Literature DB >> 25202603

Ten polymorphic microsatellite primers in the tropical tree caimito, Chrysophyllum cainito (Sapotaceae).

Jennifer J Petersen1, Ingrid M Parker2, Daniel Potter1.   

Abstract

PREMISE OF THE STUDY: We developed microsatellite primers for the tropical tree Chrysophyllum cainito (Sapotaceae) to determine the native range of the species, investigate the origin of cultivated populations, and examine the partitioning of genetic diversity in wild and cultivated populations. • METHODS AND
RESULTS: We developed 10 polymorphic primers from C. cainito genomic DNA libraries enriched for di-, tri-, and tetranucleotide repeat motifs. The loci amplified were polymorphic in samples collected from Jamaica and Panama. The number of alleles per locus ranged from two to 10 and three to 12, while observed heterozygosities ranged from 0.074 to 0.704 and 0.407 to 0.852 in Jamaica and Panama, respectively. •
CONCLUSIONS: The microsatellite primers will be useful in future population genetic studies as well as those aimed at understanding the geographic origin(s) of wild and cultivated populations.

Entities:  

Keywords:  Chrysophyllum cainito; Sapotaceae; caimito; microsatellite; tropical tree domestication

Year:  2014        PMID: 25202603      PMCID: PMC4103607          DOI: 10.3732/apps.1300079

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Chrysophyllum cainito L. (Sapotaceae), commonly known as caimito or star apple, is a neotropical tree valued for its ornamental quality and for its edible fruits (Morton, 1987). The species is generally considered native to the Greater Antilles and naturalized in Central and South America (Pennington, 1990). Less commonly, the species is considered as native to Panama (e.g., Correa et al., 2004). In Panama, cultivated and wild C. cainito trees are found growing in close proximity and exhibit high levels of intraspecific variability for fruit traits such as fruit and seed size, sugar content, and levels of polyphenolics. These observed differences between cultivated and wild individuals suggest that the cultivated trees are semidomesticated (Parker et al., 2010). Hypotheses as to the geographic origin of the species have been recently tested with DNA sequence data. Those data showed that wild populations in Panama are more diverse than wild populations from the Greater Antilles, suggesting a southern Mesoamerican origin for the species (Petersen et al., 2012). Chrysophyllum cainito, as a semidomesticated species, is an excellent system to study anthropogenic impacts on the distribution of a neotropical fruit tree. In species in the early stages of domestication, wild forms may coexist with cultivated forms that have experienced varying degrees of management and modification through artificial selection. This situation provides an opportunity to study anthropogenic impacts on genetic and phenotypic variation within a single species. We developed 10 polymorphic microsatellite markers to further test hypotheses regarding the geographic origin of the species and the source of cultivated populations, and to evaluate the levels of genetic diversity and population structure in wild and cultivated trees.

