Literature DB >> 25202642

Characterization of microsatellite loci in lichen-forming fungi of Bryoria section Implexae (Parmeliaceae).

Olga Nadyeina1, Carolina Cornejo2, Carlos G Boluda3, Leena Myllys4, Víctor J Rico5, Ana Crespo5, Christoph Scheidegger2.   

Abstract

PREMISE OF THE STUDY: The locally rare, haploid, lichen-forming fungi Bryoria capillaris, B. fuscescens, and B. implexa are associated with boreal forests and belong to Bryoria sect. Implexae. Recent phylogenetic studies consider them to be conspecific. Microsatellite loci were developed to study population structure in Bryoria sect. Implexae and its response to ecosystem disturbances. • METHODS AND
RESULTS: We developed 18 polymorphic microsatellite markers using 454 pyrosequencing data assessed in 82 individuals. The number of alleles per locus ranged from two to 13 with an average of 4.6. Nei's unbiased gene diversity, averaged over loci, ranged from 0.38 to 0.52. The markers amplified with all three species, except for markers Bi05, Bi15, and Bi18. •
CONCLUSIONS: The new markers will allow the study of population subdivision, levels of gene introgression, and levels of clonal spread of Bryoria sect. Implexae. They will also facilitate an understanding of the effects of forest disturbance on genetic diversity of these lichen species.

Entities:  

Keywords:  Ascomycetes; Bryoria implexa; Trebouxia spp; lichen-forming fungi; microsatellites

Year:  2014        PMID: 25202642      PMCID: PMC4103479          DOI: 10.3732/apps.1400037

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


The members of Bryoria sect. Implexae are pendent, copiously branched lichens with circumboreal distribution (Brodo and Hawksworth, 1977; Myllys et al., 2011a). They are an important component of the boreal forests (Glavich et al., 2005), and their frequency depends on forest fragmentation (Hilmo and Holien, 2002). These lichen-forming fungi are haploid and disperse with vegetative propagules; sexual reproduction with ascospores is uncommon (Brodo and Hawksworth, 1977). Bryoria sect. Implexae includes seven morphologically and chemically recognized species in Europe (Myllys et al., 2011a), which have different frequency across longitudinal and altitudinal gradients (Hawksworth, 1972; Myllys et al., 2011a). Molecular data confirm the monophyly of the section, although the relationships among the currently recognized species remain poorly understood because phylogenetic analyses suggest that several species are conspecific (Myllys et al., 2011b). Highly variable microsatellite markers of the fungal partner of lichen symbioses (Widmer et al., 2010; Devkota et al., 2014) will be used to study the genetic diversity and differentiation in Bryoria sect. Implexae, to determine the gene flow across and within the currently recognized species, and to assess the impact of land use and habitat fragmentation on population structure of these locally rare and threatened, boreal forest–associated lichens.

METHODS AND RESULTS

Eighty-two specimens representing the three morphologically and chemically characterized species, Bryoria capillaris (Ach.) Brodo & D. Hawksw., B. fuscescens (Gyeln.) Brodo & D. Hawksw., and B. implexa (Hoffm.) Brodo & D. Hawksw., were collected in three regions (Spain, Switzerland, and Finland; Appendix 1). All specimens are deposited in the Lichens Herbarium of the Universidad Complutense de Madrid (MAF-Lich), and duplicates are stored at the Swiss Federal Research Institute WSL at −20°C. A subset of 30 specimens was used for total DNA extraction with the MoBio PowerPlant Pro DNA Isolation Kit (MO BIO Laboratories, Carlsbad, California, USA). The pooled DNA was used to create a shotgun multiplex identifier library using the GS FLX Titanium Rapid Library Preparation Kit (Roche Diagnostics, Basel, Switzerland), and Microsynth AG (Balgach, Switzerland) provided the barcode adapters. The library was sequenced on 1/4th of a plate on a Roche 454 Genome Sequencer FLX at Microsynth. We obtained 533,962 reads of an average length of 812 bp (National Center for Biotechnology Information [NCBI] Sequence Read Archive [SRA] accession no. SRR1283191; http://www.ncbi.nlm.nih.gov/sra). The unassembled sequences were screened for di-, tri-, tetra-, and pentanucleotide microsatellites using MSATCOMMANDER 1.0.2 alpha (Rozen and Skaletsky, 1999; Faircloth, 2008), ensuring a minimum repeat length of 8 bp for dinucleotides and 6 bp for all others.
Appendix 1.

