Literature DB >> 25202544

Development of microsatellite loci for the riparian tree species Melaleuca argentea (Myrtaceae) using 454 sequencing.

Paul G Nevill1, Anna Williams1, Siegfried Krauss1, Donna Bradbury1, Sunil Samaraweera2, Michael G Gardner3.   

Abstract

PREMISE OF THE STUDY: Microsatellite primers were developed for Melaleuca argentea (Myrtaceae) to evaluate genetic diversity and population genetic structure of this broadly distributed northern Australian riparian tree species. • METHODS AND
RESULTS: 454 GS-FLX shotgun sequencing was used to obtain 5860 sequences containing putative microsatellite motifs. Two multiplex PCRs were optimized to genotype 11 polymorphic microsatellite loci. These loci were screened for variation in individuals from two populations in the Pilbara region, northwestern Western Australia. Overall, observed heterozygosities ranged from 0.27 to 0.86 (mean: 0.52) and the number of alleles per locus ranged from two to 13 (average: 4.3). •
CONCLUSIONS: These microsatellite loci will be useful in future studies of the evolutionary history and population and spatial genetic structure in M. argentea, and inform the development of seed sourcing strategies for the species.

Entities:  

Keywords:  454 GS-FLX; Melaleuca argentea; northern Australia; nuclear SSR markers; riparian tree; shotgun sequencing

Year:  2013        PMID: 25202544      PMCID: PMC4105037          DOI: 10.3732/apps.1200401

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Melaleuca argentea W. Fitzg. (Myrtaceae) is a small to medium (3–25 m high) tree species with a broad distribution throughout northern Australia. Melaleuca argentea is shallow rooted and an obligate phreatophore and therefore reliant on shallow water tables or surface water (Graham, 2001). Surface and near-surface water are scarce in the semiarid Pilbara region, and larger tree species like M. argentea are only found in or along riparian communities. Changes to the spatial and temporal aspects of water availability, associated with mining activities in the region, may have the potential to impact some areas of the riparian communities, requiring rehabilitation of areas where loss of vegetation may occur. Therefore, information on the spatial genetic structure of M. argentea is needed to inform the development of seed sourcing strategies. There are no species-specific molecular markers available for M. argentea and there have been no previous studies on genetic variation in the species. Here, we report the isolation and characterization of 11 nuclear microsatellite loci using next-generation sequencing that will be used for population genetic studies in this species.

