to show that similar results are obtained using two unrelated siRNAs (or shRNAs) against the same target gene to rule out off-target effects. Ideally, this should be done for all experiments in the manuscript, but minimally this needs to be done for the key experiments in the manuscript from which the main conclusions are drawn.We added new data to the results of most of the reported experiments in which we used alternative siRNAs to target eEF1A1:A) The previous version of the manuscript included two other unrelated siRNAs to target mouseeEF1A1 in the western-blot quantifications (Figure 1–figure supplement 3A in the current version). These experiments were performed in parallel with the inhibition of eEF1A2, which were also performed with two unrelated siRNA (Figure 1–figure supplement 4B in the current version). The sequences of the siRNAs are indicated in the figure legend.B) To exclude the possibility of an off-target effect we knocked down eEF1A1 with an alternative pair of siRNAs (referred to in the manuscript as Pair B). We observed similar effects in the transcription of the HSP70 gene, the stability of the Hsp70 mRNA and the transport and levels of HSP70 protein as we reported with the original pair of siRNAs (Pair A). We added these results to Figure 1–figure supplement 2, Figure 1–figure supplement 5B and C, Figure 4–figure supplement 1B, and Figure 5–figure supplement 5B. We also cite the western-blots in Figure 1–figure supplement 2A in response to comment 2 from reviewer 2. These additional data support the main conclusions of the manuscript and exclude the possibility of an off-target effect.The sequences of the siRNAs are indicated in the materials section as Pair A and Pair B.2)
. It would be nice to see the results minus and plus heat shock.We added the results of the non-heat shock conditions to Figure 1D.3)
. Have the authors performed these in vitro DNA binding experiments with purified HSF and eEF1A (
uses only purified eEF1A).Yes. In the paper where we first described the eEF1A/HSF1 complex we reported this experiment (Shamovsky et al., Nature (2006); Figure 2c and f). The conclusion of that experiment was that eEF1A enhanced the in vitro binding of HSF1 to the heat shock element.4)
. Isn't the fold-increase following heat-shock expected to be larger? Is there a comparable experiment for HSF1?The comparable experiment for HSF1 is shown in Figure 2B. The fold increase of HSF1 is greater than that of eEF1A1. One possible explanation is that the occupancy of HSF1 on the HSP70 locus is restricted to the promoter at the HSE element. In the case of eEF1A, the fold-increase is observed throughout the HSP70 locus rather than at a restricted, discrete region (Figure 3D and Figure 3–figure supplement 4B). The restricted localization of HSF1 on HSE results in a higher fold increase in the ChIP experiments, whereas the more mobile eEF1A1 shows a lesser increase after heat shock.5)
. Why isn't time zero shown?We apologize for inadvertently omitting labeling the Y-axes in Figure 3C. It has been added. In this plot we show the % of HSP70 TSs with a positive signal for eEF1A1 at HS times at which we detect active HSP70 transcription. Transcription of HSP70 at time zero (control growth conditions) was shown in Figure 1–figure supplement 6B. As expected, HSP70 TSs was detected only in a small fraction of cells under non-HS conditions. We did not detect a positive signal for eEF1A in these few cells.6)
. Isn't this experiment better suited to
. Why does DRB cause decreased occupancy of RNA pol II and eEF1A at the promoter?Figure 3D shows the values for RNAPII phosphorylated on serine 2 (RNAPIIS2). As DRB inhibits the phosphorylation of serine 2, we observed a decrease of RNAPIIS2 over the HSP70 gene. At the promoter region, the values for RNAPIIS2 after HS-DRB treatment are similar to those of non-HS conditions. The values for total RNAPII were shown in Figure 3–figure supplement 4A. In this case, the values at the promoter after DRB-HS treatment are higher than those under non-HS conditions, indicating an accumulation of RNAPII at the HSP70 promoter. Most likely this result is due to the inability of RNAPII to elongate after DRB treatment. In the case of eEF1A, we observed a decreased occupancy within the HSP70 gene. As we indicated in the text, this result together with the fact that eEF1A1 co-IPs with hypophosphorylated RNAPII (Figure 3E), argues that eEF1A1 interacts with the elongation complex during HSP70 transcription.7)
. What does relative on the Y-axis mean?It means relative to total HSP70 mRNA, which we have now indicated.8)
. Has HSF been tested in the RNA-IP assay.HSF1 has been tested in the RNA-IP assay. A very low enrichment was observed for the HSP70 mRNA fraction bound to HSF1, which were most probably non-specific and the result of the treatment of the samples during the RNA-IP.9)
