Literature DB >> 25202553

Development of microsatellite markers for the neotropical vine Dalechampia scandens (Euphorbiaceae).

Mohsen Falahati-Anbaran1, Hans K Stenøien2, Christophe Pélabon3, Geir H Bolstad3, Rocio Perez-Barrales4, Thomas F Hansen5, W Scott Armbruster6.   

Abstract

PREMISE OF THE STUDY: Microsatellite markers were developed to assess polymorphism and level of genetic diversity in four Mexican populations of the neotropical vine Dalechampia scandens (Euphorbiaceae). • METHODS AND
RESULTS: Thirty-seven microsatellite markers representing bi-, tri-, tetra-, and pentanucleotide microsatellite repeats were developed. In total, 166 alleles were identified across 54 individuals. The number of alleles varied from one to 11 with an average of 4.49 alleles per locus. All loci except one were highly polymorphic between populations, whereas considerably less variation was detected within populations for most loci. The average observed and expected heterozygosities across study populations ranged from 0 to 0.63 and 0 to 0.59, respectively, for individual loci, and a deviation from Hardy-Weinberg equilibrium was observed for most loci. •
CONCLUSIONS: The developed markers may be useful for studying genetic structure, parentage analysis, mapping, phylogeography, and cross-amplification in other closely related species of Dalechampia.

Entities:  

Keywords:  Dalechampia scandens; Euphorbiaceae; genetic diversity; microsatellite loci

Year:  2013        PMID: 25202553      PMCID: PMC4105026          DOI: 10.3732/apps.1200492

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Dalechampia scandens L. (Euphorbiaceae) is a neotropical twining vine native to Mexico, Central America, and South America (Webster and Armbruster, 1991). The species presents a complex hermaphroditic pseudanthial blossom (clusters of female and male flowers forming flowerlike structures). Attached to the male flowers is a resin-producing gland, which secretes resin for pollinator reward (Armbruster, 1984, 1985). Blossoms are self-compatible and often self-pollinate during a bisexual phase. The main floral visitors are species of resin-collecting bees from the Apidae or Megachilidae family. Because of the attractive floral complex and specialized pollination system, Dalechampia L. species have been used to study the evolution and selection of pollination systems and floral characters (e.g., Armbruster, 1985; Armbruster et al., 2009; Bolstad et al., 2010; Pélabon et al., 2012). Molecular data provide invaluable information to address many ecological and evolutionary questions. Nuclear ribosomal DNA and cpDNA have previously been used to investigate the phylogenetic relationships among Dalechampia species (Armbruster et al., 2009). Inter-simple sequence repeat (ISSR) markers have also been used to analyze the effects of genetic distances between parents on progeny fitness-related traits in D. scandens interpopulation crosses (Pélabon et al., 2005). DNA sequence data may be difficult to apply on intraspecific studies in plants due to low levels of polymorphisms, and ISSR markers have sometimes been shown to yield low reproducibility. Microsatellites (simple sequence repeats [SSRs]) are highly reproducible genetic markers often showing appreciable levels of polymorphisms that have been successfully applied to study a broad spectrum of biological questions. The aim of this study is to identify genomic regions harboring microsatellite loci and to develop appropriate sequence-tagged site markers in D. scandens.

