Development and characterization of microsatellite markers for the medicinal plant Smilax brasiliensis (Smilacaceae) and related species.

PREMISE OF THE STUDY: A new set of microsatellite or simple sequence repeat (SSR) markers were developed for Smilax brasiliensis, which is popularly known as sarsaparilla and used in folk medicine as a tonic, antirheumatic, and antisyphilitic. Smilax brasiliensis is sold in Brazilian pharmacies, and its origin and effectiveness are not subject to quality control. • METHODS AND
RESULTS: Using a protocol for genomic library enrichment, primer pairs were developed for 26 microsatellite loci and validated in 17 accessions of S. brasiliensis. Thirteen loci were polymorphic and four were monomorphic. The primers successfully amplified alleles in the congeners S. campestris, S. cissoides, S. fluminensis, S. goyazana, S. polyantha, S. quinquenervia, S. rufescens, S. subsessiliflora, and S. syphilitica. •
CONCLUSIONS: The new SSR markers described herein are informative tools for genetic diversity and gene flow studies in S. brasiliensis and several congeners.

The Smilacaceae is grouped within the Monocotyledoneae of the Liliales and has only two genera: Smilax L., with 300 species, and Heterosmilax Kunth, with 15 species (Angiosperm Phylogeny Group III, 2009). The family is distributed worldwide and is composed mainly of herbaceous vines and shrubs, and rarely of subshrubs and dioecious species. In Brazil, Smilax comprises 31 species, 14 of which are exclusively Brazilian (Andreata, 1997). Smilax species, which are popularly known as sarsaparilla, are used in folk medicine as tonics, antirheumatics, and antisyphilitics and are sold in Brazilian pharmacies without any quality control over their origin and effectiveness (Andreata, 1997). The quality control of herbal drugs should be more stringent, and molecular markers may be useful tools for the identification of species sold in pharmacies. Thus, the aim of the current study was to isolate and characterize microsatellite markers to identify Smilax species.

METHODS AND RESULTS

Genomic DNA was extracted from fresh leaves of S. brasiliensis Spreng., S. campestris Griseb., S. cissoides Mart. ex Griseb., S. fluminensis Steud., S. goyazana A. DC., S. polyantha Griseb., S. quinquenervia Vell., S. rufescens Griseb., S. subsessiliflora Duhamel, and S. syphilitica Humb. & Bompl. ex Willd. using the cetyltrimethylammonium bromide (CTAB) protocol described by Doyle and Doyle (1990) with modifications. The plant samples were registered (Appendix 1) and added to the plant collection of the Herbarium of the Escola Superior de Agricultura “Luiz de Queiroz” (ESA) of the Universidade de São Paulo, Brazil, and the Herbarium “Coleção de Plantas Medicinais e Aromáticas” (CPMA) of the Universidade Estadual de Campinas, Brazil.

Appendix 1.

Species	Location (Geographical coordinates)	Voucher no.
S. brasiliensis	Minas Gerais/Campina Verde (19°32′55″S, 49°26′41.1″W)	ESA 107638
S. brasiliensis	São Paulo/Paulínia (22°45′40″S, 47°09′15″W)	CPMA 736
S. campestris	Rio Grande do Sul/Porto Alegre (30°04′07.5″S, 51°07′10.1″W)	ESA 107657
S. cissoides	Bahia/Feira de Santana (12°12′05.5″S, 38°58′07.0″W)	ESA 107659
S. fluminensis	São Paulo/Itirapina (22°13′22.6″S, 47°54′2.9″W)	ESA 107633
S. goyazana	Goiás/Alto Paraíso de Goiás(14°10′22.8″S, 47°49′31.7″W)	ESA 107645
S. polyantha	São Paulo/Pratânia (22°48′54.4″S, 48°44′35.8″W)	ESA 10764)
S. quinquenervia	São Paulo/Mogi-Guaçu (22°15′930″S, 47°08′804″W)	CPMA 2020
S. rufescens	São Paulo/Cananéia (25°03′58.7″S, 47°54′58.1″W)	ESA 107648
S. subsessiliflora	São Paulo/Ilha Bela (23°46′41″S, 45°21′29″W)	CPMA 1843
S. syphilitica	Espírito Santo/Itarana (19°53′29.3″S, 40°49′09.4″W)	ESA 107665

Note: CPMA = Herbarium “Coleção de Plantas Medicinais e Aromáticas,” Universidade Estadual de Campinas, Brazil; ESA = Herbarium of the Escola Superior de Agricultura “Luiz de Queiroz,” Universidade de São Paulo, Brazil.

