Novel microsatellite markers for the high-alpine Geum reptans (Rosaceae).

PREMISE OF THE STUDY: Geum reptans reproduces by outcrossing or by the formation of stolons. Sexual and clonal reproduction are not exclusive and occur mostly simultaneously. We developed novel microsatellite primers for this species, which will be used in a study about local adaptation, phenotypic plasticity, and random molecular divergence of alpine plants. • METHODS AND
RESULTS: Twelve microsatellite primer sets were developed for G. reptans, of which nine were polymorphic. Initially, the forward primers had an M13 tail, and the allelic signals of each locus were amplified using a single fluorescent-labeled M13 forward sequence. In the running phase, a multiplex PCR assay was developed using different fluorophore-labeled forward primers. Two to 11 alleles were found per locus, depending on the studied population. •
CONCLUSIONS: Identical multilocus genotypes (i.e., clonal offspring) were not found because individuals in our sampling were at least 4 m distant from each other. F ST-Q ST analysis will be applied to detect selection processes in populations of G. reptans across the Alps.

It is generally assumed that alpine plants are locally adapted due to strong selection in habitats characterized by severe climatic conditions and high environmental heterogeneity (Körner, 2003). However, this assumption has rarely been tested. Our research uses reciprocal transplantation experiments (RTE) and sibling analyses to estimate the degree of phenotypic plasticity vs. the degree of local adaptation in populations of several alpine plant species (Via, 1984; Kawecki and Ebert, 2004). Because each transplantation site of an RTE is also a common garden, phenotypic differentiation of plant functional traits can be compared to neutral genetic differentiation based on microsatellite data (i.e., FST–QST analysis). This allows the deduction of the strength and direction of past selection on the measured traits and, therefore, allows testing for local adaptation (Spitze, 1993; Scheepens et al., 2013).

One of our focal alpine plants is Geum reptans L. (Rosaceae, Rosidae). Geum reptans is a diploid, perennial rosette plant usually found in high-alpine scree fields and in glacier forelands. The plant uses sexual reproduction to produce viable seeds, and also expands through vegetative aboveground stolons (Fig. 1; Weppler et al., 2006). Selfing provides no viable seeds in G. reptans, probably due to gametophytic self-incompatibility as in other species of the Rosaceae (see Rusterholz et al., 1993). Cross-amplification of microsatellite primers developed for the lowland rosid G. urbanum L. has been reported in seeds of G. reptans (Arens et al., 2004); however, trans-species amplification was not successful in our laboratory despite our use of the PCR protocol described by Arens et al. (2004). Hence, we have developed new polymorphic microsatellite loci in G. reptans to analyze neutral genetic differentiation within our study populations.

Fig. 1.

Reproducing individual of Geum reptans in a glacier forefield. The stolons (red arrows) root at the end, eventually forming a new clonal plant next to its ‘mother.’ This reproductive mode with sexual flowers and vegetative, aboveground stolons is comparable to strawberries (e.g., Fragaria vesca L.).

METHODS AND RESULTS

We sampled three geographically distinct populations from the Swiss Alps (Davos: 46°44′47.46″N, 9°56′47.70″E; Furka: 46°33′24.28″N, 8°24′45.40″E; Zermatt: 45°59′16.69″N, 7°40′40.73″E). Tissue samples from young leaves of 20 randomly selected individuals were collected from each population in summer 2012. Sampled individuals were separated by at least 4 m to minimize the risk of resampling identical clones (Pluess and Stöcklin, 2004, p. 2014). Leaf material was stored in silica in the collection of the University of Basel, section of Population Biology of Plants. Microsatellite marker development was outsourced to Ecogenics GmbH (Zurich-Schlieren, Switzerland). The genome screening technique of Ecogenics has been described previously (Kesselring et al., 2013). The total of 26,603 reads had an average length of 178 bp, and 2222 of these reads contained a microsatellite insert with a tetra- or trinucleotide of at least six repeat units or a dinucleotide of at least 10 repeat units. Suitable primer design was possible in 309 reads.

