Microsatellite markers for Cariniana legalis (Lecythidaceae) and their transferability to C. estrellensis.

PREMISE OF THE STUDY: Microsatellite primers were developed in the neotropical tree species Cariniana legalis (Lecythidaceae) to investigate its genetic diversity, mating system, and gene flow. • METHODS AND
RESULTS: We identified 96 clones containing 82 repeat motifs from a genomic library enriched for (CT)8 and (GT)8 motifs. Primer pairs were developed for 13 microsatellite loci and validated in 51 C. legalis specimens and 26 C. estrellensis specimens. Eleven loci were polymorphic, revealing a maximum of two to 15 alleles per locus in C. legalis and three to 12 in C. estrellensis. For C. legalis, the observed (H o) and expected (H e) heterozygosities ranged from 0 to 0.99 and from 0.07 to 0.90, respectively. For C. estrellensis, H o and H e ranged from 0 to 0.96 and from 0.14 to 0.91, respectively. •
CONCLUSIONS: The primers identified polymorphic loci that are suitable to study genetic diversity and structure, mating system, and gene flow in C. legalis and the related species C. estrellensis.

Cariniana Casar. (Lecythidaceae) is a genus of trees native to South America, and many of these tree species are harvested for timber. Cariniana legalis (Mart.) Kuntze and C. estrellensis (Raddi) Kuntze are two endangered tropical trees with wind-dispersed seeds that are pollinated by bees (Carvalho, 1994). These species are endemic to the Atlantic Forest in Brazil and have a low population density (less than 1 tree/ha). However, the Atlantic Forest has become increasingly fragmented in recent centuries, and today just 12–16% of the original forest remains (Ribeiro et al., 2009). Forest fragmentation isolates and decreases the natural populations of these trees. These changes affect gene flow among populations and can increase the selfing rate, correlated matings, genetic structure, and the relatedness in subsequent generations (Jump and Penuelas, 2006; O’Connell et al., 2006). Recent advances in molecular techniques, such as microsatellite markers, have created new opportunities for conservation research that can be used to minimize the negative implications of population fragmentation. Here, we describe the development of 12 nuclear microsatellite markers for C. legalis and the transferability of these markers for studying C. estrellensis.

METHODS AND RESULTS

Total genomic DNA was extracted from fresh leaves collected from a single C. legalis tree using the protocol proposed by Doyle and Doyle (1987). A microsatellite-enriched genomic library was constructed following the protocol of Billotte et al. (1999). The RsaI enzyme (Invitrogen, Carlsbad, California, USA) was used to digest genomic DNA from one genotype of C. legalis, enriched in microsatellite fragments using (CT)8 and (GT)8 motifs. These enriched fragments were cloned into pGEM-T Easy Vector (Promega Corporation, Madison, Wisconsin, USA), and ligation products were used to transform Epicurian Coli XL1-Blue Escherichia coli–competent cells (Stratagene, Agilent Technologies, Santa Clara, California, USA). Transformed cells were cultivated on agar plates containing 100 μg/mL ampicillin, 50 μg/mL X-galactosidase, and isopropyl β-d-1-thiogalactopyranoside (IPTG). Single white colonies were selected and stored at −80°C. A total of 96 recombinant colonies were obtained and sequenced using the adapters Rsa21 (5′-CTCTTGCTTACGCGTGGACTA-3′) and Rsa25 (5′-TAGTCCACGCGTAAGCAAGAGCACA-3′) in a 3730xl DNA Analyzer sequencer (Applied Biosystems, Foster City, California, USA) using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems). Ninety-six positive clones from the library were sequenced, and the microsatellites were found in 82 of them. Dinucleotide motifs were the most abundant, followed by mono-, tetra-, tri-, and hexanucleotide motifs (approximately 75.6%, 14.6%, 5%, 2.4%, and 2.4%, respectively); pentanucleotide motifs were not found. Only 13 simple sequence repeat (SSR) markers were selected for primer design because their sequences presented more than five tandem repeats. Vector segments were removed from each of the sequences by VecScreen (http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen.html). Thirteen pairs of primers were designed for SSR flanking regions using Primer3Plus (Untergasser et al., 2007) according to the following criteria: annealing temperature ranging from 52–60°C and GC content between 40% and 60%. Each primer pair was designed to amplify a fragment ranging between 150 and 300 bp. Microsatellite loci were amplified by PCR in a final volume of 15 μL using GoTaq Colorless Master Mix (Promega Corporation) containing 7.5 μL GoTaq Colorless Master Mix (2×), 10 μM of each primer (F and R), 3.0 μL Nuclease-Free Water, and 7.5 ng template DNA. The amplification program for all primers consisted of an initial denaturing step at 94°C for 1 min, followed by 35 cycles of amplification (94°C for 1 min, followed by 1 min at the specific annealing temperature of each primer pair [Table 1], 72°C for 1 min), and a final elongation step at 72°C for 10 min. Amplifications were performed with a Mastercycler (Eppendorf, Hamburg, Germany). Thirteen pairs of primers were designed, but only 12 yielded successfully amplified fragments. The Cle13 locus did not amplify despite using a considerable range of temperatures (40–65°C). The amplification products (2 μL of the total reaction volume) were separated on a Fragment Analyzer Automated CE System (Advanced Analytical Technologies [AATI], Ames, Iowa, USA) using the Quant-iT PicoGreen dsDNA Reagent Kit, 35–500 bp (Invitrogen). Raw data were analyzed using PROSize version 2.0 software (AATI).