. It would be nice to see the eEF1A binding site in the 3' UTR further localized.It is known that eEF1A1 binds to a stem loop region in West Nile Virus genomic RNA (Blackwell et al., 1997). Therefore, we used an m-fold structure of the HSP70 3’UTR to make deletion constructs of various stem loop regions. We deleted parts of the three stem loops one by one. The deletion of SL2 abolished binding of eEF1A1 to the 3’UTRΔSL1ΔSL2 and we were able to bind eEF1A1. This new result is added to Figure 4–figure supplement 1B.10)
. It is not clear why the promoter is needed here. Doesn't the in vitro RNA binding data of
show that eEF1A can recognize and bind directly to the 3' UTR?We used the different promoters to demonstrate that eEF1A1 recruited to the HSP70 promoter migrates to and binds directly to the 3’UTR (Figure 4C). This binding is important for stabilizing HSP70 mRNA after heat shock. Using the foreign SV40 promoter eliminates both the promoter-specific recruitment of eEF1A1 and also the effect of eEF1A1 on luciferase expression, i.e. HSP70 mRNA stability.11) For several of the panels () statistics need to be provided.For Figure 3D the p values were presented in the text: “Interestingly, the eEF1A1 occupancy inside HSP70 locus was reduced (p=0.0585) as it was for total RNAPII (p=0.0316)”.For Figure 4A and 5E the values are not significant.Reviewer #2:The manuscript by Vera et al claims the translation factor eEF1A participates at multiple steps in the human and mouse heat shock response (HSR): recruiting the HSF1 regulator to the promoter, associating with elongating Pol II and the 3'UTR of HSp70 mRNA, stabilizing the mRNA, and facilitating its export from the nucleus and to active ribosomes. These extraordinary claims, which in effect state that, “eEF1A orchestrates the entire heat shock response”, require extraordinary evidence. The authors provide a lot of experimental results in their effort to support all of these eEF1A1 functions. Some experiments are well-controlled and show reasonably convincing effects. Others are much less convincing.In the current manuscript we focus on HSP70 (Title: eEF1A1 couples HSP70 transcription to translation during the heat shock response); we do not state anywhere that “eEF1A1 orchestrates the entire heat shock response” as quoted by the reviewer. In the Conclusion we state that eEF1A1 synchronizes the expression of HSP70 mRNA from transcription to translation, for which we believe we provide sufficient evidence in this manuscript.We modified one paragraph of the discussion to avoid a potential overstatement:“The influence of eEF1A1 on several heat shock inducible genes, including HSP27 supports the notion that it controls the expression of HSF1-dependent genes in general”.It now reads: “It is likely that eEF1A1 modulates the expression of many genes controlled by HSF1. Our results with HSP27 and other HSPs support this hypothesis (Figure 1–figure supplement 2C,D,F, Figure 1–table supplement 1)”.How can a single 50 kDa factor do all of this?We believe that the importance of this manuscript is precisely because it demonstrates that one protein can perform several functions in parallel, thereby explaining the synchrony and robustness of the HSP70 expression under heat shock in mammals. As we indicate in the Discussion (end of paragraph 1), only a few factors have been shown to determine the ultimate fate of mRNAs. They have been described only in yeast, are not related to HSR, and are also known to perform other cellular functions.I am concerned that other general mechanisms, which do not require a direct mechanistic role in each of these very specific steps, might account for the numerous effects seen. Could the depletion of such a super abundant protein (1-3% of total cytosolic proteins) lead to general pleiotropic effects that make general cellular mechanisms sluggish?eEF1A1 is indeed highly abundant. However, the nuclear fraction of eEF1A1, which is responsible for the effects we reported in the manuscript, is small. We show that depletion of eEF1A1 only affects heat shock genes (transcription activation, mRNA stability, and transport), and not other unrelated genes or processes. We also show that depletion of the second isoform of eEF1A (which is 95% identical to eEF1A1 and can clearly fulfill, by itself, the translational requirements of a cell as it is the only eEF1A isoform expressed in muscle cells and neurons) does not have any effect on HSR. This second isoform is highly expressed in various cancer cell lines, including HeLa and NSC34 - cells, which we used in the current study (Figure 1–figure supplement 3) to demonstrate that knock down of EF1A2, which has the same general properties as eEF1A1 with respect to translation, both in vitro and in vivo, does not