Literature DB >> 25225626

Microsatellite primers in Parietaria judaica (Urticaceae) to assess genetic diversity and structure in urban landscapes.

Angèle Bossu1, Valérie Bertaudière-Montès1, Vincent Dubut2, Stéphanie Manel3.   

Abstract

PREMISE OF THE STUDY: Urbanization is one of the main factors contributing to loss of genetic diversity, as the resulting landscape fragmentation and habitat loss induce species isolation. However, studies of genetic structure and diversity in urbanized landscapes are still rare. We characterized microsatellite primers for Parietaria judaica to study this environment. • METHODS AND
RESULTS: Eleven microsatellite loci from P. judaica, an urban plant, were isolated using shotgun pyrosequencing, and the simple sequence repeat (SSR) markers were screened in 20 individuals of P. judaica. The loci were tested on 166 individuals from three populations in different cities. The number of alleles ranged from two to 19, and expected and observed heterozygosity values ranged from 0.019 to 0.912 and 0.019 to 0.448, respectively. •
CONCLUSIONS: The markers amplified well in the species and will be useful for examining genetic diversity and population genetic structure in this urban plant.

Entities:  

Keywords:  Parietaria judaica; Urticaceae; microsatellites; urban area

Year:  2014        PMID: 25225626      PMCID: PMC4162664          DOI: 10.3732/apps.1400036

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Parietaria judaica L. is a perennial herb, with individual plants consisting of many shoots emerging from a common rootstock. The plant is a wind-pollinated species of the Urticaceae family that grows in urban Mediterranean areas (Fotiou et al., 2011) and is very common on urban walls. This wide occurrence will facilitate studies of genetic diversity and genetic structure in urban environments. While urbanization is one of the main factors contributing to loss of genetic biodiversity, genetic patterns in urban areas have been understudied (Manel and Holderegger, 2013). In the current study, we have developed and characterized 11 microsatellite markers for P. judaica that will be used for further studies to examine genetic diversity of plants in urban environments.

METHODS AND RESULTS

Twenty individuals of P. judaica were collected in Marseilles, France (43.296346°N, 5.369889°E; voucher specimen available at the Herbarium of Muséum d’Histoire Naturelle d’Aix-en-Provence [AIX], barcode number AIX036092). Samples were sent to Genoscreen (Lille, France) to develop and characterize microsatellites. Total genomic DNA was isolated from individuals’ leaf tissues using NucleoSpin Plant II (Macherey-Nagel, Duren, Germany). A total of 1 μg of DNA was used for the development of microsatellite libraries through 454 GS FLX Titanium pyrosequencing of enriched DNA libraries as described in Malausa et al. (2011). Total DNA was enriched for TG, TC, AAC, AAG, AGG, ACG, ACAT, and ACTC repeat motifs and subsequently amplified. PCR products were purified, quantified, and GS FLX libraries were then constructed following the manufacturer’s protocols (Roche Diagnostics, Meylan, France) and sequenced on a GS FLX PicoTiterPlate Kit (Roche Diagnostics). Sequences with a minimum of five repeats were selected. The bioinformatics program QDD version 1 with default parameters (Meglécz et al., 2010) was used to filter for redundancy, resulting in a final set of sequences from which it was possible to design primers. Finally, for a total of 43.9 Mbp read in the run, 10,895 sequences comprised microsatellite motifs with an average length of 304 bp. A total of 1114 primer sets were designed with QDD using BLAST, ClustalW, and Primer3 (Altschul et al., 1990; Larkin et al., 2007; Rozen and Skaletsky, 2000). A subgroup of 47 primer pairs was then tested for amplification. Primer sets were discarded if they failed to amplify or led to multiple fragments. Each primer pair was assessed in eight individuals of P. judaica. Microsatellite loci were amplified in 25-μL reactions containing 20 ng of template DNA, 1 unit of Taq polymerase (FastStart Taq DNA polymerase, Roche Diagnostics), 0.6 mM of dNTPs, 3.75 mM of MgCl2, and 0.1 μM of each forward and reverse primer. The amplification profiles included initial denaturation at 95°C for 10 min; followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min; followed by a final extension at 72°C for 10 min. For each PCR, a negative control was included. A total of 2 μL of PCR product was separated on 2% agarose gel. Primer pairs that amplified in at least five individuals were validated. Among 47 primer pairs tested, 26 pairs were validated on a subset of eight individuals from Marseilles, France. Polymorphism of 24 microsatellite loci was tested on the same subset of individuals that was used for amplification tests. PCR cycles and mixture were the same as those mentioned previously except that we used 10 pmol of each forward and reverse primer (instead of 1 pmol). One microliter of each PCR product was run in an ABI 3730xl DNA Analyzer (Applied Biosystems, Waltham, Massachusetts, USA). Results were analyzed with GeneMapper 4.0 (Applied Biosystems). Eleven markers were selected, and amplifications were tested for individuals sampled from three different cities: 85 individuals in Marseilles (43.296346°N, 5.369889°E), 29 individuals in Lauris (43.747778°N, 5.313611°E), and 52 individuals in Aix-en-Provence (43.531127°N, 5.454025°E). The characteristics of the 11 novel microsatellite loci in P. judaica are summarized in Table 1. We calculated the expected heterozygosity using an R package (adegenet version 1.3-9.2; Jombart and Ahmed, 2011). The number of alleles per locus ranged from two to 13 in Lauris, two to 15 in Aix-en-Provence, and three to 16 in Marseilles (Table 2). Expected heterozygosity ranged from 0.128 to 0.874, 0.019 to 0.882, and 0.240 to 0.912 in Lauris, Aix-en-Provence, and Marseilles, respectively. Observed heterozygosity ranged from 0.068 to 0.448, 0.019 to 0.231, and 0.059 to 0.423 in Lauris, Aix-en-Provence, and Marseilles, respectively. All loci showed significant linkage disequilibrium (except loci ParJ_31 in the Lauris population and ParJ_37 in the Lauris and Aix-en-Provence populations).
Table 1.