Voucher information for species of Bryoria sect. Implexae used in this study.

SpeciesVoucher specimen accession no.aCollection locality and dateGeographic coordinatesNo. of individuals
B. capillaris18964–18967Spain, Prov. Segovia, 1854 m a.s.l., Pinus sylvestris forest, 6 Nov. 201240°47′35.0″N, 03°59′12.6″W4
B. capillaris18968–18993Switzerland, Canton of Berne, 1511 m a.s.l., Picea abies forest, 25 Nov. 201246°35′28.3″N, 07°20′26.9″E26
B. capillaris18997–18999Finland, Prov. Etelä-Häme, Liesjärvi, 110 m a.s.l., Picea abies forest, 17 Nov. 201260°40′17.0″N, 23°51′10.4″E3
B. capillaris18994–18996Finland, Prov. Etelä-Häme, 110 m a.s.l., Picea abies forest, 17 Nov. 201260°42′04.3″N, 23°54′41.9″E3
B. fuscescens19001–19014Spain, Prov. Madrid, 1490 m a.s.l., Pinus sylvestris forest, 6 Nov. 201240°46′05.4″N, 03°59′35.9″W14
B. fuscescens19015–19027Spain, Prov. Segovia, 1854 m a.s.l., Pinus sylvestris forest, 6 Nov. 201240°47′35.0″N, 03°59′12.6″W13
B. fuscescens19028–19034, 19036Switzerland, Canton of Berne, 1511 m a.s.l., Picea abies forest, 25 Nov. 201246°35′28.3″N, 07°20′26.9″E8
B. fuscescens19000, 19035Finland, Prov. Etelä-Häme, Liesjärvi, 110 m a.s.l., Picea abies forest, 17 Nov. 201260°40′17.0″N, 23°51′10.4″E2
B. implexa19037Switzerland, Canton of Berne, 1511 m a.s.l., Picea abies forest, 25 Nov. 201246°35′28.3″N, 07°20′26.9″E1
B. implexa19038–19042Finland, Prov. Etelä-Häme, 110 m a.s.l., Picea abies forest, 17 Nov. 201260°42′04.3″N, 23°54′41.9″E3
B. implexa19043–19045Finland, Prov. Etelä-Häme, Liesjärvi, 110 m a.s.l., Picea abies forest, 17 Nov. 201260°40′17.0″N, 23°51′10.4″E5

Vouchers deposited at Lichens Herbarium of the Universidad Complutense de Madrid (MAF-Lich).

