cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications.

PREMISE OF THE STUDY: A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. • METHODS AND
RESULTS: For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. •
CONCLUSIONS: These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation.

The duckweed family encompasses 38 monocotyledonous species in four genera (Landolt, 1986; Les et al., 2002). Duckweeds had long been classified in their own family, the Lemnaceae, but are now considered to be members of the arum or aroid family (Araceae); the name Lemnaceae is therefore rapidly falling out of favor among taxonomists, who treat it as the subfamily Lemnoideae (Cabrera et al., 2008). Lemna minor L., which is known as common duckweed, is a small, free-floating, and fast-growing aquatic plant with a chromosome count of 40 (Blackburn, 1933). The species is distributed worldwide and often grows as blanket-like mats on the surface of still or slow-moving, nutrient-rich, fresh and brackish waters. Lemna minor represents a potential source of bioethanol (Xu et al., 2011) and can extract organic pollutants and toxic metals from waters, which makes it useful in remediation efforts (Alvarado et al., 2008; Wang et al., 2010). The species reproduces quickly through vegetative budding and doubles its biomass in two to seven days, depending upon culture conditions. Conditions affecting growth include the availability of nutrients and water temperature (Landolt, 1986; Brain and Solomon, 2007; Kanoun-Boulé et al., 2009). Notwithstanding its wide geographic range, L. minor displays a characteristically sporadic local distribution (Savile, 1956). In some parts of the world, such as the Kashmir Himalayas, this species has tended to become more invasive (Shah and Reshi, 2014).

Because of its widespread distribution, a monographic account of the Lemnaceae by Daubs (1965) puts L. minor in a “catch-all” category, as many herbarium specimens have been inadvertently labeled with this binomial but are actually other species. Development of appropriate molecular markers has therefore attained a special significance for correct taxonomic delineation of the species. Moreover, a lack of genetic markers impedes our understanding of the population biology and dynamics of L. minor. The development of such markers promises to yield important insights into the biology and biogeography of this species, with useful implications for understanding its invasiveness. Although Wang and Messing (2011) recently sequenced the chloroplast genomes from species in three different genera within the Lemnoideae (i.e., Spirodela polyrhiza (L.) Schleid., Wolffiella lingulata Hegelm., and Wolffia australiana (Benth.) Hartog & Plas) for systematic analysis, there are no studies so far on duckweed species using simple sequence repeat (SSR) or microsatellite markers. Thus, our objective was to develop cpDNA-based SSR markers for L. minor because such markers could provide a wealth of information for evolutionary and population genetic studies.

METHODS AND RESULTS

Individuals of L. minor were collected from five populations in the Kashmir Valley, India, and from three populations in Quebec, Canada, using a panel of five to seven individuals per population. The date and site of collection within each region, together with geographic coordinates of the sites, are given in Appendix 1; voucher specimens could not be collected due to lack of availability of suitable specimens. To develop SSR markers for L. minor, the chloroplast genome of L. minor was downloaded from the National Center for Biotechnology Information (NCBI) database. The PerlScript MIcroSAtelitte (MISA; http://pgrc.ipk-gatersleben.de/misa/) was used to identify microsatellites in the L. minor chloroplast genome. The SSR information that was generated by MISA was used for designing primers flanking the repeats. To design primers that flanked the microsatellite locus, two PerlScripts were used as interface modules for the program-to-program data interchange between MISA and the primer-designing software Primer3 (Rozen and Skaletsky, 2000). Primer pairs were designed from the flanking sequences of SSRs using primer3_core in batch mode via the p3_in.pl and p3_out.pl PerlScripts (Sonah et al., 2011). The primer-designing conditions were: 100–300 bp amplicon size, 60°C optimal annealing temperature, 20 bp optimal primer length, and 50% optimal GC content (Sonah et al., 2011). Three sets of primer pairs were designed for each SSR to provide alternatives if amplification was unsuccessful.

Appendix 1.

Region, site, and date of collection of Lemna minor in India and Canada together with geographical coordinates of the sites.

Region	Collection date	Collection site	Population code	Altitude (m)	Geographic coordinates
Kashmir, India	27 May 2012	Forshore	LK1	1596.2	34.08°N, 74.51°E
Kashmir, India	27 May 2012	Ashaibagh	LK2	1578.9	34.06°N, 74.50°E
Kashmir, India	28 May 2012	Rangharstop	LK4	1583.4	34.06°N, 74.48°E
Kashmir, India	29 May 2012	Kuhumus Wullar	LK5	1580	34.20°N, 74.36°E
Kashmir, India	6 Feb. 2012	Shalimar	LK7	1583.4	34.08°N, 74.52°E
Quebec, Canada	18 Sept. 2012	Lac St. Francais	LQ1	46	45.01°N, 74.45°W
Quebec, Canada	5 Oct. 2012	Riv-sud	LQ2	99.2	46.74°N, 71.24°W
Quebec, Canada	5 Oct. 2012	Université Laval	LQ3	98	46.47°N, 71.17°W