alter the HSR.eEF1A1 is also known to have chaperone function (see J. Biol. Chem. 2007, 282:4076), and its depletion might have a broad array of effects including those seen here. The previously documented role of eEF1A1 by this group as having a role in trimerization and activation of HSF1 could be consistent with such a chaperone role.The chaperone function of eEF1A1 homologs has been reported in bacteria, yeast and for the mammalian mitochondrial translation elongation factor Tu (see J. Biol. Chem. 2007, 282:4076). We don’t believe this is damaging to our conclusions, and, indeed, we agree that eEF1A does function as a chaperone in promoting HSF1 trimerization, as proposed in our earlier report (Shamovsky et al., 2006). However, the additional functions of eEF1A1 that we currently describe with respect to HSR cannot be explained by the same chaperone activity.These general concerns and the lack of a mapping of specific functions to distinct parts or mutations of the protein, lead me to the view that this grand view of eEF1A is too ambitious for a single paper and for the data in hand. This is already a bulky paper and it may be better suited being published as a couple of more focused papers in more specialized journals than eLife. However, publication either in eLife or elsewhere requires addressing these general concerns and specific concerns below.Mapping specific functions to distinct regions of eEF1A is the next step in understanding the molecular mechanism of eEF1A1-mediated HSR. This work is currently underway and beyond the scope of the current manuscript, which is already “bulky”, as noted by the reviewer, and which elucidates how HSP70 expression is synchronized during heat shock by the multiple functions of eEF1A1. This primary work needs to be published before we subsequently address the biochemical details of eEF1A1 function.We hope that the above clarifications address the general concerns of this reviewer.Specific concerns:1) The claim that translation is not affected by knockdown of eEF1A1 is not adequately supported by the data. The authors show that total translation is unaffected in cells where eEF1A1 was reduced to ∼35% of normal levels (). The heat shock for this experiment was done at 40C instead of 43C. All the other experiments were done at full heat shock temperatures 43C or 45C. The 40C appears not to be a typo, because, under their 40C heat shock, there is not the change in protein patterns expected for a normal heat shock. A broad effect on general translation in full heat shock conditions caused by.eEF1A1 could lead to reduced HSPs.General translation is shutdown under full heat shock conditions, so the effect of eEF1A on general protein synthesis cannot be determined. Accordingly, we used 40°C to show that a mild heat-shock equally decreases general translation of mock-transfected cells and si:eEF1A1 transfected cells.2) With no standard curve to show their Western assays are linear, it is inappropriate to ascribe the accuracy implied by a statement “knock down of eEF1A1 <38%” and in other numbers in
and supplemental figures. It's not sufficient to normalize to a GAPDH band.In Figure 1A we referred to a representative western-blot and its quantifications. The reviewer is correct that the accuracy implied in the quoted statement cannot rely solely on those numbers. We therefore performed further quantification.All the western-blots presented were performed using chemiluminescence and X-ray films. Regardless of how accurate the film quantifications are, we always observe an obvious decrease in the levels of HSP70 protein in different cell lines from different species using different siRNAs to target eEF1A1 (see Figure 1A, Figure 1–figure supplement 2B, for representative blots prepared from different human cell lines:, quantification of 3 independent western blots with two unrelated si:eEF1A1).To address the reviewer’s concern in full, we added two new western blots using an alternative set of siRNAs against eEF1A1 (Pair B) to exclude potential off-target effect (Figure 1–figure supplement 2A). The quantitation was performed as follows:A) Li-COR Odyssey Imager for direct detection. With this fluorescent system western blot detection of HSP70 is reported to be quantitative across 4.3 orders of magnitude, from 5 pg to 100 ng (http://www.licor.com/bio/applications/quantitative_western_blots/quantification.html).B) We used two induction times for HSP70 protein expression (2 and 6 hours of recovery after 1 hour of heat shock) not to saturate the system.C) We included ponceau S staining of the membrane to demonstrate that our normalizations to GAPDHaccurately represents the total amount of proteins loaded in each condition.D) We quantified the two western blots, and in both cases we observed ∼70% reduction of HSP70 protein levels upon heat shock in cells knocked down of eEF1A1. In these cells levels of eEF1A were reduced to 25%. Concurrently, eEF1A1 mRNA levels were reduced to 20%, as quantified by RT-QPCR.The numerical values obtained by Li-COR are comparable to the values we previously presented. Therefore, we have substituted the numbers indicated in the main text by saying “to a third of the normal levels” or to ∼70 % as previously indicated.3)