MSATCOMMANDER recovered 6329 primer pairs that fulfilled the default primer parameters among all reads. Of those, 5932 pairs were discarded from further studies because they contained unfavorable secondary structure, primer-dimer formation, monorepeats in the flanking region, or because they were duplicates, which we detected after alignment using CLC Main Workbench 6 (CLC bio, Aarhus, Denmark). Putative sequences of algae, plants, animals, or microorganisms, which are often present in epiphytic samples, were identified and removed using the ntBLAST search on http://www.ncbi.nlm.gov. This inspection resulted in 58 primer pairs used for further analysis, i.e., to test for amplification with the symbiotic partner of these lichen-forming fungi. We used DNA from five axenic cultures of Trebouxia spp., which are hypothesized to be the photobionts of Bryoria sect. Implexae (Lindgren et al., 2014): T. angustilobata Beck (SAG2204), T. asymmetrica Friedl & Gärtner (SAG48.88), T. arboricola Puymaly (SAG219-1a), T. jamesii (Hildreth & Ahmadjian) Gärtner (SAG2103), and T. simplex Tschermak-Woess (SAG101.80). Forward primers were labeled with an M13 tag (5′-TGTAAAACGACGGCCAGT-3′) for PCR amplification (Schuelke, 2000). All PCR runs were performed on Veriti Thermal Cyclers (Life Technologies, Carlsbad, California, USA). The PCR reactions were evaluated in a temperature gradient with one-degree steps from 56–61°C, performed with the JumpStart REDTaq ReadyMix (Sigma-Aldrich, St. Louis, Missouri, USA) according to the manufacturer’s protocol, with the following conditions: denaturation for 2 min at 94°C, followed by 30 cycles of 30 s at 94°C, 45 s at 56–61°C, and 45 s at 72°C; then for the M13-tag binding additional eight cycles of 30 s at 94°C, 45 s at 53°C, and 45 s at 72°C, with a final extension of 30 min at 72°C. In total, 14 primer pairs produced positive PCR reactions with at least one of the five Trebouxia species, and were excluded from further analyses because they were considered alga-specific. The amplification of the fungal component of Bryoria sect. Implexae was tested with the 44 remaining loci under the same conditions as mentioned above. There were 14 loci that produced specific single products at an annealing temperature of 56°C, 12 at 57°C, six at 58°C, six at 60°C, and six at 61°C. Polymorphism of the 44 microsatellite loci was initially tested on a subset of 12 individuals (four individuals from each of three countries: Spain, Switzerland, and Finland), resulting in 18 polymorphic loci with satisfactory amplification. All PCR products obtained were multiplexed (Table 1). PCR reactions were performed in a total volume of 10 μL containing 1 μL of ∼5 ng genomic DNA, 1 μL each of forward and reverse primers of varying concentration (Table 1), and 5 μL of Type-it Multiplex PCR Master Mix (QIAGEN, Hilden, Germany). The PCR protocol used fluorescent forward primers and the reaction was adjusted to: 5 min at 95°C; followed by 30 cycles of 30 s at 95°C, 90 s at 56, 58, or 60°C (Table 1), and 30 s at 72°C; with a final extension of 60 min at 60°C. PCR products were run on a 3130xl DNA Analyzer with GeneScan 500 LIZ as the size standard for fragment analysis (both by Life Technologies).
Table 1.

Overview of the microsatellite loci developed for the group of lichen-forming fungi Bryoria sect. Implexae.