METHODS AND RESULTS

We extracted 100 ng/μL of genomic DNA of leaf tissue from a single individual of C. cainito (Montgomery Botanical Center accession number 78601*C) using a DNeasy Plant Tissue Kit (QIAGEN, Valencia, California, USA). The extracted DNA was sent to the Savannah River Ecology Laboratory (University of Georgia, Athens, Georgia, USA), and the DNA was enriched for di-, tri-, and tetranucleotide repeats using three sets of oligonucleotide probe mixes (Cc2: AG, AAC, AAG, AAT, ACT, ATC; Cc3: AAAC, AAAG, AATC, AATG, ACAG, ACCT; and Cc4: AAAT, AACT, AAGT, ACAT). The enrichment process followed Glenn and Schable (2005) and included an initial digestion with the restriction enzyme RsaI (New England Biolabs, Ipswich, Massachusetts, USA). Double-stranded SuperSNX linkers (Hamilton et al., 1999) were then ligated onto each end of the digested DNA fragments. The DNA was then denatured and hybridized to biotinylated microsatellite oligonucleotide probes and captured on magnetic beads. The nonhybridized DNA was washed away, and the hybridized DNA was eluted and amplified in a PCR using the SuperSNX forward primer. At the University of California, Davis, fragments of the three libraries of enriched DNA were cloned using TOPO-TA cloning kits (Invitrogen, Carlsbad, California, USA) (Glenn and Schable, 2005). Inserts from 91 clones were PCR-amplified using M13 forward and M13 reverse primers, and the PCR products were sequenced with those primers using ABI BigDye Terminator v3.1 Cycle Sequencing chemistry on an ABI 3730 Capillary Electrophoresis Genetic Analyzer (Applied Biosystems, Foster City, California, USA). Forward and reverse sequences were assembled and edited in Sequencher 3.1.1 (Gene Codes Corporation, Ann Arbor, Michigan, USA). Thirty-three of the 91 sequenced inserts contained a microsatellite motif with a minimum of 10 subunit repeats. We designed primers using the default program settings in Primer3 (Rozen and Skaletsky, 2000) for 22 assembled contigs (forward and reverse sequences) that were between 100 and 400 bp in length and had sufficient flanking regions (at least 20 bp) on either side of the microsatellite repeat. We tested the amplification and levels of polymorphism of products from 22 primer pairs using a panel of five individuals including the Montgomery Botanical Center accession (78601*C) and Fairchild Tropical Garden accession (981444A), as well as three individuals collected from Jamaica and Panama, which are indicated by asterisks in Appendix 1. The DNA of each individual was extracted from fresh or silica-dried leaf tissue using a DNeasy Plant Tissue Kit (QIAGEN). PCR reactions were performed in 25-μL reaction volumes containing 2.5 μL10× buffer, 1.9 μL MgCl2, 0.25 μL bovine serum albumin (BSA), 0.25 μL AmpliTaq (Applied Biosystems), 0.5 μL each of the forward and reverse primers (10 μM) and dNTPs (10 mM), 17.65 μL H2O, and 1 μL genomic DNA (20 ng/μL). PCR amplification was carried out on an Applied Biosystems 2720 thermal cycler using the following cycling parameters: a 94°C initial denaturing for 4 min followed by 35 cycles of 94°C for 30 s, 50–60°C for 30 s, and 72°C for 30 s, with a final extension of 72°C for 7 min. We ran out the PCR products on a 2% agarose gel stained with ethidium bromide and then visualized the products under UV light. For the 13 loci that produced reliable amplification, we excised the PCR products from the agarose gels and used QIAquick Gel Extraction Kits (QIAGEN) to purify amplified fragments. To confirm that the primers were amplifying the target microsatellite motif, the purified PCR products were sequenced directly in both directions using the amplification primers. In all cases, we confirmed that the primer pairs were amplifying the target microsatellite motif.
Appendix 1.

Voucher specimens used in this study. All specimens of Chrysophyllum cainito are deposited at the University of California, Davis, Center for Plant Diversity (DAV).

CountryCollection no.aCollection localityNLatitudeLongitude
JamaicaJP135Albert Town, Trelawny Parish118°17.340 N77°32.594 W
JP95*Cave Valley, St. Ann Parish218°12.869 N77°22.695 W
JP108Ipswich/Red Gate, St. Elizabeth Parish418°10.588 N77°49.963 W
JP101Johnson, St. James Parish218°15.708 N77°49.755 W
JP128Kinloss–Clark Town Road, Trelawny Parish218°24.157 N77°33.716 W
JP112Lacovia to Slipe, St. Elizabeth Parish118°04.377 N77°46.530 W
JP119Marshal’s Pen, Manchester Parish118°03.608 N77°31.822 W
JP124Mountainside, St. Elizabeth Parish417°59.415 N77°44.760 W
JP100Newton, St. Elizabeth Parish118°07.543 N77°44.879 W
JP98Scott’s Pass, Clarendon Parish218°00.588 N77°23.000 W
JP115Slipe, St. Elizabeth Parish318°03.533 N77°47.133 W
JP129Windsor Estate, Trelawny Parish218°22.125 N77°38.786 W
PanamaJP222*Arraijan-Burunga, Panama408°58.190 N79°40.286 W
JP152Balboa, Panama208°57.272 N79°33.344 W
JP178Camino de Cruces, Panama409°06.658 N79°41.512 W
JP165Chilibre, Panama409°11.107 N79°36.621 W
JP189Clayton, Panama209°00.441 N79°34.056 W
JP141Ella Purua, Panama309°07.810 N79°41.749 W
JP216Gamboa, Panama109°07.890 N79°42.690 W
JP157Madden, Panama209°06.906 N79°36.945 W
JP205Pipeline Road, Panama409°09.066 N79°43.946 W
JP194*San Antonio, Panama209°07.758 N79°41.733 W
JP201Venta de Cruces, Panama109°07.707 N79°41.081 W