METHODS AND RESULTS

Four natural populations of D. scandens—Ciudad del Carmen (CC: n = 20, 18°56′29″N, 91°18′01″W), Cozumel (CO: n = 10, 20°22′10″N, 86°59′40″W), Puerto Morelos (PM: n = 11, 20°51′11″N, 86°53′43″W), and Valladolid (V: n = 13, 20°42′31″N, 88°15′06″W)—covering large parts of the species range in Mexico were used in this study (see Appendix 1 for voucher information). The Ciudad del Carmen and Puerto Morelos populations differ from the Cozumel and Valladolid in blossom size, the former populations being characterized by large blossoms compared to the latter. Leaf tissue from the Ciudad del Carmen population was used to identify microsatellite loci and to develop primers for the amplification of these loci. The library construction was performed using restriction enzymes BsaAI and HincII following Hamilton et al. (1999). A double-stranded SNX linker was simultaneously ligated to the ends of these fragments with XmnI. The enrichment of DNA fragments containing microsatellite loci was conducted by different 3′-biotinylated oligonucleotides (dimers, trimers, and tetramers), and streptavidin-coated magnetic beads were used to capture the enriched fragments. PCR of genomic DNA fragments enriched for microsatellites was conducted using SNX forward primer (5′-CTAAGGCCTTGCTAGCAGAAGC-3′). PCR reactions were performed in a total volume of 50 μL containing Platinum Taq polymerase (Invitrogen, Carlsbad, California, USA), 10× PCR buffer, 50 mM MgCl2, 10 mM dNTPs, and 10 μM SNX primer. The thermal profile was set at 94°C for 50 s, 55°C for 45 s, and 72°C for 1 min, for 35 cycles. The PCR products were purified using a QIAquick PCR purification kit (QIAGEN, Hilden, Germany) and were digested with NheI and ligated to plasmid pUC19 (New England Biolabs, Ipswich, Massachusetts, USA). The purified ligation was transformed to Electromax DH5α-E cells (Invitrogen) using an Eppendorf Electroporator 2510 (Eppendorf AG, Hamburg, Germany). After electroporation, 300 μL S.O.C. medium (Invitrogen) at room temperature was added to the mixture and incubated in a 37°C water bath for 1 h, followed by incubation at 4°C for 30 min. Two microliters of each library was mixed with 98 μL S.O.C. medium, and 30 and 60 μL of each mixture were spread on the 90-mm Luria–Bertani (LB)/ampicillin/X-gal plates followed by incubation at 37°C overnight. A total of 700–900 colonies were plated onto 150-mm LB/agar plates with 50 μg/mL of ampicillin and left to grow at 37°C overnight. Hybridization was performed by placing a Magna Lift (137-mm) nylon transfer membrane (Osmonics, Westboro, Massachusetts, USA) on a 150-mm LB/agar plate using 5× saline sodium citrate (SSC)/0.5% sodium dodecyl sulfate (SDS)/1 mM EDTA/0.1% bovine serum albumin (BSA) buffer and incubated at 50°C for at least 2 h. The radiolabeled probes were hybridized to a membrane, incubated at 50°C, and rotated overnight. The membrane was exposed to Kodak BioMax MR35 × 43 cm single-emulsion film (Carestream Health Inc., Rochester, New York, USA), and the developed autoradiograph was aligned to an LB plate to localize the positive colonies. In total, 109 positive clones containing microsatellite repeats were sequenced with an ABI 3730xl DNA Analyzer using a BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California, USA).
Appendix 1.

Information for voucher specimens of Dalechampia scandens deposited at the herbarium of the Norwegian University of Science and Technology (NTNU) Museum (TRH), NTNU, Trondheim, Norway.

Voucher informationTRH/V-7479TRH/V-7481TRH/V-7480TRH/V-7482
SampleCC2303PM0901CO0403V0101
CountryMexicoMexicoMexicoMexico
Collection localityCiudad del CarmenPuerto MorelosCozumelValladolid
EcologyRoadside open habitat close to beachRoadside by forestRoadside by forestRoadside by forest
Collector nameGeir H. BolstadGeir H. BolstadGeir H. BolstadGeir H. Bolstad
Collection dateOctober 2007October 2007October 2007October 2007
Determinator nameGeir H. BolstadGeir H. BolstadGeir H. BolstadGeir H. Bolstad
Determination dateOctober 2007October 2007October 2007October 2007
Geographic coordinates18°56′29″N, 91°18′01″W20°51′11″N, 86°53′43″W20°22′10″N, 86°59′40″W20°42′31″N, 88°15′06″W
Altitude2 m7 m13 m31 m
Primer pairs (n = 42) for flanking regions of microsatellite repeats were designed by BatchPrimer3 (You et al., 2008). Two individuals from each population were used to test for primer amplification. Microsatellite loci were amplified in a 10-μL reaction containing 2× Type-it Microsatellite PCR Kit (containing HotStarTaq Plus DNA Polymerase, MgCl2, and dNTPs) from QIAGEN, 0.2 μM of each primer, and 10 ng DNA. PCR amplification was performed on an ABI 9600 thermal cycler (Applied Biosystems) at 95°C for 5 min; 10 initial cycles as touchdown at 94°C for 30 s, 60–50°C for 45 s, 72°C for 45 s; 25 cycles at 94°C for 30 s, 50°C for 45 s, 72°C for 45 s; and final extension at 72°C for 10 min. For successful markers (n = 39), the 5′ end of the forward primer was fluorescently labeled with different fluorophores (6-FAM, HEX, NED, and PET; Table 1) and fragment analysis was conducted with an ABI 3130xl Genetic Analyzer (Applied Biosystems). Nucleotide sequences for microsatellite clones were deposited in GenBank (accession no.: JX668754–JX668790). Two markers, CCtri5 and CCtri12, were removed from data analyses (data not shown). The estimation of the number of alleles (A), observed (Ho) and expected (He) heterozygosities, and test for Hardy–Weinberg equilibrium were performed using Arlequin version 3.5.1.3 (Excoffier and Lischer, 2010).
Table 1.