LocusPrimer sequences (5′–3′)Repeat motifMultiplexaTa (°C)Fluorescent dyePrimer conc. (μM)Allele size range (bp)GenBank accession no.
Bi01F: GGACGACGACATACCACTC(AACAGC)6156FAM0.3294–129KJ739845
R: GAGTTCGGGTTTAGGTCGTC
Bi02F: GCGTGAATGTGTCCGAATCG(AG)12156FAM0.80369–372KJ739846
R: GAATGGGCGCTCACTGTCTT
Bi03F: GTGAACTCGCTCGTATCGTC(AG)12156FAM0.80279–281KJ739847
R: CCTAGGGATGACACGCAGAA
Bi04F: CAGTGCGGCAAACAGTTAGT(TG)10156PET0.80320–325KJ739848
R: GCACAAATCCACCCACTCCT
Bi05F: CAAGGAGGTCGACTGTGAGT(AAGG)6156NED0.50127–143KJ739849
R: CAACCGATCCCACGCTCTC
Bi06F: GGGAGGGTGGAAGTTGGTTT(GTT)9156PET0.32114–168KJ739850
R: CGACCACTTCCACTTCCATATC
Bi07F: GAAATCGGCTTGTTGTCCTCC(CCTTT)6258PET0.80123–144KJ739851
R: GAACTACCGCCCACAAACAA
Bi08F: CATGCGGAGTTAAAGGAGGC(TC)8258NED0.32367–372KJ739852
R: CGCACCTATTTACGGCCTTT
Bi09F: CGTTCGTTCGTAGGTAGGTA(AT)8258PET1.10341–343KJ739853
R: GCCTACCCACCATCTGAACT
Bi10F: CTCGCGTTTCCCTGTTTCTT(TC)8258FAM0.90434–437KJ739854
R: GTATGAGGTCGGAGTGTGCT
Bi11F: GCACAAATCCACCCACTCCT(AC)12258FAM0.50314–318KJ739855
R: CAGTGCGGCAAACAGTTAGT
Bi12F: GCAGAAAGTGAGTTAGCCGG(TTG)12258FAM0.32100–124KJ739856
R: CTCAGCCTCAACCACAACGA
Bi13F: TCTTTCCTCTCCTGTCCACC(TTC)11360FAM0.9093–134KJ739857
R: CCTTACAGACCGGAGAAGCC
Bi14F: CTAACCACGACAAGCTGACC(TC)7360FAM0.60316–365KJ739858
R: GTACCGACGCAACTTACCTA
Bi15F: GTAGCAGGACATACGGAGGT(TC)9360PET3.00379–381KJ739859
R: CGTCCTAGCATCTCGGTTCT
Bi16F: CCAGGTCCTTCACTACAGCT(AG)8360FAM1.50405–437KJ739860
R: CGGTACAAGTCCAGTTGCAG
Bi18F: GCAGCTATCAGGAGTCACGT(TC)7360VIC0.60387–396KJ739861
R: GCAGCTATCAGGAGTCACGT
Bi19F: CCACCTCGAAGAGTACTGCT(TC)10360PET0.80346–352KJ739862
R: CTGAGCTATGTCCTCGCACA

Note: Ta = annealing temperature.

Multiplex indicates loci that were mixed in the same capillary electrophoresis run.

Overview of the microsatellite loci developed for the group of lichen-forming fungi Bryoria sect. Implexae. Note: Ta = annealing temperature. Multiplex indicates loci that were mixed in the same capillary electrophoresis run. The 18 polymorphic microsatellite markers were tested for locus variability and marker consistency on three populations (Table 2). Alleles were sized using GeneMapper 5.0 (Life Technologies). The linkage disequilibrium (LD) between microsatellite loci and their variability were measured by counting the number of alleles and calculating Nei’s unbiased gene diversity using Arlequin 3.11 (Excoffier et al., 2005). Dinucleotide microsatellites (n = 13) were the most common microsatellite motifs among the 18 loci (Table 1). The microsatellite loci revealed significant LD based on 999 permutations (P < 0.001). They show two to 13 alleles per locus with a mean of 4.6, and average gene diversities varied from 0.38 to 0.52 over three populations (Table 2).
Table 2.

Results of microsatellite screening in 82 individuals of lichen-forming fungi of Bryoria sect. Implexae between species of Bryoria sect. Implexae, and between compared regions.

TotalB. capillaris (n = 36)B. fuscescens (n = 37)B. implexa (n = 9)Spain (n = 31)Switzerland (n = 35)Finland (n = 16)
LocusnAHeAHeAHeAHeAHeAHeAHe
Bi018270.8260.7160.7940.5850.7360.7140.44
Bi026740.7430.6440.6820.4330.6840.6930.59
Bi038220.2420.3220.1520.2220.1220.3620.13
Bi048230.3630.4520.2820.3920.1230.5420.33
Bi057940.6130.5730.4720.2230.5240.6620.13
Bi0682100.83100.8850.6430.6430.5380.8540.64
Bi078230.4930.3720.1110.0020.2830.4620.13
Bi088240.5430.5230.4930.5620.4930.5430.57
Bi096020.5020.2520.2810.0020.4020.3120.33
Bi108220.4420.4420.0510.0020.2320.4920.13
Bi118230.3630.4520.2820.3920.1230.5420.33
Bi128270.6750.3960.4940.8130.3460.4850.82
Bi1382130.8490.8080.6860.9260.6790.8370.88
Bi148230.4730.4020.0510.0020.2330.4820.13
Bi155220.0410.0020.0510.0010.0020.1310.00
Bi168260.7660.5750.6130.7230.6160.6740.69
Bi188140.5640.3530.6230.6830.5940.2730.68
Bi198230.6530.1130.5330.7230.6030.4330.69
Mean4.580.5360.7160.7940.582.630.384.110.522.840.40

Note: A = number of alleles; He = Nei’s unbiased gene diversity; n = total number of samples analyzed.