Characteristics of the microsatellite loci designed for Parietaria judaica.

LocusPrimer sequences (5′–3′)Ta (°C)Repeat motifFluorescent dyeAllele size (bp)GenBank accession no.
ParJ_20F: AGTTCAGTTGGGTTTGGCAG56(AG)11PET146KJ747956
R: TATGGGTGTGAGTGGCTACG56
ParJ_26F: CCTCCAATCGTTGAGAGGAA54(GAA)8PET157KJ747957
R: CCGCCATTGCTGTCTAGC56
ParJ_27F: TCCGATTATCCTCTTCGCAT53(TTC)126-FAM159KJ789106
R: GCAGAGAAATGAAAGAGAGTCG53
ParJ_31F: CTTCACGCCACGACTACAAC56(GTAT)5PET184KJ789103
R: TCAAAATCGAGATTGGCTCA52
ParJ_33F: AGCCGTTAAGGTCCCAAAGT57(TTC)18VIC190KJ872579
R: GGGACATGCGAAAGAAAAGA53
ParJ_34F: AACGGAATTCATTTCTCCGA52(TGA)10NED190KJ872580
R: TTGATTCTCCAAACACAACG51
ParJ_37aF: GAAGCCTCGTCGAACCAGT57(TC)96-FAM201
R: CGACACCTTCACCAACAAGA55
ParJ_42F: CGTATTTTGCGGGAAAGCTA53(CT)106-FAM235KJ789107
R: CCCATTCGTGAAGTTGGTAGA54
ParJ_43F: GTGGCTCTCGACTCGGAC58(CTT)14VIC240KJ789105
R: AACTCGAGAGCTTCATCGTTTC55
ParJ_44F: GACAGTGTTCCCTATTGAGCG56(CTT)11NED243KJ789108
R: TCGGGAGTTGGAACATATCA53
ParJ_45F: GTAGGAAAAGGGGTTTGTCG53(CT)10PET245KJ789104
R: TTTCTCTGATGTGGAAGCCC55

Note: Ta = annealing temperature.

No GenBank accession number is available for locus ParJ_37 because the region between the primer and the repeat region has too many undetermined nucleotides.

Table 2.

Polymorphism in 11 microsatellite loci developed for three populations of Parietaria judaica.

TotalLauris (N = 29)Aix-en-Provence (N = 52)Marseilles (N = 84)
LocusNAAHeHoAHeHoAHeHo
ParJ_20166850.610b0.34560.712b0.21270.636b0.294
ParJ_26166730.324b0.06940.627b0.17370.654b0.317
ParJ_27166740.509b0.31040.620b0.18070.636b0.321
ParJ_31166420.3280.20720.158b0.01940.628b0.282
ParJ_3316619130.874b0.448150.868b0.212160.912b0.423
ParJ_341661160.561b0.31060.592b0.17390.551b0.294
ParJ_37166320.1280.06820.0190.01930.315b0.072
ParJ_42166640.604b0.13840.580b0.13760.661b0.256
ParJ_431661990.815b0.345150.882b0.231150.695b0.289
ParJ_441661040.329b0.13870.633b0.15480.650b0.376
ParJ_45166430.558b0.17220.464b0.11540.240b0.059

Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; N = total number of samples analyzed.