METHODS AND RESULTS

Genomic DNA (5 μg) was isolated from the leaf tissue of one individual of M. argentea following the protocol of Glaubitz et al. (2001), modified with the addition of a wash buffer (Wagner et al., 1987). The DNA was then sent to the Ramaciotti Centre for Gene Function Analysis (University of New South Wales, Sydney, Australia) for shotgun sequencing on a Roche 454 GS-FLX sequencer with titanium chemistry (Roche Applied Science, Indianapolis, Indiana, USA) following Gardner et al. (2011). The sample occupied 12.5% of a plate and produced 274,938 individual sequences, with an average read length of 362 bp, of which 5860 contained microsatellites. We used the program QDD version 1 (Meglécz et al., 2010) to screen the raw sequences for those that contained eight or more di-, tri-, tetra-, or pentabase repeats, remove redundant sequences, and design primers (automated in QDD using Primer3 [Rozen and Skaletsky, 2000]). Software running parameters were set to default values with the exception of PCR product lengths, which was set to 90–450 bp. Primer pairs were designed for 548 different loci and from these we excluded immediately all loci that contained imperfect repeats, had a greater than 2°C difference between the forward and reverse primer annealing temperatures, a GC content less than 40% or greater than 60%, polynucleotide runs of four or more runs in the flanking regions, and short repeat motifs within the flanking region or primer sequence. From the remaining 355 loci, we randomly chose for further development 32 loci containing either dinucleotide or trinucleotide repeats (GenBank accession no.: JX424003–JX424034). These 32 loci were trialed for amplification with the cost-effective approach of Schuelke (2000) using a QIAGEN Multiplex PCR Kit (QIAGEN, Hilden, Germany). Loci were amplified in individual, 20-μL reactions containing 10 μL QIAGEN Multiplex PCR Master Mix; 2.5 μL Q-solution; forward primer (with sequence tag at 5′ end, unlabeled) 0.05 μM, reverse primer (unlabeled) 0.2 μM, and 5′ sequence tag (labeled; unique to primer) 0.2 μM; 10–50 ng DNA; plus sterile H2O to 20 μL. PCR cycling was performed in a Corbett Gradient Palm-Cycler (Corbett Life Science, Sydney, Australia) according to the manufacturer’s protocol as follows: Taq activation at 95°C for 15 min; followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 90 s, and extension at 72°C for 90 s; followed by a final extension at 60°C for 30 min. PCR products were visualized on a 2% agarose gel stained with SYBR Safe (Invitrogen Corporation, Carlsbad, California, USA). Twenty-four loci amplified an unambiguous product of the expected size. These amplifiable loci were then screened on eight individuals to test for polymorphism and alleles sized using an ABI 3730 genetic analyzer (Applied Biosystems, Foster City, California, USA) and GENEMAPPER version 4.0 software (Applied Biosystems). Of the 24 loci, 11 were polymorphic and scorable, seven did not amplify consistently, and alleles at six loci were unclear. We screened the 11 polymorphic and scorable loci for variation in 20 or more individuals from each of two populations of M. argentea from the Pilbara region (Table 1) (WW-BO: Universal Tranverse Mercator [UTM] coordinates 720216E 7448488N, collection no. PN103; WW-LP: UTM coordinates 725022E 7462878N, collection no. PN104; herbarium material is deposited at the Kings Park and Botanic Garden Herbarium, Perth, Western Australia [KPBG]). The loci were amplified in two multiplex PCRs, and conditions were as per the initial screening with the exception of a reduction of the annealing temperatures to 56°C to improve amplification. Genetic diversity parameters were calculated using GenAlEx version 6.4 (Peakall and Smouse, 2006), and deviation from Hardy–Weinberg equilibrium (HWE) was determined using GENEPOP 3.4 (Raymond and Rousset, 1995) (Tables 1 and 2). P values from HWE tests were adjusted for multiple tests of significance using the sequential Bonferroni method. Overall, the number of alleles observed for the 11 loci ranged from two to 13 with an average of 4.3 alleles per locus (Table 2). The observed and expected heterozygosities ranged from 0.23 to 0.86 and 0.29 to 0.78, respectively (Table 2). Significant departures from HWE were detected in the KPMA07 and KPMA25 loci in WW-BO and WW-LP (Table 2). This may be a result of heterozygote deficiency, potentially resulting from the presence of null alleles and/or population structure. We checked all pairs of loci for linkage disequilibrium in GENEPOP, and none were significant after sequential Bonferroni adjustment.
Table 1.

Characteristics of 11 nuclear microsatellite primers developed in Melaleuca argentea.[a,b]

LocusPrimer sequences (5′–3′)cRepeat motifSize range (bp)dLabel (Multiplex)eGenBank accession no.
KPMA07F: CAGTGCGACTGATCCTTTGA(AG)11119–127FAM (1)JX424009
R: AAAATTAGATGACGCCGAGC
KPMA11F: AACATGGCTACCAACCAACC(GCC)8126–144PET (2)JX424013
R: ACGATCAGGGACAGCAAGAT
KPMA14F: CGACAACAGAAGCCGGTAAT(GAA)9202–208VIC (1)JX424016
R: CGAAGAGAAACGAAGGAACG
KPMA16F: CGTAGAACTTGGCGAGGAAG(CTT)9209–221FAM (2)JX424018
R: CCCTACTGTCCGACGAAGAA
KPMA17F: CCTGGTGGGTAAAGGGTCTT(CT)8132–140NED (1)JX424019
R: GGTCTAGAGTTCAGCGCTACAAA
KPMA18F: TTGAAGGTTTGTTTGCACCA(AG)10208–216NED (2)JX424020
R: CTGCCTTGCTTGATGTTTCA
KPMA20F: CTCCGCATCTTGATAGCGTT(GCA)8221–230PET (1)JX424022
R: TACGTAAATTCGGGCTCACC
KPMA23F: ATGAATGGAGGCCAGACAAC(GCG)8126–138FAM (2)JX424025
R: CCCCTCTTTCACCTCTTCCT
KPMA25F: GCTCATTCGTTTGCTTCCAT(GA)13142–188NED (2)JX424027
R: CGCTCCTCCTAAAGTTTCCC
KPMA26F: GCATCCTAGCGGACGAGTAG(CTT)11238–258NED (2)JX424028
R: TAGCTGCTTCAAAGATGGCA
KPMA28F: ACCAAAACATTTCCCCATGA(GA)13152–172PET (2)JX424030
R: TATACGCCCTCCTTCAATGC

All values are based on samples from two populations in the Pilbara region of Western Australia (WW-BO: UTM coordinates 720216E 7448488N, n = 25; WW-LP: UTM coordinates 725022E 7462878N, n = 21).