Results of microsatellite screening in 82 individuals of lichen-forming fungi of Bryoria sect. Implexae between species of Bryoria sect. Implexae, and between compared regions. Note: A = number of alleles; He = Nei’s unbiased gene diversity; n = total number of samples analyzed. Cross-species amplifications within three congeneric species were analyzed with the chi-square test; B. capillaris was shown to not amplify consistently, while B. fuscescens and B. implexa amplified more regularly (Appendix 2). Most markers amplified with all three species. However, the microsatellite marker Bi15 only amplified with B. fuscescens, Bi05 with B. fuscescens and B. implexa, and Bi18 with B. capillaris and B. fuscescens.
Appendix 2.

Percentage of successful amplification between species of Bryoria sect. Implexae, and between compared regions.

GroupnpBi01Bi02Bi03Bi04Bi05Bi06Bi07Bi08Bi09Bi10Bi11Bi12Bi13Bi14Bi15Bi16Bi18Bi19
B. capillaris360.00810094100100921001001009710010010010010022100100100
B. fuscescens370.811006810010010010010010051100100100100100100100100100
B. implexa90.9910089100100100100100100671001001001001007810089100
Spain310.97100651001001001001001005210010010010010090100100100
Switzerland350.861009710010091100100100941001001001001004310097100
Finland160.39100811001001001001001006910010010010010056100100100
Total8210081–84100100971001001007210010010010010063–6710096–99100

Note: n = total number of samples analyzed; p = probability (according to chi-square test) that each group will equally amplify with all markers.

CONCLUSIONS

The fungus-specific markers developed here will facilitate studies on genetic diversity and differentiation in Bryoria sect. Implexae throughout its geographic distribution, and on effects of forest management on genetic diversity of populations in this species group. Furthermore, putative phylogenetic signal within the flanking regions of the microsatellite sequences might help to delimit closely related species and to assess the taxonomic value of the morphological and chemical characters of these regionally rare and threatened lichens.
  6 in total

1.  An economic method for the fluorescent labeling of PCR fragments.

Authors:  M Schuelke
Journal:  Nat Biotechnol       Date:  2000-02       Impact factor: 54.908

2.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

3.  msatcommander: detection of microsatellite repeat arrays and automated, locus-specific primer design.

Authors:  Brant C Faircloth
Journal:  Mol Ecol Resour       Date:  2008-01       Impact factor: 7.090

4.  Highly variable microsatellite markers for the fungal and algal symbionts of the lichen Lobaria pulmonaria and challenges in developing biont-specific molecular markers for fungal associations.

Authors:  Ivo Widmer; Francesco Dal Grande; Carolina Cornejo; Christoph Scheidegger
Journal:  Fungal Biol       Date:  2010-04-21

5.  Arlequin (version 3.0): an integrated software package for population genetics data analysis.

Authors:  Laurent Excoffier; Guillaume Laval; Stefan Schneider
Journal:  Evol Bioinform Online       Date:  2007-02-23       Impact factor: 1.625

6.  Characterization of microsatellite loci in the Himalayan lichen fungus Lobaria pindarensis (Lobariaceae).

Authors:  Shiva Devkota; Carolina Cornejo; Silke Werth; Ram Prasad Chaudhary; Christoph Scheidegger
Journal:  Appl Plant Sci       Date:  2014-04-05       Impact factor: 1.936

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.