Table 1.

Microsatellite primers developed in Cariniana legalis.

Locus	Primer sequences (5′–3′)	Repeat motif	Size range (bp)b	Size range (bp)c	Ta (°C)	GenBank accession no.
Cle01	F: TTCTCTTCCCCCTCTTCCTC	(AC)18	154–184	160–181	60	JX466851
	R: TCCTTTCCAAACCAAACCAC
Cle02	F: TCTCAAAACTCCCCCTCAAG	(AC)11	150–202	140–202	62	JX466852
	R: CCGAAGAAATCATCACCTCA
Cle03	F: GCCTGTCTACTGATGCCAGA	(AC)8	222–241	202–230	62	JX466853
	R: GTATTCCTTGGTTTCTTTGCTG
Cle04	F: CAAAGGTTGAGGGTATAAATGC	(TG)10T(TGTA)5	266–300	256–296	60	JX466854
	R: GGGAGAACTATCCACATCAAGA
Cle05	F: CAAGCCGCACCTTTATCTAT	(CA)8	188–226	186–232	62	JX466855
	R: GCAGCCAAACAGGATAGCA
Cle06	F: CTCTCCTGCCATTGATTTTG	(TG)8A(GA)11	198–230	176–202	60	JX466856
	R: ATGACTGACTCTAAATCTTG
Cle07	F: GGGTAGTGACCAACAATCTCG	(CA)8	150–160	148–208	56	JX466857
	R: ATGATGCTGCCAAGGTAATG
Cle08	F: GCAATCCTCCAAACAGCATT	(AG)19	152–180	150–180	62	JX466858
	R: CCCTCTCTCCATGACCGTTA
Cle09	F: TGGGACAACACATCACAACC	(GT)14	156–186	158–180	58	JX466859
	R: GAATGAATTGGGAGAAAGTG
Cle10	F: AAGTAGAAACCACCTGGCAGA	(TG)16	156–170	160–182	60	JX466860
	R: CCCTATTTCATCCTCAGCAG
Cle11	F: ATGACGCTGATGATGCTGAA	(GT)7	226–230	224–230	58	JX466861
	R: TGCTCCCTTCTGGCTACTTG
Cle12	F: GCCTTGTTAGATGTTGCCTGT	(AG)16	202–224	202–244	56	JX466862
	R: TTGGTTAGTCTCCCTGTTAGC
Cle13	F: TGCCCAACTCAATTCTGAAAC	(TC)19(AC)8	NA	NA	40–65	JX466863
	R: TGACTTCTCCACCTTCAACG

Note: NA = not amplified; Ta = annealing temperature when run individually.

All values are based on a variable number of samples representing two populations located in Ibicatu and Mogi-Guaçu, São Paulo, Brazil.

Allele size found for C. legalis.

Allele size found for C. estrellensis.