A microsatellite-enriched library was obtained using protocols adapted from Billotte et al. (1999). Genomic DNA from one individual of S. brasiliensis (Campina Verde, Minas Gerais) was digested with AfaI (Invitrogen, Carlsbad, California, USA) and enriched in microsatellite fragments using (CT)8 and (GT)8 motifs. Microsatellite-enriched DNA fragments were ligated into pGEM-T Easy Vectors (Promega Corporation, Madison, Wisconsin, USA), which were used to transform Epicurian Coli XL1-Blue Escherichia coli competent cells (Promega Corporation). Positive clones were selected using the β-galactosidase gene and grown overnight with ampicillin. The sequencing reactions (10 μL) contained 200 ng of plasmid DNA, 0.5 pmol SP6 primer, 0.4 μL of BigDye Terminator mix (version 3.1; Applied Biosystems, Foster City, California, USA), 1 mM MgCl2, and 40 mM Tris-HCl (pH 9.0). The sequencing reactions were performed in a thermal cycler (MJ Research, BioRad, Hercules, California, USA) under the following conditions: 2 min at 96°C for the first denaturation followed by 26 cycles of 45 s at 96°C, 30 s at 50°C, and 4 min at 60°C. The PCR products were precipitated with isopropanol (65%), centrifuged, and washed with 70% ethanol. Ninety-six positive clones were sequenced on an ABI 3700 automated sequencer (Applied Biosystems).

A total of 26 primer pairs were designed against simple sequence repeat (SSR) flanking regions using Primer3 software (Rozen and Skaletsky, 2000) and tested in DNA extracted from leaves of S. brasiliensis (two specimens collected from Minas Gerais State, Brazil, and 30 specimens from a germplasm bank at the University of Campinas, Brazil [Appendix 1]). Primer sequences, repeat motifs, GenBank accession numbers, optimal annealing temperatures, and allele size ranges are provided in Table 1.

Table 1.

Sequences and characteristics of primer pairs designed for Smilax brasiliensis that amplified microsatellite loci.

Locus	Primer sequences (5′–3′)	Repeat motif	Size range (bp)	Ta (°C)	GenBank accession no.
Sbr01	F: AGTCTGCATGAGTTGGTGGA	(GA)7(GT)9	229–241	52	JX070058
	R: AATGGTTCTACTCCTGCCATGT
Sbr02	F: CCAAGAGCAGGGTAGGAGAG	(AG)14	179–217	Touchdown	JX070059
	R: AGGGTCAGAATCGTAGCTGTT
Sbr03	F: TGTTCTCTGGCGGAGTTTCT	(TCT)5	256–259	52	JX070060
	R: AGGACAATCAGCTCGGAAGT
Sbr04	F: GTTACCTCCATGCTGCTGTG	(AG)34(TAGC)5	139–179	60	JX070061
	R: CCACCTCTGCCTCTCTCCTA
Sbr05	F: TGCGGATCTGTAACACACTTG	(TC)5	209	52	JX070062
	R: AAGTCTTGAGGCATGGATGA
Sbr06	F: CCCTACGCACGGTAACACAT	(TC)5	249–251	Touchdown	JX070063
	R: TCCAAGCTCTCCCTCTATTCC
Sbr07	F: GGGGGTGCTTTACAAGATCA	(TC)5(AC)8	161–179	54	JX070064
	R: CGTCTGACCACTCCTTTCCT
Sbr08	F: GGAGTCGGATCACAGAGGAG	(AG)6(AG)4	180–182	Touchdown	JX070065
	R: TGTGTGAGAGGTGTTGAGTGC
Sbr09	F: CGATATGGGCCTCATTCAGA	(TC)11	178–230	52	JX070066
	R: ACATGCCTTTCCCCTACCAC
Sbr10	F: CGATGGATTCAGGTGATTGA	(GA)24	169–209	Touchdown	JX070067
	R: TCAACCCATCAGACCAGTGA
Sbr11	F: CCAGGGAATCTGTGAAATCC	(CT)13	217–249	55	JX070068
	R: TTCTTCAAAACGTGCTGCAT
Sbr12	F: GCCAAATGCATGAGACTCG	(GA)9	237–245	Touchdown	JX070069
	R: GCTTCGTCAACAATCCATCA
Sbr13	F: CCCATCTACACGTCCAAGAG	(CT)5(CT)18	171–195	60	JX070070
	R: GTCACTTGCTTCCCAACCAT
Sbr14	F: TGATTTCAACCACCCATTACC	(AGA)8	204–243	Touchdown	JX070071
	R: TGGGGCCAAAGCTACTAAAT
Sbr15	F: GCCACAACTAGGTCGAGCA	(AG)21	149–193	52	JX070072
	R: TGATTTTGCGTGTTGGACA
Sbr16	F: GTTTTGGAAGCCGAGAT	(TTC)5	259	52	JX070073
	R: GAGCCTTTTTCTTTTTCTCTCC
Sbr17	F: CTGATTGGAAACCCGAACC	(AG)21	204–240	56	JX070074
	R: AACAAGGGAGATGCAGCAGT