Characteristics of 37 microsatellite loci in Dalechampia scandens.

Primer sequences (5′–3′)b
LocusaForwardReverseFluorescent dyecRepeat motifTm (°C)Allele size range (bp)AGenBank accession no.
CCdi4CAATTTCGCCGGATTGTTGTCTATGAATCGGATGCAAACCTPET(GA)2061.21190–2188JX668765
CCdi9TCTTCCTGTTCGGTCCTACCTTTGAGAATTCGGATTAGATCGTAGAGAGA6-FAM(TAT)563.10119–1263JX668777
CCdi10CATTGCTTCCATCGACGTTCCCTAGCCTCCTCCCCCAATCAA6-FAM(TC)2565.08199–24710JX668754
CCdi11GCTGACAACGGAATTCAAAAGGAGAGAACACGCAAAGGGAAGTGAAHEX(CT)863.88306–3365JX668755
CCdi13AGGTTGCCATTTCCCCACATCTCAACTGGACAAGTAAAACACGACTAC6-FAM(TC)964.9398–1134JX668756
CCdi23TCTTTCCTTCACTTTCTCCTCTCCAAACCATGAGACACGATGCCAAA6-FAM(CT)763.78151–1795JX668757
CCdi24TTGCATTCCTTCACTGACAATTCAAACCATGAGCCAACAAHEX(AC)858.81136–1483JX668758
CCdi25TATCCACCCTGCCGTTAATCATAGCATCAGTACCACACCCTCGAAACAHEX(CT)1264.02220–2435JX668759
CCdi27AACAAACCTGAAGAAAAAGGGAGGAGGCTCTCACTTTTAGAACCCACA6-FAM(GAG)764.5468–815JX668760
CCdi29GAAAGAAGGAGGCCCCACCAGCAAAAGCATGAGGATTGAGGHEX(CT)1463.2153–786JX668761
CCdi33TTCCAAGAGGTCATGTTGATTGATGGACTGCGTGTGTGTATGTGTTTGTGHEX(AC)863.37180–1963JX668762
CCdi38CGTCCCGTCACATCACTCAAAAGGGACAGGAGTGGAAAHEX(CT)1160.50110–1122JX668763
CCdi39-1GACATGCAGAGGAGGAAGGGAAAGAGGAGAAGAGAATTTAAGGAGAAGGA6-FAM(CAATC)563.60328–3748JX668764
CCdi39-2CCCAACCTCTCTTCTTTCACCTTTCTTCGACGTCCAGCATTT6-FAM(TCT)661.2893–962JX668764
CCdi41TGGGTACCTGAAACTTGTGATGATGGTCGCTTTGTTTCTATCGCTTGCT6-FAM(TG)1064.87200–2254JX668766
CCdi45GGTACGAAGTAAAGTAATGCAAGGACCTGCAAAACTACAATAATGACCTGPET(AC)1062.78117–1326JX668767
CCdi47GAAGAGAAGCGGCATTGTATGAGGCAATTTCCCACATCTTCTTTGHEX(AG)1161.57216–2322JX668768
CCdi50GCTTGCGGGAGCAGGACAACATACCCCTTCAAGCTTTCTCGAACATTACA6-FAM(AG)1365.30285–31511JX668769
CCdi52TGCAAACCATTCATTTTAATTCCAAGTCAACGGTCCACTTACCA6-FAM(TG)858.5674–783JX668770
CCdi53CAATAGAAATGCCAGGAACACGCATAATGCACAGTGAAACPET(TC)1158.35104–1288JX668771
CCdi54CAACCGAAGAAACTCCATGACAACTACCTTGACCTTCCTTCCAACACHEX(GA)1764.39272–2978JX668772
CCdi63TTTCGATATCATTTATCTTCCTTTTTCCTCTCTGGGAACCTTCCACTTHEX(CT)1258.29130–1322JX668773
CCdi67CTGTTTGCGAAAGGCAGGAGGTGTTGAGATCCCTCACCAAGAACATAGAPET(GA)1864.19156–1815JX668774
CCdi71GTGGAGGCGACCAAGACCAACCTGCGACCATGTAAAGTGTTAGGAAAGAHEX(TC)865.38194–1982JX668775
CCdi74TTATGACTCCTTCGCAACAATCCCATACCAAAGACCTGCATCTTCCTPET(CT)1462.99144–1735JX668776
CCtri1CATTGAGAACCAACACCCCACAGGAGGATTCAAGAAAGAGGGAAGGHEX(ATC)565.351681JX668778
CCtri2TTGCGTAAGAAGCCAACCAAACACAAAGATCAATCATGCCTTTCCCTTC6-FAM(AGA)664.6077–832JX668784
CCtri3GCGGTTGCTTAGTCAAAACTCCTACAGGGTATTTATAGAAGGAGAGGAGGAAAG6-FAM(TC)764.8588–962JX668786
CCtri6GGAACGGAGTCATGACAAGTAAGCTCATCATCCATTTTTCCTCCAHEX(TG)860.4297–1336JX668787
CCtri8TGGCAATTGGGACTTTCCTCTTCGAGGCCATTGTTGTGGACTGGTTPET(CTT)565.28165–1983JX668788
CCtri10CACTTCCCTCTCAGTCTTGTTTTGGCTGAAGCTGTTTGCTGGCTGT6-FAM(TCC)666.52181–1873JX668779
CCtri13TGGAGACATAAGGCAAGGATGGCCATGTGGATGAATGAGTAAGTGG6-FAM(TTC)964.26216–2226JX668780
CCtri14-1ACAATCTCACCCAACCAATCAGGCTGAGGTCAGAAGTCATTTTPET(TTA)1061.74104–1163JX668781
CCtri14-2CCACTGCTCCTTCTTCTCCTCCATTAAATGTGGTGAAGATAATGNED(CTT)856.7278–823JX668781
CCtri15CAAATAAAGACTGCAGCACAAAGTCCATAGAAAGATCACATTAAGCAAPET(GTT)659.42126–1272JX668782
CCtri17AAAGAAAGTGATCTGGTGAAGGCATGAAAGGCAAGAGGAAAGAAG6-FAM(GAT)1461.30220–2487JX668783
CCtri21GAAACAGAGTATTGGAGAAAGAGGCAGAATTCTTCTGCTTTTGG6-FAM(ATG)1058.15138–1543JX668785