needs more controls. Is the complete loss of the red eEF1A only in the cytoplasm due to a 65% knock down of this protein??The cells represented Figure 1E stably express Cherry-Flag-eEF1A1. The loss of the cherry signal in the cytoplasm was indeed due to the knock down of the eEF1A1. The loss of eEF1A1 occurs not only in the cytoplasm; it is also proportionately reduced in the nucleus. The exposure time determines the intensity of signal. The remaining cherry fluorescence, due to the remaining 35% eEF1A1, is less visible due to optimization of the exposure to capture the full expression of eEF1A1. The remaining Cherry-Flag-eEF1A1 fluorescence is more easily observed on a computer screen.Immofluorescence of cells expressing Cherry-flag-eEF1A1 growing at 37°C. Mock transfected cells (Si:NT and cells knocked down for eEF1A1 (si:eEF1A1) were immunostained with an antibody specific for eEF1A1 (Millipore, # 05-235) and a secondary antibody (Invitrogen, goat anti mouse (alexa 647)) (red). Nucleus was stained with dapi (blue).4) Are there no error bars associated with the control in
? If there are bars in proportion to the measurement of eEF1A1, then are the differences as significant as the authors’ state?To compare three biological replicates for each experiments all values were normalized to si:NT. NT values were defined as 1 and, therefore, have no error bars, but values for si:eEF1A samples do have error bars. The differences in values are statistically significant, as indicated.5) With eEF1A1 being so abundant, can many of the interactions observed with other proteins and RNAs in the cell be non-specific or low affinity (). Perhaps more quantification and use of other proteins as controls that are similarly abundant would help.As explained below, we believe there are enough controls to demonstrate that interactions of eEF1A1 with mRNA, DNA, and proteins are specific:For the interaction of eEF1A1 with mRNA: if the reported interactions depended on the relative abundance we should have detected a higher interaction of eEF1A1 with GAPDH mRNA than with HSP70 mRNA, because GAPDH mRNA is substantially more abundant. In our RNA IP experiment (Figure 4B) we detected only an eEF1A-HSP70 mRNA interaction. We included PABP, which is less abundant but interacts with both mRNAs, as a control in this same experiment. Finally, we have even identified a specific region within the 3’UTR of HSP70 mRNA that interacts with eEF1A1 (see new Figure 4–figure supplement 1B)For the interaction of eEF1A1 with DNA: we used GAPDH as a negative control. If the detection of eEF1A on the DNA were non-specific we should have observed the same enrichment for the GAPDH promoter and ORF as for the HSP70 gene. We also used Flag to ChIP the exogenous protein, which is less abundant than its endogenous counterpart (Figure 1–figure supplement 6) and we obtained similar results as with the endogenous protein (Figure 3D and Figure 3–figure supplement 4B; cells lacking Cherry-Flag-eEF1A1 were used as a negative control.For the interaction of eEF1A1 with other proteins: we provide data on interactions only with HSF1 and PolII. Endogenous controls are provided for both of the IPs. We detect eEF1A1-HSF1 and eEF1A1-PolII interactions only under heat shock conditions (Figure 2B and Figure 3E).If all these interactions were non-specific due the high cellular abundance of eEF1A1, we should also have detected them under non-HS conditions, which did not occur. In other words, the specificity of each interaction under HS conditions is supported by the corresponding non-interaction control under non-heat shock conditions.6) In the binding of eEF1A1 to Hsp70 RNA, a single high concentration of protein is used. A binding curve and estimate of the Kd should be provided, if this is claimed to be an RNA binder.This result is now shown in Figure 4–figure supplement 1C.7) It was recently reported that inhibition of translation inactivates Hsf1 (Santagata et al. Science, 2013). If the translation is found to be compromised in eEF1A1 knockdown cells, then many observations reported in this manuscript can be explained by the possibility of unaccounted effect of eEF1A1 knockdown in inactivation of Hsf1 and hence, attenuation of Hsp70 and other heat shock proteins expression upon heat shock.We do not find that translation is compromised in eEF1A1 knockdown cells (Figure 1–figure supplement 1). Although this