Note: Ta = annealing temperature.

PCR was performed in a 20-μL reaction mixture containing 30 ng of DNA, 0.24 μL of forward primer (10 μM), 0.30 μL of reverse primer (10 μM), 0.45 μL of fluorochrome-labeled primer (10 μM), 1.2 μL of dNTP mix (2.5 mM), 1.5 μL of 1× PCR buffer (50 mM KCl, 10 mM Tris-HCl [pH 8.9]), 0.6 μL of bovine serum albumin (BSA, 2.5 μM), 0.6 μL of MgCl2 (3 mM), and 1 U of Taq DNA polymerase (Thermo Scientific, Vilnius, Lithuania). The PCR program consisted of an initial denaturation step at 95°C for 5 min followed by 30 cycles of amplification (94°C for 30 s, 40 s at the specific annealing temperature of each primer pair, and 72°C for 1 min), and a final elongation step at 60°C for 10 min (Table 1). The following touchdown cycling program was used for certain primers: an initial denaturation at 94°C for 5 min followed by 10 cycles of 94°C for 1 min, 65°C decreasing to 55°C at 1°C per cycle for 40 s, and 72°C for 1 min. Subsequently, 30 cycles of 94°C for 40 s, 55°C for 40 s, and 72°C for 1 min were performed prior to a final extension at 72°C for 10 min. The amplification products were separated under denaturing conditions on a 5% (v/v) polyacrylamide gel containing 8 M of urea and 1× TBE (0.045 M Tris-borate and 1 mM EDTA) in an automatic sequencer (LI-COR 4300S DNA Analysis System; LI-COR Biosciences, Lincoln, Nebraska, USA) for approximately 2 h at 70 W. The loci were genotyped using Saga software (LI-COR Biosciences).

From the 26 loci tested, 17 successfully amplified in S. brasiliensis including 13 polymorphic and four monomorphic loci (Sbr05, Sbr06, Sbr08, and Sbr016). The number of alleles per locus, the allele size range, and the observed (Ho) and expected (He) heterozygosities under Hardy–Weinberg equilibrium (HWE) were determined for the polymorphic loci (Table 2). Each locus was tested for deviations from HWE expectations using exact tests, and the gametic disequilibrium between pairs of loci was calculated using GENEPOP (Raymond and Rousset, 1995). The sequential Bonferroni correction was used to correct multiple applications of the same test (Weir, 1996). The presence of null alleles was determined using MICRO-CHECKER 2.2.3 (van Oosterhout et al., 2004). In the S. brasiliensis population, the number of alleles per locus in the remaining 13 loci ranged from four to 11, and the mean number of alleles per locus was 7.4, whereas the Ho and He varied from 0.20 to 1.00 and from 0.51 to 0.89, respectively (Table 2). The total number of alleles for 13 loci was 97 with an average of 7.46 alleles per locus.