Note: A = number of different alleles across all populations; Tm = melting temperature.

Two different markers were identified for clones CCtri14 and CCdi39; these are tagged with the suffixes -1 and -2 for each clone.

The forward and reverse sequence of flanking region.

Fluorescent dye for labeling the 5′ end of the forward primer.

Characteristics of 37 microsatellite loci in Dalechampia scandens. Note: A = number of different alleles across all populations; Tm = melting temperature. Two different markers were identified for clones CCtri14 and CCdi39; these are tagged with the suffixes -1 and -2 for each clone. The forward and reverse sequence of flanking region. Fluorescent dye for labeling the 5′ end of the forward primer. In total, 37 microsatellite loci were successfully screened for variability across the four populations of D. scandens (Table 1). Locus CCtri14-2 amplified only in CC and PM populations, and CCtri1 was monomorphic across all individuals/populations. Overall, 166 alleles were identified across all loci/individuals, with an average of 4.49 (SD = 2.47, range 1–11) alleles per locus (Table 1). The proportion of polymorphic loci varied from 0.38 (for PM) to 0.81 (for V). The average number of alleles across all loci varied between 1.51 (SD = 0.73, for PM) and 2.32 (SD = 1.25, for V; Table 2). The average Ho over all loci ranged from 0.06 (for PM) to 0.59 (for V; Table 2). Similarly, the average He across all loci ranged from 0.14 (SD = 0.21, for PM) to 0.40 (SD = 0.26, for V). Overall, lower levels of genetic variation were found in CC and PM compared with CO and V populations.
Table 2.

Allelic diversity and observed and expected heterozygosities in 37 microsatellite loci in four Mexican populations of Dalechampia scandens.