Note: N = number of individuals sampled in a given locality.

First author collection numbers. Individuals that were used in the initial primer screen are indicated with an asterisk.

We fluorescently labeled forward primers for 13 loci using FAM, NED, and HEX and analyzed those PCR products on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). We separated and scored alleles using GeneMapper version 3.7 (Applied Biosystems) using GeneScan 400HD ROX as an internal size standard (Applied Biosystems). Ten primer pairs yielded polymorphic amplification products that we were able to score consistently (Table 1). We further tested these primers for ease of scoring and levels of polymorphism on a total of 54 individuals from C. cainito collected from 12 and 11 localities from Jamaica and Panama, respectively (Appendix 1). We performed conventional genetic analyses of the Jamaica and Panama collections in GenAlEx version 6.3 (Peakall and Smouse, 2006) and tested for the presence of null alleles using MICRO-CHECKER (van Oosterhout et al., 2004). The overall observed number of alleles per locus ranged from two to 10 (mean = 5.2) for the Jamaica samples and from three to 12 (mean = 7) for the Panama samples. The slight difference in the observed and mean number of alleles between the Jamaica and Panama samples may reflect higher genetic diversity of C. cainito in Panama compared to Jamaica. We would expect a higher number of alleles in the area of origin as well as in the center of domestication. Observed heterozygosities ranged from 0.074 to 0.704 and 0.407 to 0.852 for the Jamaica and Panama samples, respectively (Table 2). Significant departures from Hardy–Weinberg equilibrium (HWE) were observed at microsatellite loci CaiG4 and CaiC2 in the Jamaica samples and at locus CaiD9 in the Panama samples. MICRO-CHECKER reported that null alleles might be present at these same locus/sample locality combinations (Table 2). No locus was observed as having null alleles or significant deviations from HWE in both Jamaica and Panama.
Table 1.

Characteristics of 10 polymorphic microsatellite loci developed for Chrysophyllum cainito.

LocusPrimer sequences (5′–3′)Repeat motifAllele size (bp)Ta (°C)FluorophoreaGenBank accession no.
CaiC1F: GCGTAGAGTTTCGCCTATCG(GA)12(GT)1124950HEXKF688727
R: TGTAGGGGATTGGAGTCGAG
CaiC2F: CAGCCATCAACCAAAAGTCA(CT)15(CA)1721256HEXKF688728
R: GGAGGAAATTTGGAGGGAAT
CaiD8F: GGAAGGGAAAGATGGTGTGA(AG)1428350NEDKF688730
R: CCCGTGAGATACAGGGAAGA
CaiD9F: TCCATATTCCGTAAACCATGC(AG)1415650NEDKF688731
R: TGATGGCTATGCATTCTTTGTT
CaiE5F: TCCCAAACAAGCCAATTCTC(AG)1117460FAMKF688732
R: CCGCCTGAATTGAAGAAAAC
CaiE7F: CTCCACTTGGAAGGTGCTTG(CT)8(AC)815156FAMKF688729
R: TTACCAGATGCCTGGGAAAC
CaiF4F: ACAAGCAAACCAAGCCAAAC(AG)1415950FAMKF688726
R: TGCAACGTCAGAACAACCAT
CaiG4F: TAAATGGGGCTTTGTTGAGG(AG)2022350FAMKF688733
R: TCTGGAACACAATACAAACTTGAG
CaiG6F: TCTTGGGGGTCTTCTTGATG(AG)2021450FAMKF688734
R: TTGAATCCAGTTTACAAACCAA
CaiG7F: AGATGCCCATCTCGTGAGTC(AG)18(AAG)220150HEXKF688735
R: GGACACTTTGATTTCCCCAGT

Note: Ta = annealing temperature.