To find allelic polymorphisms, a test sample of N = 15 individuals was used. For the screening of loci for polymorphism and PCR functionality, a PCR strategy (see details in Kesselring et al., 2013) that involved M13-tailing at the 5′-end of each forward primer was used (Schuelke, 2000). Finally, nine out of 12 loci provided sufficient allelic polymorphisms and robust PCR characteristics (Table 1). To facilitate subsequent genotyping, the PCR of the nine loci were combined in three multiplex assays using fluorophore labeling (Table 1). For each locus, a fraction of the forward primer was labeled with a fluorophore and complemented with nonlabeled forward primer and reverse primer to a concentration of 10 μM primer master mix (see Table 1, footnote 1). Subsequently, 20 individuals from each of the three populations (Davos, Furka, Zermatt) were tested (a total of N = 60 individuals, see Table 2). PCR was done in a final volume of 10 μL, and contained 1 μL PCR stock buffer (QIAGEN, Hilden, Germany) with 15 mM MgCl2 and 200 μM dNTPs, 0.3 μL primer master mix of each of the three loci, 0.5 unit HotStar Taq polymerase (QIAGEN), and 2–10 ng DNA. Cycling conditions were: denaturation at 95°C for 15 min, followed by start PCR at 94°C for 30 s, 56°C for 90 s, and 72°C for 60 s in 35 cycles. Final elongation was set to 72°C for 30 min. After PCR, samples were mixed with ECO500 size standard (provided by Ecogenics) and loaded on an ABI3730 sequencer (Applied Biosystems, Carlsbad, California, USA). This size marker is suitable for accurate sizing in the range of 50–500 bp. ECO500 was labeled with orange DY-630 dye (Dyomics GmbH, Jena, Germany) and comprised the following base pair fragments: 75, 102, 124, 148, 171, 207, 229, 260, 274, 311, 321, 349, 374, 395, 419, 455, 473, and 497 bp. Allelic assignment of the electropherograms was done with GeneMarker version 1.80 (SoftGenetics, State College, Pennsylvania, USA). Data were cross-checked for repeatability. Eight of the 60 individuals were retested, starting again with DNA extraction of the silica gel–dried leaves and microsatellite fingerprinting. Hence, 72 fingerprints (i.e., 8 samples · 9 loci) of the first run were opposed to 72 fingerprints of the repetition run. Just one pairwise comparison differed, which is an error rate of 1.4%. The error occurred due to inconsistent allelic assignment of an individual at locus 015615. Instead of being heterozygous, the individual was interpreted in the repetition run as homozygous. Two loci showed background noise (loci 015967 and 013998; Table 1), i.e., we interpreted the constant occurrence of an additional peak as a mismatch. Moreover, at locus 013998 an allele of 151 bp was found to occur at a frequency of 5%. This allele was binned with the common allele of 150 bp because of potential stuttering (see Table 1). The same was done with the 144-bp allele (frequency of 8%; binning with 143 bp) at locus 002235 (Table 1). The polished data set was written in GENEPOP format (Rousset, 2008). Three software packages were used: GENEPOP on the Web for general index calculations and tests on linkage disequilibrium (Rousset, 2008; http://genepop.curtin.edu.au/), MICRO-CHECKER (van Oosterhout et al., 2004) for tests on potential null alleles with a prior value of maximum allele length of 250 bp and a 95% confidence limit, and GenAlEx version 6.2 (Smouse et al., 2008; Beck et al., 2008) for finding identical multilocus clones.

Table 1.

Characteristics of the newly developed microsatellite markers for Geum reptans.

Locus1	GenBank accession no.	Primer sequence (5′–3′)	Repeat motif	Amplicon length (bp)	Comment
015967 (a)	KJ439055	F: ACGGGTCTCTCTTCACTTGG	(TG)13	125–145	Depending on genotype, mismatch signal between 122 and 126 bp.
		R: TGACCATACTCATTCGCCCC
011721 (a)	KJ439056	F: AAAACCCTAGCCTTCGTCGC	(TC)11	92–121
		R: ATGTTAAGTGCAGCGGTTCG
013998 (a)	KJ439057	F: GAGCCACACTGAAAGCCATC	(AC)11	125–150	Depending on genotype, mismatch signal between 124 and 125 bp. The 151-bp allele was binned with the common allele of 150 bp.
		R: GCCACTCTCAGTATCTTCCTCC
002235 (b)	KJ439058	F: TCCGGTCCACCAAAGGATAG	(CT)12	143–171	The 144-bp allele was binned with the common allele of 143 bp.
		R: CTTGCCTTTTCCATGGGCTC
003651 (b)	KJ439059	F: CCACCTACAGTACGGACGAC	(GA)12	125–221
		R: ACCCCAATTCATTCGACACG
011534 (b)	KJ439060	F: CGCCCAAAATCAATCCATCAC	(AG)14	95–189
		R: GTACACCTTTGCTCCCCCTC
015615 (c)	KJ439061	F: TTTTGGATTGGACTACATAGACAG	(CA)12	137–160
		R: CAGTACCTGGAATCTGGGGG
013198 (c)	KJ439062	F: TGTGATCGATTAACTGCTGACG	(AG)11	131–182
		R: CACTCCCTCCAGCTCAGTTC
007389 (c)	KJ439063	F: AGTAGACCGGCCTTGATTCC	(TC)12	120–142
		R: ACCACAAAAGTAATGAAGCTTTTCG
072382	KJ439064	F: ACAAAAATGGCGAGAGCATC	(TGA)7	180–186	Only 8 of the 15 test individuals gave readable amplicons; three alleles with 180 bp, 183 bp, and 186 bp were found.
		R: CTTTGGTACGGCCCATTTCG
147692	KJ439065	F: TGTGTGTGTTTTGCCCTAGC	(TC)11	94	monomorph; 1 allele with 94 bp
		R: AAAGTACCCCATCCCAGCTC
262382	KJ439066	F: CGTCGCTCTCTCTATCTACCC	(CCG)7	80	monomorph; 1 allele with 80 bp
		R: GAGAGTGAGGTTTTCCGGC