Ciudad del Carmen (n = 20)Puerto Morelos (n = 11)Cozumel (n = 10)Valladolid (n = 13)
LocusAHoHePAHoHePAHoHePAHoHeP
CCdi430.050.59<0.00120.300.390.481310.570.007310.560.002
CCdi9100100310.570.007210.520.001
CCdi1040.250.570.00130.180.600.002310.570.007310.620.004
CCdi1120.100.430.001100310.570.007310.590.003
CCdi1320.050.51<0.001100310.570.007310.650.004
CCdi2310020.090.09110020.080.081
CCdi24100100100100
CCdi2510020.180.480.06210.530.007310.560.001
CCdi2720.050.051300.69<0.001210.530.007210.520.001
CCdi2920.150.220.24620.270.450.233100100
CCdi3320.050.300.002100100100
CCdi3810010010020.080.081
CCdi39-140.150.230.249300.330.00220.100.10130.500.450.342
CCdi39-220.050.051100210.530.007210.520.001
CCdi41100100410.62<0.001310.560.001
CCdi4510020.100.270.15820.900.520.04650.770.780.018
CCdi47100100210.530.007210.520.001
CCdi5030.100.50<0.00130.090.260.048310.570.007710.78<0.001
CCdi5220.200.430.02710010020.080.081
CCdi53200.100.026100410.620.00140.920.660.042
CCdi54300.35<0.00130.500.431210.530.007210.520.002
CCdi6320.300.510.08410010020.080.470.004
CCdi6720.150.410.0120.180.520.061100100
CCdi71100100210.530.007210.520.001
CCdi7420.100.180.153100210.530.007210.520.001
CCtri1100100100100
CCtri2100100100100
CCtri3100100210.530.007210.520.001
CCtri620.100.430.001100100200.52<0.001
CCtri820.050.051100210.530.007210.520.001
CCtri10100100200.190.05320.080.081
CCtri1320.250.360.214200.170.047200.190.05340.230.590.001
CCtri14-1200.51<0.001100210.530.00720.920.520.006
CCtri14-210020.090.091000000
CCtri15100100200.190.05320.080.320.026
CCtri1740.250.660.00120.200.340.306310.570.007310.560.001
CCtri21100100210.530.007210.520.001
Mean1.810.060.201.510.060.141.950.570.332.320.590.40
SD0.910.090.230.730.110.210.910.500.261.250.460.26

Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; P = P value of exact test for Hardy–Weinberg equilibrium.

Allelic diversity and observed and expected heterozygosities in 37 microsatellite loci in four Mexican populations of Dalechampia scandens. Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; P = P value of exact test for Hardy–Weinberg equilibrium.

CONCLUSIONS

The microsatellite markers reported here provide a valuable tool for various kinds of genetic and ecological studies in D. scandens. The present set of markers will be useful in addressing questions about causes of genetic structure, demographic history, phylogeography, and mating systems of natural populations of D. scandens. These markers will be attempted for cross-amplification in closely related species of Dalechampia.
  6 in total

1.  Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites.

Authors:  M B Hamilton; E L Pincus; A Di Fiore; R C Fleischer
Journal:  Biotechniques       Date:  1999-09       Impact factor: 1.993

2.  Macroevolutionary patterns of defense and pollination in Dalechampia vines: adaptation, exaptation, and evolutionary novelty.

Authors:  W Scott Armbruster; Joongku Lee; Bruce G Baldwin
Journal:  Proc Natl Acad Sci U S A       Date:  2009-10-19       Impact factor: 11.205

3.  Effects of crossing distance on offspring fitness and developmental stability in Dalechampia scandens (Euphorbiaceae).

Authors:  Christophe Pélabon; Matthew L Carlson; Thomas F Hansen; W Scott Armbruster
Journal:  Am J Bot       Date:  2005-05       Impact factor: 3.844

4.  Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows.

Authors:  Laurent Excoffier; Heidi E L Lischer
Journal:  Mol Ecol Resour       Date:  2010-03-01       Impact factor: 7.090

5.  Direct selection at the blossom level on floral reward by pollinators in a natural population of Dalechampia schottii: full-disclosure honesty?

Authors:  Geir H Bolstad; W Scott Armbruster; Christophe Pélabon; Rocío Pérez-Barrales; Thomas F Hansen
Journal:  New Phytol       Date:  2010-08-30       Impact factor: 10.151

6.  BatchPrimer3: a high throughput web application for PCR and sequencing primer design.

Authors:  Frank M You; Naxin Huo; Yong Qiang Gu; Ming-Cheng Luo; Yaqin Ma; Dave Hane; Gerard R Lazo; Jan Dvorak; Olin D Anderson
Journal:  BMC Bioinformatics       Date:  2008-05-29       Impact factor: 3.169

  6 in total
  2 in total

1.  Genetic constraints predict evolutionary divergence in Dalechampia blossoms.

Authors:  Geir H Bolstad; Thomas F Hansen; Christophe Pélabon; Mohsen Falahati-Anbaran; Rocío Pérez-Barrales; W Scott Armbruster
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2014-08-19       Impact factor: 6.237

2.  Developmental nonlinearity drives phenotypic robustness.

Authors:  Rebecca M Green; Jennifer L Fish; Nathan M Young; Francis J Smith; Benjamin Roberts; Katie Dolan; Irene Choi; Courtney L Leach; Paul Gordon; James M Cheverud; Charles C Roseman; Trevor J Williams; Ralph S Marcucio; Benedikt Hallgrímsson
Journal:  Nat Commun       Date:  2017-12-06       Impact factor: 14.919

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.