Table 2.

Estimates of the genetic diversity indices of Smilax brasiliensis accessions based on 13 microsatellite markers.

Locus	N	A	PIC	Ho	He
Sbr01	19	7.00	0.57	0.74	0.66
Sbr02	14	7.00	0.81	1.00	0.86
Sbr03	20	2.00	0.38	1.00	0.51
Sbr04	15	8.00	0.81	0.53	0.86
Sbr07	20	6.00	0.69	0.50	0.75
Sbr09	21	9.00	0.85	0.48	0.89
Sbr10	21	9.00	0.82	0.71	0.86
Sbr11	17	11.00	0.82	0.59	0.86
Sbr12	14	4.00	0.57	0.29	0.66
Sbr13	20	8.00	0.71	0.20	0.76
Sbr14	17	11.00	0.84	0.65	0.88
Sbr15	19	8.00	0.75	0.63	0.80
Sbr17	19	10.00	0.64	0.63	0.68
Mean	19	7.46	0.74	0.61	0.77

Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; N = number of accessions analyzed; PIC = polymorphic information content.

The mean polymorphism information content (PIC) for all the loci was high (PIC > 0.7), suggesting that these microsatellite markers could be useful for population genetics and diversity studies. No linkage disequilibrium was detected between pairs of loci after Bonferroni correction for multiple tests (P = 0.0038).

Of the polymorphic loci described in this study, between three and 13 were successfully amplified in the other nine Smilax species studied (S. campestris, S. cissoides, S. fluminensis, S. goyazana, S. polyantha, S. quinquenervia, S. rufescens, S. subsessiliflora, and S. syphilitica) (Table 3).

Table 3.

Transferability of loci designed for Smilax brasiliensis and tested in nine other Smilax species with their respective allele size ranges (in base pairs).

Locus	S. campestris (n = 2)	S. cissoides (n = 2)	S. fluminensis (n = 2)	S. goyazana (n = 2)	S. polyantha (n = 2)	S. quinquenervia (n = 1)	S. rufescens (n = 2)	S. subsessiliflora (n = 1)	S. syphilitica (n = 1)
Sbr01	231–235	229–235	—	231–237	231–237	—	229	—	231
Sbr02	191–217	193–213	—	191–213	179–203	—	179–209	—	—
Sbr03	256–259	256–259	256–259	256–259	256–259	—	256–259	—	256
Sbr04	147–163	165	—	145–179	145–155	—	145–167	—	145–159
Sbr05	209	209	—	209	209	209	209	209	—
Sbr06	249	249	251	249	249	251	249	249	251
Sbr07	175–179	161–169	163–165	161–167	—	165	167	—	—
Sbr08	182	182	180	182	182	—	182	—	182
Sbr09	184–200	178–230	188–206	182–210	188–190	—	180–192	—	—
Sbr10	169–189	179–195	169	175–205	173–185	—	179–193	—	169–185
Sbr11	221–243	223–241	—	219–247	237–249	—	225–239	—	—
Sbr12	237	237–245	245	241–245	237–243	—	245	—	237
Sbr13	171	171	173	177	171–185	189	177–189	—	—
Sbr14	207–231	204–231	219–231	213–234	207–231	—	204–213	—	222
Sbr15	167–179	163–183	149–159	163–193	171	149–159	175–189	163–179	—
Sbr16	259	259	259	259	259	—	259	—	259
Sbr17	206–224	220–230	206–224	212–226	208	—	204–212	—	204

Note: — = unsuccessful amplification.

CONCLUSIONS

The development of microsatellite markers for S. brasiliensis will facilitate research focused on germplasm diversity, conservation, and taxonomic studies of the Smilax genus. The described primers represent a useful tool for population genetics in S. brasiliensis as well as in the other nine species of the genus in this study, allowing for enhanced quality control of this group of medicinal plants and avoiding adulterations in the products derived from these plants.