Genomic DNA was extracted by grinding 0.25 g of fresh leaf tissue in liquid nitrogen and by using a prewarmed cetyltrimethylammonium bromide (CTAB) extraction protocol (Doyle and Doyle, 1987). Thirty-three primer pairs were designed initially, synthesized, and tested on seven individuals from Kashmir and Quebec by running the PCR products in 1.5% agarose gel in 1× Tris-acetate/EDTA (TAE). PCR amplifications were carried out in total reaction volumes of 15 μL containing 50 ng of template DNA, 0.2 μM forward primer, 0.5 μM reverse primer, 1.5 mM dNTPs (Applied Biosystems/Life Technologies, Grand Island, New York, USA), 1× PCR buffer including MgCl2 (10 mM Tris [pH 8.0], 50 mM KCl, and 50 mM ammonium sulphate; Sigma Aldrich, St. Louis, Missouri, USA), 0.5 μM fluorochrome (Applied Biosystems/Life Technologies), and 1 unit of Taq DNA polymerase (Sigma Aldrich). The thermal cycling profile was 4 min at 94°C; followed by 35 cycles of 94°C for 1 min, 51°C annealing for 1 min, and 72°C for 1 min; followed by a final extension of 72°C for 10 min. The PCR products were separated by electrophoresis in 1.5% agarose gels in 1× Tris-borate/EDTA (TBE) buffer and visualized by ethidium bromide staining. To check for variability in L. minor, five to seven individuals from each of the different populations were amplified for each primer set. Amplicons were aligned using BioEdit Sequence Alignment Editor (Ibis Biosciences, Carlsbad, California, USA) to determine the possible identity of haplotypes, and fragments were measured using an ABI PRISM 3130xL Analyzer (Applied Biosystems, Carlsbad, California, USA) and scored using Peak Scanner version 1.0 software (Applied Biosystems).

DNA samples that were obtained from 26 individuals of five L. minor populations in Kashmir and from 17 individuals of three populations in Quebec were screened against 33 primer pairs. We found nine polymorphic loci (Table 1) and 24 monomorphic loci (Appendix S1), which allowed the identification of 11 haplotypes in Kashmir and one haplotype in Quebec (Table 2). Of these 11 haplotypes, one occurs in 56% of the genotypes, one in 8%, and nine in 4% each. The number of alleles and unbiased estimates of haploid diversity are shown in Table 3. One intraspecific diagnostic locus (L16*) showed discriminating alleles between Kashmir and Quebec, and could be useful to determine whether individuals introduced outside of the native range are from similar or different source populations in the native range.

Table 1.

Nine polymorphic microsatellite markers used for optimization on Lemna minor.

Locus	Primer sequences (5′–3′)	Repeat motif	Ta (°C)	Allele size range (bp)	GenBank accession no.
L6	F: CAGCAGCAATAACAGAAGCG	(A)10	51	297–301	Pr032067216
	R: TGTCTGTGATTGGGGATTGA
L7	F: CATTTTTCCCCACACTTGCT	(A)11	51	281–282	Pr032067217
	R: TGCATCCCAAACAATTTTCA
L14	F: TTGTTCTCATGATCGGTCAAA	(A)10	51	295–299	Pr032067209
	R: GCCTTACCATGGCGTTACTC
L16*	F: CGCATCAATCGAGGATACAC	(T)10…(A)15	51	216–220 Exp.: 224	Pr032067210
	R: TTCCGACAACTTCAGGAGAGA
L19	F: TGCTGGAAAAATAAGGTGGG	(A)10	51	282–288 Exp.: 289	Pr032067211
	R: CCTTTTGATTTGAGACCGGA
L20	F: TTAATCAGGACCCGAATCCA	(T)10	51	288–293	Pr032067212
	R: AAAGTCGACGGATTTTCCTC
L25	F: GGTTGCGCCATACATATCAA	(T)10	51	215–217	Pr032067213
	R: TGGTGACATAAGTCCCTCCC
L29	F: TCCAGGACTCCGAAAAGGTA	(A)10	51	257–270	Pr032067214
	R: CAATGGGGAATTGGCTTTATT
L35	F: CAAGAAGAACGGGTTGATCC	(T)10	51	204–205	Pr032067215
	R: GGATTCGAGCCATAGCACAT

Note: Exp. = expected size; Ta = annealing temperature.

Diagnostic marker; Quebec: allele size = 241; Kashmir: allele size = 237.

Table 2.

Haplotypes of cpSSRs at nine polymorphic loci of Lemna minor.