We sampled a total of 51 adult C. legalis trees from two populations (25 from Floresta Estadual de Ibicatu and 26 from Floresta Estadual de Mogi-Guaçu) and 26 adult C. estrellensis trees from Floresta Estadual de Ibicatu in São Paulo State, Brazil (Appendix 1). Genetic diversity, fixation index (F), and linkage disequilibrium were estimated for each species using the FSTAT program (Goudet, 2002). To test if F was significantly different from zero and to test linkage disequilibrium, we used 1000 Monte Carlo permutations (alleles among individuals) and a Bonferroni correction (95%, α = 0.05). As noted above, of the 13 tested primers in both species, one (Cle13) showed no amplification (Table 1). The other 12 loci worked well for both species (Table 2). For C. legalis, 100 alleles were found (ranging among loci from two to 14, with an average of 8.3) from Ibicatu, and 112 alleles were found from Mogi-Guaçu (ranging among loci from two to 15, with an average of 9.3). For C. estrellensis, we identified 103 alleles (ranging from three to 12, with an average of 8.6) (Table 2). For C. legalis, the observed (Ho) and expected (He) heterozygosities ranged from 0 to 0.99 and from 0.22 to 0.90, respectively, for Ibicatu and from 0 to 0.96 and from 0.07 to 0.90, respectively, for Mogi-Guaçu. For C. estrellensis, Ho and He ranged from 0 to 0.96 and from 0.14 to 0.91, respectively. Following Bonferroni correction, F was significantly different from zero for three loci of C. legalis from Mogi-Guaçu and four loci and means over loci from Ibicatu. In C. estrellensis, significant F values were observed in eight loci and means over loci (Table 2). After Bonferroni correction, no linkage disequilibrium was detected in the studied populations. Of the 13 loci developed, only Cle11 and Cle13 were not useful due to low polymorphism and lack of amplification, respectively. The remaining 11 loci are suitable for studying genetic diversity and structure, mating system, gene flow, and parentage analysis in both species.

Appendix 1.

List of vouchers of Cariniana legalis and C. estrellensis used in this paper. Vouchers are deposited in the Herbarium of the Universidade de São Paulo, São Paulo, Brazil (ESA).

Code	Species	Country	Locality (State)	Voucher no.
IBI	C. estrellensis	Brazil	Ibicatu (SP)	120064
IBI	C. legalis	Brazil	Ibicatu (SP)	120065
MoG	C. legalis	Brazil	Mogi-Guaçu (SP)	120489

Table 2.

Table 2.Results of initial primer screening in two populations of Cariniana legalis (Ibicatu and Mogi-Guaçu) and one population of C. estrellensis (Ibicatu) from São Paulo, Brazil.

	C. legalisa (N = 25)				C. legalisb (N = 26)				C. estrellensisa (N = 26)
Locus	A	Ho	He	F	A	Ho	He	F	A	Ho	He	F
Cle01	10	0.60	0.81	0.262	15	0.58	0.88	0.347*	11	0.65	0.87	0.247*
Cle02	8	0.96	0.81	−0.18	11	0.92	0.87	−0.056	12	0.88	0.86	−0.029
Cle03	6	0.75	0.76	0.014	5	0.69	0.74	0.066	10	0.30	0.86	0.642*
Cle04	13	0.80	0.90	0.114	14	0.88	0.88	0.001	8	0.54	0.69	0.209
Cle05	7	0.99	0.69	−0.465*	10	0.96	0.86	−0.114	8	0.96	0.73	−0.316
Cle06	6	0.40	0.72	0.448*	7	0.65	0.81	0.196	9	0.27	0.84	0.678*
Cle07	4	0.76	0.56	−0.357	6	0.69	0.73	0.054	6	0.16	0.65	0.754*
Cle08	12	0.76	0.88	0.140	15	0.81	0.90	0.109	11	0.33	0.91	0.635*
Cle09	14	0.68	0.82	0.18	7	0.60	0.76	0.021*	8	0.38	0.72	0.462*
Cle10	8	0.76	0.78	0.024	7	0.96	0.80	−0.203	8	0.70	0.78	0.109
Cle11	2	0.00	0.22	1.000*	2	0.00	0.07	1.000*	3	0.00	0.14	1.00*
Cle12	10	0.46	0.82	0.448*	13	0.96	0.87	−0.104	9	0.51	0.76	0.322*
Mean	8.3	0.66	0.73	0.099*	9.3	0.72	0.77	0.029	8.5	0.47	0.73	0.352*

Note: A = number of alleles per locus; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = sample size for each population.

Significant departures from Hardy–Weinberg equilibrium at P < 0.05.

Ibicatu: 22°46′32″S, 47°49′03″W.

Mogi-Guaçu: 22°17′25″S, 47°10′55″W.

CONCLUSIONS

The microsatellite loci showed high levels of polymorphism in both C. legalis and C. estrellensis. Our data suggest that the microsatellite markers developed in this study are suitable for population genetic studies in both Cariniana species. We are currently using these markers for inferring genetic diversity, spatial genetic structure, and gene flow in C. legalis. These studies will produce valuable information for managing fragmented populations, including information for breeding, conservation, and reforestation plans.