Three multiplex PCR assays (a, b, c) were performed. The following fluorescent dyes were used: ATTO532 for the forward primer at locus 011721; ATTO565 for the forward primers at loci 013998, 011534, and 007389; FAM for the forward primers at loci 015967, 002235, and 015615; ATTO550 for the forward primers at loci 003651 and 013198. In the multiplex PCR assays, the ratio of fluorophore-labeled forward primer and unlabeled forward primer was between 0.11 and 0.52 (see text). For example, the primer master mix of locus 011721 contained 0.5 μL ATTO532-labeled forward primer, 4.5 μL unlabeled forward primer, 5 μL reverse primer, and 40 μL ddH2O, in a final concentration of 10 μM total forward primer and 10 μM total reverse primer. Of this master mix, 0.3 μL were pipetted into the PCR tube together with two other primer master mix solutions (see text).

Three of the tested loci were excluded. These loci were either monomorphic in the test sample of N = 15 individuals or could be amplified only in a subset of the 15 test individuals.

Table 2.

Results of initial primer screening of nine polymorphic microsatellite loci in three populations of Geum reptans (each with N = 20 individuals).

	Davos, Switzerland			Furka, Switzerland			Zermatt, Switzerland
Locus	A	Ho	He	A	Ho	He	A	Ho	He
015967	4	0.6	0.57	4	0.75	0.65	2	0.3	0.39
011721	6	0.45	0.66*	8	0.70	0.79	7	0.45	0.73*
013998	6	0.60	0.56	3	0.75	0.63	2	0.05	0.14
002235	5	0.50	0.71*	3	0.35	0.59*	3	0.10	0.19
003651	11	0.70	0.77	11	0.90	0.83	4	0.65	0.65
011534	8	0.70	0.76	8	0.80	0.86	9	0.85	0.83
015615	9	0.65	0.81	10	0.90	0.86	6	0.60	0.67
013198	9	0.75	0.81	9	0.85	0.85	10	0.90	0.82
007389	9	0.25	0.86*	5	0.15	0.77*	4	0.60	0.53

Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity.

Indicates potential null alleles (see text).

Two to 11 alleles were found per locus, depending on the studied population (Table 2). Observed (Ho) and expected heterozygosities (He) were in good agreement overall, indicating sexual outcrossing and random mating of alleles. However, three loci showed obvious deviation between Ho and He (Table 2). The presence of null alleles was suggested by MICRO-CHECKER for loci 002235, 007389, and 011721 in some populations (Table 2). The independent evolution of the microsatellite loci was tested with linkage analysis. There was no linkage disequilibrium among pairs of loci across all populations (all P > 0.09). In a further step, we searched for identical multilocus genotypes because of clonal reproduction by stolons. Six of the 60 individuals had to be excluded from the analysis because they had missing values at some loci (000-allele code in GENEPOP). We did not find identical multilocus genotypes in the 54 remaining individuals, although the establishment of clonal offspring by stolons of G. reptans is common and was estimated to range between 53% and 74% (Weppler et al., 2006).

CONCLUSIONS

The new microsatellite markers described here proved to be valuable tools to perform population and landscape genetics studies in the clonal plant G. reptans, for parental analysis or further investigations of its breeding system. Observed and expected heterozygosities were in good agreement, indicating random mating of alleles and sexual outcrossing; however, null alleles might occur at some loci. Given the absence of identical multilocus genotypes, we assume that our sampling design was successful in avoiding clonal individuals and indicate that clonal offspring of G. reptans establish only right next to their ‘mother’ plants. In the near future, we will examine microsatellite data of G. reptans to identify neutral genetic differentiation across the Alps. Contrasting molecular differentiation with differentiation in fitness-related phenotypic traits of reciprocally transplanted populations (FST–QST analysis) should allow detection of selection and local adaptation.