observation alone should suffice in resolving the reviewer’s concern, we address it below in more detail:Santagata et al. show that there is a tight coordination of protein translation and HSF1activation that specifically supports the anabolic malignant state. To reach this conclusion they used a translation initiation inhibitor RHT. This drug has a strong effect in a panel of humancancer cell lines but much less of an effect in non-tumorigenic cells. In our experiments we used human and mouse fibroblast that are non-tumorigenic (TIGs and MEFs). We used the MDA-MB-231breast cancer cell line (not used by Santagata et al.) and obtained similar results as with non-tumorigenic cell lines. We used the MDA-MB-231 cell line because under non-heat shock condition these cells show very little expression of HSP70 mRNA.The experiments by Santagata et al. were performed under non-heat shock conditions, whereas most of our experiments were performed upon heat-shock. Without heat shock their tumorigenic cells continued to display a high level of HSP70 mRNA and efficient binding of HSF1 to the HSP70 promoter. This binding disappears when they add RHT. In contrast, we did not detect any strong HSF1 binding to the HSP70 promoter under control (non-HS) conditions. Moreover, this weak binding was not altered when we knocked down eEF1A1 (New Figure-2B). Interestingly, it is well established and demonstrated in the field that both translation initiation and elongation are already shut down during heat shock conditions when HSF1 shows its higher activity.The only cell line the two groups used in common is HeLa. We used HeLa because they express high levels of both eEF1A isoforms, eEF1A1 and eEF1A2. Although both isoforms share the same role in translation elongation, only when we knocked down eEF1A1 did we observe a decrease in HSP70 mRNA (Figure 1-figure supplement 3A and 3B). Therefore, the role of eEF1A1 during the heat shock response is independent of its role in translation.For all the reasons indicated above we believe that there is not an unaccounted effect of eEF1A1 knockdown in the inactivation of HSF1 under the conditions we used for the experiments presented in our current manuscript.8) Finally, is the proposed role of eEF1A1 in recruitment and activation of Hsf1 limited to major Heat Shock Protein genes or is it much broader and applicable for all Hsf1 regulated genes? Evidence exists for Hsf1 regulating expression of genes other than HSPs (Trinklein et al., 2004 & Mendilli et al., 2012) and I think it would be quite informative, if authors could include few of these genes and examine the role of eEF1A1 knockdown in their induction upon heat shock.This is an important question, which we will address in a future report. In the current manuscript we focus primarily on HSP70 in order to characterize each step in its induction pathway: transcription, mRNA stability, transport and translation. To determine whether every gene regulated by HSF1 is also subject to regulation by eEF1A1 is beyond the limits of any single manuscript. We have added an mRNA profiler in Figure 1–table supplement 1 and discussed the likely possibility of the role of eEF1A1 in regulating the expression of heat shock genes other than HSP70. Finally, to address the reviewer’s question in full, different cell lines (from non-tumorigenic to highly malignant) would need to be analyzed, because HSF1 drives a transcriptional program distinct from heat shock to specifically support highly malignant humancancers (Mendillo et al. 2012).[Editors’ note: the author responses to the re-review follow.]1) The previous Impact Statement stated “eEF1A1 orchestrates the entire process of the heat shock response, from transcription activation of HSP70 gene, to HSP70 mRNA stabilization, nuclear export, and translation”. I apologize for abbreviating this to “eEF1A orchestrates the entire heat shock response”. The current Impact statement now is “eEF1A1 orchestrates the process of heat shock response, from transcription activation of the HSP70 gene, to HSP70 mRNA stabilization, nuclear export, and translation”. The word “entire” is now deleted, which helps, but this is still an overstatement, especially considering the complexity of the heat shock response. First, the “process of the heat shock response” is too broad, as this study focuses on Hsp70. Second, the work “orchestrates” gives eEF1A1 a status of a major regulator like HSF1. While the paper provides data supporting an eEF1A1 contribution to the Hsp70 heat shock response at multiple stages, this factor has not acquired the regulatory support of an Hsf1, which has been demonstrated to have more than 10 times larger effects than those reported here on transcription (and protein production) of major heat shock genes.As requested, we changed the word “orchestrate” in the Impact Statement to less prominent “modulate”. It now reads: “eEF1A1 modulates the process of heat shock response, from transcription activation of the HSP70 gene, to HSP70 mRNA stabilization, nuclear export, and translation”.2) The incomplete binding curve of