Geographic coordinates of populations used in the study: Lauris (43.747778°N, 5.313611°E), Aix-en-Provence (43.531127°N, 5.454025°E), Marseilles (43.296346°N, 5.369889°E).

Markers deviating from Hardy–Weinberg equilibrium after Bonferroni correction (P < 0.004).

Characteristics of the microsatellite loci designed for Parietaria judaica. Note: Ta = annealing temperature. No GenBank accession number is available for locus ParJ_37 because the region between the primer and the repeat region has too many undetermined nucleotides. Polymorphism in 11 microsatellite loci developed for three populations of Parietaria judaica. Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; N = total number of samples analyzed. Geographic coordinates of populations used in the study: Lauris (43.747778°N, 5.313611°E), Aix-en-Provence (43.531127°N, 5.454025°E), Marseilles (43.296346°N, 5.369889°E). Markers deviating from Hardy–Weinberg equilibrium after Bonferroni correction (P < 0.004).

CONCLUSIONS

The molecular markers described here are the first microsatellite loci isolated for P. judaica. Most markers showed median levels of polymorphism, while ParJ_33 and ParJ_43 showed high levels of polymorphism. Most loci were at Hardy–Weinberg disequilibrium potentially due to genetic drift caused by landscape fragmentation. The set of microsatellite markers will be useful for studying population genetics of P. judaica in urban environments.
  8 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  Basic local alignment search tool.

Authors:  S F Altschul; W Gish; W Miller; E W Myers; D J Lipman
Journal:  J Mol Biol       Date:  1990-10-05       Impact factor: 5.469

Review 3.  Ten years of landscape genetics.

Authors:  Stéphanie Manel; Rolf Holderegger
Journal:  Trends Ecol Evol       Date:  2013-06-13       Impact factor: 17.712

4.  QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Authors:  Emese Meglécz; Caroline Costedoat; Vincent Dubut; André Gilles; Thibaut Malausa; Nicolas Pech; Jean-François Martin
Journal:  Bioinformatics       Date:  2009-12-10       Impact factor: 6.937

5.  Clustal W and Clustal X version 2.0.

Authors:  M A Larkin; G Blackshields; N P Brown; R Chenna; P A McGettigan; H McWilliam; F Valentin; I M Wallace; A Wilm; R Lopez; J D Thompson; T J Gibson; D G Higgins
Journal:  Bioinformatics       Date:  2007-09-10       Impact factor: 6.937

6.  High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries.

Authors:  Thibaut Malausa; André Gilles; Emese Meglécz; Hélène Blanquart; Stéphanie Duthoy; Caroline Costedoat; Vincent Dubut; Nicolas Pech; Philippe Castagnone-Sereno; Christophe Délye; Nicolas Feau; Pascal Frey; Philippe Gauthier; Thomas Guillemaud; Laurent Hazard; Valérie Le Corre; Brigitte Lung-Escarmant; Pierre-Jean G Malé; Stéphanie Ferreira; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2011-02-21       Impact factor: 7.090

7.  adegenet 1.3-1: new tools for the analysis of genome-wide SNP data.

Authors:  Thibaut Jombart; Ismaïl Ahmed
Journal:  Bioinformatics       Date:  2011-09-16       Impact factor: 6.937

8.  Parietaria judaica flowering phenology, pollen production, viability and atmospheric circulation, and expansive ability in the urban environment: impacts of environmental factors.

Authors:  Christina Fotiou; Athanasios Damialis; Nikolaos Krigas; John M Halley; Despoina Vokou
Journal:  Int J Biometeorol       Date:  2010-04-22       Impact factor: 3.787

  8 in total
  1 in total

1.  Microsatellite markers: what they mean and why they are so useful.

Authors:  Maria Lucia Carneiro Vieira; Luciane Santini; Augusto Lima Diniz; Carla de Freitas Munhoz
Journal:  Genet Mol Biol       Date:  2016-08-04       Impact factor: 1.771

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.