An annealing temperature of 56°C was used for all primers.

Forward primer sequences do not include the 5′-forward tail.

Size range of the PCR products in base pairs includes the 5′-forward tail.

5′ tags: FAM 5′-AATACGACTCACTATAG; NED 5′-ATTTAGGTGACACTATAG; PET 5′-GCGGATAACAATTTCACACAGG; VIC 5′-ATTAACCCTCACTAAAG.

Table 2.

Results of primer screening in two populations of Melaleuca argentea.

WW-BOWW-LP
LocusAHobHeAHobHe
KPMA0750.61*0.5550.23*0.48
KPMA1130.440.5030.330.29
KPMA1420.290.4320.440.42
KPMA1630.580.5830.550.52
KPMA1730.670.5750.440.62
KPMA1830.270.4940.380.70
KPMA2030.440.4530.650.51
KPMA2320.560.5050.570.56
KPMA2580.50*0.66100.52*0.67
KPMA2640.720.6460.860.78
KPMA2860.640.6460.760.76

Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity.

All values are based on samples from two populations in the Pilbara region of Western Australia (WW-BO: UTM coordinates 720216E 7448488N, n = 25; WW-LP: UTM coordinates 725022E 7462878N, n = 21).

Significant deviations from Hardy–Weinberg equilibrium (*P < 0.01) after correction for multiple tests (sequential Bonferroni procedure) are reported.

Characteristics of 11 nuclear microsatellite primers developed in Melaleuca argentea.[a,b] All values are based on samples from two populations in the Pilbara region of Western Australia (WW-BO: UTM coordinates 720216E 7448488N, n = 25; WW-LP: UTM coordinates 725022E 7462878N, n = 21). An annealing temperature of 56°C was used for all primers. Forward primer sequences do not include the 5′-forward tail. Size range of the PCR products in base pairs includes the 5′-forward tail. 5′ tags: FAM 5′-AATACGACTCACTATAG; NED 5′-ATTTAGGTGACACTATAG; PET 5′-GCGGATAACAATTTCACACAGG; VIC 5′-ATTAACCCTCACTAAAG. Results of primer screening in two populations of Melaleuca argentea. Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity. All values are based on samples from two populations in the Pilbara region of Western Australia (WW-BO: UTM coordinates 720216E 7448488N, n = 25; WW-LP: UTM coordinates 725022E 7462878N, n = 21). Significant deviations from Hardy–Weinberg equilibrium (*P < 0.01) after correction for multiple tests (sequential Bonferroni procedure) are reported.

CONCLUSIONS

The microsatellite loci presented in this study will be useful in the examination of the population genetic structure of M. argentea, a species that may be impacted by hydrological changes associated with mining in the Pilbara region of northwestern Western Australia. Specifically, research is planned that will examine genetic connectivity between geographically proximate riparian systems, which will inform the development of seed sourcing guidelines for the species.
  7 in total

1.  An economic method for the fluorescent labeling of PCR fragments.

Authors:  M Schuelke
Journal:  Nat Biotechnol       Date:  2000-02       Impact factor: 54.908

2.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

3.  QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Authors:  Emese Meglécz; Caroline Costedoat; Vincent Dubut; André Gilles; Thibaut Malausa; Nicolas Pech; Jean-François Martin
Journal:  Bioinformatics       Date:  2009-12-10       Impact factor: 6.937

4.  Rise of the machines--recommendations for ecologists when using next generation sequencing for microsatellite development.

Authors:  Michael G Gardner; Alison J Fitch; Terry Bertozzi; Andrew J Lowe
Journal:  Mol Ecol Resour       Date:  2011-06-16       Impact factor: 7.090

5.  Dinucleotide microsatellites from Eucalyptus sieberi: inheritance, diversity, and improved scoring of single-base differences.

Authors:  J C Glaubitz; L C Emebiri; G F Moran
Journal:  Genome       Date:  2001-12       Impact factor: 2.166

6.  Chloroplast DNA polymorphisms in lodgepole and jack pines and their hybrids.

Authors:  D B Wagner; G R Furnier; M A Saghai-Maroof; S M Williams; B P Dancik; R W Allard
Journal:  Proc Natl Acad Sci U S A       Date:  1987-04       Impact factor: 11.205

7.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

  7 in total
  1 in total

1.  Microsatellite markers: what they mean and why they are so useful.

Authors:  Maria Lucia Carneiro Vieira; Luciane Santini; Augusto Lima Diniz; Carla de Freitas Munhoz
Journal:  Genet Mol Biol       Date:  2016-08-04       Impact factor: 1.771

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.