, which does not show saturation, is only able to provide an upper estimate of eEF1A1 affinity for Hsp70 promoter of >300nM. So eEF1A1 is a very weak binder relative to a typical sequence specific DNA binding factor, which would be useful to emphasize for the reader. I agree that there seems to be some specificity from various controls, and the new
helps.As suggested we now emphasize a relatively weak DNA binding capability of eEF1A1: “Moreover, in vitro binding of recombinant eEF1A1 to a DNA fragment of HSP70 promoter suggests direct and specific, albeit a relatively weak, interaction of eEF1A1 to HSP70 promoter (Figure 2E). We further confirmed the presence of eEF1A1 at HSP70 locus by ChIP-QPCR… experiments ”3) While the data support the conclusion that KD of eEF1A1 causes a ∼2-fold decrease in Hsp70 mRNA and a striking decrease in nuclear export, the case made for eEF1A1 having a role on loading Hsp70 mRNA on polysomes is considerably weaker (). The effect on Hsp70 mRNA in polysomes could be a consequence of lower cytoplasmic Hsp70 mRNA, and the difference between light and heavy is modest especially when considering error bars. Therefore, the authors should drop or tone down the conclusion that eEF1A1 affects Hsp70 translation.As suggested, we toned down the conclusion regarding eEF1A1 affecting HSP70 translation by doing the following changes in the text:Abstract: “…facilitating its export from the nucleus to the active ribosomes” to “facilitating its nuclear export”.also: “…eEF1A1 facilitates HSP70 mRNA nuclear export and translation” to “..eEF1A1 facilitates HSP70 mRNA nuclear export”and: “… indicating that eEF1A1 helped the loading of HSP70 into polysomes” to “… suggesting that eEF1A1 helped the loading of HSP70 mRNA into polysomes.”4) It's interesting that, with eEF1A1 affecting significantly so many processes in Hsp70 expression, the overall reduction in Hsp70 protein is only about 70% of the si:NT control (). The authors should discuss this quantitatively and evaluate what this may mean about mechanisms governing this multistep pathway.As suggested, we now expand the Discussion to address this comment:“…We observed that each of these steps gets impaired when eEF1A1 is partially depleted. It is the sum of the effects on HSP70 mRNA synthesis, stability and transport that accounts for a ∼70% reduction of the HSP70 protein level and decreased thermotolerance in cells partially knocked down for eEF1A1. It is likely that the remaining eEF1A1 supports the residual HSP70 expression.”Clarification for the editor/reviewer: We would like to emphasize that 70% reduction of HSP70 is not a low value as implied by the reviewer’s term “only”: The western blot experiments were done from a pool of cells treated with eEF1A1siRNA. The efficiency of transfection by siRNAs and eEF1A1 inhibition was less than 75%. Thus, in any given experiment there are some cells responding to heat shock normally by producing HSP70 protein. This should account at least for some of the remaining HSP70 produced under the eEF1A1 depletion conditions. Moreover, a 70% reduction in HSP70 protein levels is biologically significant since there is a decrease in cell thermotolerance comparable with that of HSF1 depletion (Figure 1).
Authors: Sean R Carmody; Elizabeth J Tran; Luciano H Apponi; Anita H Corbett; Susan R Wente Journal: Mol Cell Biol Date: 2010-09-07 Impact factor: 4.272
Authors: Catherine M Abbott; Helen J Newbery; Charlotte E Squires; David Brownstein; Lowri A Griffiths; Dinesh C Soares Journal: Biochem Soc Trans Date: 2009-12 Impact factor: 5.407
Authors: Gemma L Carvill; Katherine L Helbig; Candace T Myers; Marcello Scala; Robert Huether; Sara Lewis; Tyler N Kruer; Brandon S Guida; Somayeh Bakhtiari; Joy Sebe; Sha Tang; Heather Stickney; Sehribani Ulusoy Oktay; Ashwin A Bhandiwad; Keri Ramsey; Vinodh Narayanan; Timothy Feyma; Luis O Rohena; Andrea Accogli; Mariasavina Severino; Georgina Hollingsworth; Deepak Gill; Christel Depienne; Caroline Nava; Lynette G Sadleir; Paul A Caruso; Angela E Lin; Floor E Jansen; Bobby Koeleman; Eva Brilstra; Marjolein H Willemsen; Tjitske Kleefstra; Joaquim Sa; Marie-Laure Mathieu; Laurine Perrin; Gaetan Lesca; Pasquale Striano; Giorgio Casari; Ingrid E Scheffer; David Raible; Evelyn Sattlegger; Valeria Capra; Sergio Padilla-Lopez; Heather C Mefford; Michael C Kruer Journal: Hum Mutat Date: 2020-04-06 Impact factor: 4.878
Authors: Nawsad Alam; Lior Zimmerman; Noah A Wolfson; Caleb G Joseph; Carol A Fierke; Ora Schueler-Furman Journal: Structure Date: 2016-03-01 Impact factor: 5.006