Fluorophore used to label the forward primer.

Table 2.

Locus-specific measures of genetic diversity for Chrysophyllum cainito, collected in Jamaica and Panama.

JamaicaPanama
LocusNAHoHeHWEaNAHoHeHWEa
CaiC12770.7040.7150.9662760.5190.5970.496
CaiC22750.5560.7350.029*2790.8150.7670.890
CaiD82760.2590.2690.2802770.7040.6390.846
CaiD92750.2590.2361.00025120.5600.8160.000*
CaiE52720.0740.0710.8422740.5190.4590.897
CaiE727100.6670.7510.5082780.8520.7820.058
CaiF42750.2590.2670.0612670.6920.6430.874
CaiG42630.3850.5780.035*2670.6920.6580.843
CaiG62740.5560.5620.7902730.4070.4110.941
CaiG72650.6150.5560.8312570.7200.7420.613

Note: A = number of observed alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; N = sample size.

P values for Hardy–Weinberg equilibrium tests; * indicates a significant departure from HWE (P > 0.05), and ‡ indicates possible null alleles detected by MICRO-CHECKER.

Characteristics of 10 polymorphic microsatellite loci developed for Chrysophyllum cainito. Note: Ta = annealing temperature. Fluorophore used to label the forward primer. Locus-specific measures of genetic diversity for Chrysophyllum cainito, collected in Jamaica and Panama. Note: A = number of observed alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; N = sample size. P values for Hardy–Weinberg equilibrium tests; * indicates a significant departure from HWE (P > 0.05), and ‡ indicates possible null alleles detected by MICRO-CHECKER.

CONCLUSIONS

These newly developed primers amplified highly polymorphic microsatellite loci in C. cainito individuals. Observed differences in genetic diversity between Jamaica and Panama, both of which have been reported to include the native range of the species, indicate that these highly polymorphic loci will be useful in establishing the origins and genetic differentiation of wild and cultivated C. cainito populations. In addition, the loci would be useful for studies that evaluate gene flow and the evolution of mating system in this semidomesticated neotropical fruit tree, as well as studies that include closely related congeneric Chrysophyllum species.
  6 in total

1.  Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites.

Authors:  M B Hamilton; E L Pincus; A Di Fiore; R C Fleischer
Journal:  Biotechniques       Date:  1999-09       Impact factor: 1.993

2.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

3.  Isolating microsatellite DNA loci.

Authors:  Travis C Glenn; Nancy A Schable
Journal:  Methods Enzymol       Date:  2005       Impact factor: 1.600

4.  Origins and close relatives of a semi-domesticated neotropical fruit tree: Chrysophyllum cainito (Sapotaceae).

Authors:  Jennifer J Petersen; Ingrid M Parker; Daniel Potter
Journal:  Am J Bot       Date:  2012-03       Impact factor: 3.844

5.  Domestication Syndrome in Caimito (Chrysophyllum cainito L.): Fruit and Seed Characteristics.

Authors:  Ingrid M Parker; Isis López; Jennifer J Petersen; Natalia Anaya; Luis Cubilla-Rios; Daniel Potter
Journal:  Econ Bot       Date:  2010-05-21       Impact factor: 1.731

6.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

  6 in total
  2 in total

1.  The complete chloroplast genome sequence of Chrysophyllum cainito, a semidomesticated species.

Authors:  Cheng Zheng; Zi-Yan Liu; Jin Liu
Journal:  Mitochondrial DNA B Resour       Date:  2020-05-27       Impact factor: 0.658

2.  Domestication of the neotropical tree Chrysophyllum cainito from a geographically limited yet genetically diverse gene pool in Panama.

Authors:  Jennifer J Petersen; Ingrid M Parker; Daniel Potter
Journal:  Ecol Evol       Date:  2014-01-28       Impact factor: 2.912

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.