| Literature DB >> 25202510 |
Mohammad Fatemi1, Gary J Houliston2, Azadeh Haddadchi1, Caroline L Gross1.
Abstract
PREMISE OF THE STUDY: Microsatellite markers were developed to assess the level of genetic variation and population structure in Banksia integrifolia, a widespread species endemic to eastern Australia. • METHODS ANDEntities:
Keywords: Banksia integrifolia; Proteaceae; coast banksia; genetic variation; next-generation sequencing; simple sequence repeat markers
Year: 2013 PMID: 25202510 PMCID: PMC4105364 DOI: 10.3732/apps.1200130
Source DB: PubMed Journal: Appl Plant Sci ISSN: 2168-0450 Impact factor: 1.936
Locations and herbarium voucher information for Banksia integrifolia populations used in this study.
| Population | Voucher | Geographic coordinates | Herbarium |
| South Auckland | C. Winks | 36°55′11″S, 174°46′03″E | CHR618143 |
| Wards Mistake | I. Simpson WSW-DNA-11 | 30°08′18″S, 151°51′36″E | NE098953A |
| Ex Wambo | I. Simpson WSW-DNA-12 | 32°35′51″S, 151°1′49″E | NE098954A |
| Archerfield | I. Simpson WSW-DNA-7 | 32°30′17″S, 151°02′55″E | NE098950A |
Note: CHR = Allan Herbarium; NE = N. C. W. Beadle Herbarium.
Characteristics of 11 polymorphic microsatellite loci in Banksia integrifolia.
| Locus | GenBank accession no. | Primer sequences (5′–3′) | Fluorescent label | Repeat motif | Allele size (bp) | |
| Bint02 | JQ717058 | F: GTACCTACCAAGGGCGGTG | NED | (AAAG)5 | 5 | 202 |
| R: TCCTGGATTGCAAAATCACAAAC | ||||||
| Bint03 | JQ717059 | F: GCCAGCCCTACAGATCAGG | PET | (AAAT)7 | 3 | 160 |
| R: AGAGGCAAAACAAACTCGGAC | ||||||
| Bint05 | JQ717060 | F: TTCACCGGCCTCTTATCCC | VIC | (AAC)8 | 4 | 226 |
| R: TCGTTGCGGATTGCAGTTG | ||||||
| Bint07 | JQ717061 | F: TCCAAGCCGGGAAGAATTG | FAM | (AAG)5 | 4 | 156 |
| R: AGAAACTGCGAGCAGAACTC | ||||||
| Bint12 | JQ717062 | F: AAGGGCCATACCTGGTGC | NED | (AAT)13 | 7 | 242 |
| R: AGAGCGTGGATAGGACACG | ||||||
| Bint14 | JQ717063 | F: TCCATATAGCTGATCACATTAAGTTGG | PET | (AAT)9 | 7 | 156 |
| R: TCAGATGAACACGTAGCAATCG | ||||||
| Bint16 | JQ717064 | F: AGAGGAGCGAGTCGAAGTG | VIC | (ACGG)6 | 5 | 241 |
| R: GAAACAGGTAGCGTGTCCG | ||||||
| Bint17 | JQ717065 | F: GAAGGCCTGAAATGTCGCC | FAM | (AGG)10 | 7 | 156 |
| R: GAACCTGGCTGGAATGCTG | ||||||
| Bint19 | JQ717066 | F: GGTAGCAACAAGACGTTGGG | NED | (GGT)10 | 4 | 149 |
| R: ACCACCATCACCCACTACC | ||||||
| Bint24 | JQ717067 | F: GTGCCTGCACAGAAAGGTG | PET | (AGT)11 | 4 | 220 |
| R: AATGGACTGGACCTCAGCC | ||||||
| Bint25 | JQ717068 | F: ATCTCCCCAGCAACTCGTG | VIC | (AGG)7 | 3 | 160 |
| R: AGATCGGCCATTCTGGGTC |
Note: A = number of alleles.
Sequences are deposited in the GenBank Sequence Read Archive (SRA053681).
Results of primer screening in three Australian populations of Banksia integrifolia.
| WM ( | EW ( | AF ( | |||||||||||||
| Locus | Null | Null | Null | ||||||||||||
| Bint02** | 3 | 0.125 | 0.318 | 0.599 | 0.17 | 4 | 0.167 | 0.365 | 0.534 | 0.19 | 4 | 0.174 | 0.617 | 0.712 | 0.27 |
| Bint03 | 3 | 0.261 | 0.309 | 0.138 | 0.16 | 2 | 0.042 | 0.042 | −0.021 | 0.00 | 1 | 0 | 0 | — | — |
| Bint05** | 4 | 0.792 | 0.575 | −0.405 | 0.49 | 4 | 0.875 | 0.689 | −0.297 | 0.41 | 4 | 0.696 | 0.669 | −0.064 | 0.48 |
| Bint07 | 2 | 0.375 | 0.361 | −0.061 | 0.00 | 3 | 0.292 | 0.263 | 0.131 | 0.00 | 3 | 0.348 | 0.305 | −0.165 | 0.00 |
| Bint12** | 6 | 0.154 | 0.702 | 0.772 | 0.35 | 4 | 0.048 | 0.645 | 0.924 | 0.36 | 3 | 0 | 0.557 | 1.000 | 0.35 |
| Bint14** | 6 | 0.208 | 0.563 | 0.622 | 0.25 | 4 | 0.292 | 0.610 | 0.512 | 0.21 | 4 | 0.087 | 0.312 | 0.715 | 0.20 |
| Bint16* | 5 | 0.500 | 0.556 | 0.081 | 0.01 | 2 | 0.417 | 0.383 | −0.111 | 0.20 | 3 | 0.130 | 0.335 | 0.602 | 0.21 |
| Bint17** | 5 | 0.167 | 0.270 | 0.368 | 0.09 | 5 | 0.417 | 0.763 | 0.443 | 0.31 | 4 | 0.478 | 0.747 | 0.345 | 0.13 |
| Bint19* | 0 | 0 | 0 | — | — | 3 | 0.150 | 0.304 | 0.494 | 0.16 | 3 | 0.696 | 0.590 | −0.205 | 0.00 |
| Bint24** | 3 | 0.417 | 0.643 | 0.338 | 0.56 | 3 | 0.333 | 0.507 | 0.329 | 0.44 | 3 | 0.435 | 0.527 | 0.156 | 0.34 |
| Bint25 | 2 | 0.182 | 0.169 | −0.100 | 0.00 | 2 | 0.042 | 0.042 | −0.021 | 0.00 | 1 | 0 | 0 | — | — |
| Mean | 3.54 | 0.289 | 0.406 | 0.223 | — | 3.27 | 0.279 | 0.419 | 0.267 | — | 3 | 0.277 | 0.423 | 0.281 | — |
Note: A = number of alleles; FIS = inbreeding coefficient; He = expected heterozygosity; Ho = observed heterozygosity; N = number of sampled individuals; Null = null allele frequency estimate.
Populations are abbreviated as: WM = Wards Mistake; EW = Ex Wambo; AF = Archerfield.
Asterisks indicate significant departure from Hardy–Weinberg equilibrium after Bonferroni correction: *P ≤ 0.05, **P ≤ 0.01.