			Locus
Site	Plant no.	Haplotype	L6	L7	L14	L16	L19	L20	L25	L29	L35
Kashmir	LK1-226	HK1	317	301	319	237	308	313	237	290	225
Kashmir	LK1-228	HK1	317	301	319	237	308	313	237	290	225
Kashmir	LK1-229	HK1	—	301	—	—	—	313	237	277	225
Kashmir	LK1-231	HK1	317	301	—	—	308	—	237	277	225
Kashmir	LK1-239	HK1	317	—	—	237	—	—	—	—	225
Kashmir	LK2-251	HK2	317	301	315	237	302	308	NA	NA	NA
Kashmir	LK2-252	HK1	—	—	NA	NA	NA	NA	237	290	225
Kashmir	LK2-253	HK1	—	—	—	237	308	313	237	290	225
Kashmir	LK2-254	HK1	317	301	319	237	308	—	—	—	225
Kashmir	LK2-255	HK1	317	301	319	237	308	313	237	290	225
Kashmir	LK2-258	HK1	317	301	319	237	308	313	237	290	225
Kashmir	LK4-301	HK3	317	302	315	237	302	308	235	290	224
Kashmir	LK4-303	HK4	317	—	315	237	—	308	235	290	224
Kashmir	LK4-304	HK5	317	301	315	237	—	308	235	290	224
Kashmir	LK4-305	HK6	317	302	319	237	308	313	237	290	225
Kashmir	LK4-306	HK7	317	301	—	237	308	308	237	290	224
Kashmir	LK5-326	HK8	321	302	315	237	302	308	235	290	224
Kashmir	LK5-327	HK1	317	301	319	237	308	313	237	290	225
Kashmir	LK5-328	HK9	317	301	—	237	302	308	235	290	224
Kashmir	LK5-329	HK1	—	301	—	237	308	313	237	290	225
Kashmir	LK5-330	HK10	317	301	319	237	308	313	235	290	225
Kashmir	LK7-376	HK1	317	301	319	237	308	313	237	290	225
Kashmir	LK7-378	HK1	317	301	319	237	308	313	237	290	225
Kashmir	LK7-382	HK1	—	—	—	—	308	313	—	290	225
Kashmir	LK7-385	HK1	—	301	—	—	308	313	237	290	225
Kashmir	LK7-388	HQ1	—	301	—	—	—	313	237	290	225
Quebec	LQ1-07	HQ1	317	301	319	241	308	313	237	—	225
Quebec	LQ1-15	HQ1	317	301	319	NA	308	313	237	NA	225
Quebec	LQ1-23	HQ1	317	301	319	NA	308	313	237	NA	225
Quebec	LQ1-26	HQ1	317	301	319	241	308	313	237	290	225
Quebec	LQ1-30	HQ1	317	301	319	NA	308	313	237	NA	225
Quebec	LQ2-1-1	HQ1	317	301	319	241	308	313	237	NA	NA
Quebec	LQ2-1-3	HQ1	NA	NA	NA	NA	NA	NA	NA	290	225
Quebec	LQ2-1-4	HQ1	317	301	319	NA	308	313	237	NA	225
Quebec	LQ2-2-2	HQ1	317	301	319	NA	308	313	237	NA	225
Quebec	LQ2-2-4	HQ1	317	301	319	241	308	313	237	290	225
Quebec	LQ2-4-1	HQ1	317	301	319	NA	308	313	237	NA	225
Quebec	LQ3-2-2	HQ1	317	301	319	241	308	313	237	290	225
Quebec	LQ3-5-1	HQ1	—	301	319	241	308	313	NA	NA	NA
Quebec	LQ3-6-2	HQ1	NA	NA	NA	NA	NA	NA	237	290	225
Quebec	LQ3-7-2	HQ1	317	301	319	NA	308	313	237	NA	225
Quebec	LQ3-10-3	HQ1	317	301	319	NA	308	313	237	NA	225
Quebec	LQ3-18-2	HQ1	317	301	319	241	308	313	237	290	225

Note: — = no peak; NA = not available.

Number of haplotypes in Kashmir = 10; number of haplotypes in Quebec = 1.

Table 3.

Chloroplast microsatellite genetic diversity values for nine polymorphic loci of Lemna minor.

	Kashmir (n = 26)		Quebec (n = 17)
Locus	A	hunb	A	hunb
L6	2	0.1053	1	0.0000
L7	2	0.2571	1	0.0000
L14	2	0.4762	1	0.0000
L16	1	0.0000	1	0.0000
L19	2	0.3368	1	0.0000
L20	2	0.4545	1	0.0000
L25	2	0.4156	1	0.0000
L29	2	0.1660	1	0.0000
L35	2	0.3800	1	0.0000
Mean	1.709	0.2879	1	0.0000

Note: A = number of alleles; hunb = unbiased haploid diversity; n = sample size.

CONCLUSIONS

For the first time, we have developed and characterized nine polymorphic and 24 monomorphic cpDNA microsatellite markers for L. minor. We expect these markers to be useful for population genetic studies and the reconstruction of introduction history, as well as to facilitate the understanding of other life history questions regarding Lemna and related species.

Click here for additional data file.