Literature DB >> 25202490

Exon-primed intron-crossing (EPIC) markers for evolutionary studies of Ficus and other taxa in the fig family (Moraceae).

Xiaohong Yao1, Chenhong Li2, Christopher W Dick3.   

Abstract

PREMISE OF THE STUDY: The genus Ficus (fig trees) comprises ca. 750 species of trees, vines, and stranglers found in tropical forests throughout the world. Fig trees are keystone species in many tropical forests, and their relationship with host-specific wasp pollinators has received much attention, although many questions remain unresolved regarding the levels of host specificity, cospeciation, and the role of hybridization in fig and wasp speciation. We developed exon-primed intron-crossing (EPIC) markers to obtain phylogenetic resolution needed to address these questions. • METHODS AND
RESULTS: Expressed sequence tags (ESTs) from F. elastica were compared to Arabidopsis and Populus genomes to locate introns and to design primers in flanking exons. Primer pairs for 80 EPIC markers were tested in samples from divergent clades within Ficus and the outgroup Poulsenia (Moraceae). •
CONCLUSIONS: Thirty-one EPIC markers were successfully sequenced across Ficus, and 29 of the markers also amplified in Poulsenia, indicating broad transferability within Moraceae. All of the EPIC markers were polymorphic and showed levels of polymorphism similar to that of the widely used internal transcribed spacer (ITS).

Entities:  

Keywords:  Ficus; Moraceae; exons; nuclear DNA markers; phylogeny; transcriptome

Year:  2013        PMID: 25202490      PMCID: PMC4103470          DOI: 10.3732/apps.1300037

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Ficus L. (Moraceae) is a pantropical genus comprised of ca. 750 species of trees, epiphytes, shrubs, vines, and stranglers found primarily in humid tropical forests. As a year-round source of calcium-rich fig fruits, Ficus trees are often described as keystone species. However, Ficus may be best known for their pollination mutualism with small (1–2 mm), short-lived (1–2 d) “fig wasps” in the family Agaonidae (Weiblen, 2002; Herre et al., 2008). Female fig wasps pollinate flowers and oviposit within the enclosed inflorescence (syconium or “fig”), in which the larvae develop before emerging to pollinate and oviposit in the syconia of asynchronously flowering conspecific trees. For sustained reproduction of the figs and the wasps, the wasps must exhibit a high degree of host-specificity, and the host population must provide access to flowers (i.e., figs) throughout the year. Although the fig-wasp pollination mutualism is one of the tightest known in terms of host-pollinator specificity, there are many exceptions to the one pollinator species/one host species rule. In some cases, two or more wasp species pollinate the same host species in different parts of its geographic range, and multiple wasp species have been found in a single host tree (Herre et al., 2008). Furthermore, in Central America and in South Africa some wasp species have been shown to use more than one fig species in the local fig community (reviewed in Herre et al., 2008). The nonspecificity of some pollinators, in addition to some genetic studies (e.g., Machado et al., 2005), suggests that hybridization is possible. Most phylogenetic studies of Ficus have used chloroplast DNA and/or one or two commonly used nuclear DNA markers (e.g., internal transcribed spacer [ITS]) (e.g., Rønsted et al., 2005). These markers are insufficient in number for studies of introgression, and they do not resolve phylogenies of closely related species or phylogeographic structure in widespread species (C. Dick, unpublished). To address the deficiency in nuclear genomic markers for Ficus, we have developed a set of exon-primed intron-crossing (EPIC) markers by comparing an expressed sequence tag (EST)–library for F. elastica Roxb. ex Hornem. with the annotated genomes of Populus trichocarpa Torr. & A. Gray (Salicaceae) and Arabidopsis thaliana (L.) Heynh. (Brassicaceae) using a bioinformatics pipeline developed by Li et al. (2010).

METHODS AND RESULTS

Selection of taxa

Neotropical Ficus contains two distinct and phylogenetically distant subgenera, which represent two important neotropical life forms: the free-standing fig trees (subg. Pharmacosycea (Miq.) Miq. sect. Pharmacosycea) and the strangler figs (subg. Urostigma (Gasp.) Miq. sect. Americana Miq.). Sect. Pharmacocysea is sister to all the other fig subgenera, and therefore our sect. Americana and sect. Pharmacocysea samples share a most recent common ancestor that is the base of the entire Ficus crown clade, which, based on fossil records, dates back to at least 60 million years before present (Rønsted et al., 2005). All primers were tested on F. obtusifolia Kunth (sect. Pharmacocysea) and F. maxima Mill. (sect. Americana), which were collected from the Barro Colorado National Monument (BCNM) in central Panama. The subset of primers that amplified in both Ficus species were also tested on Poulsenia armata (Miq.) Standl., which is a monotypic genus in the fig family Moraceae (Datwyler and Weiblen, 2004). Botanical vouchers (Dick and Gomez 234, F. obtusifolia; Dick and Gomez 240, F. maxima; and Dick and Gomez 180, P. armata) were deposited at the herbaria of the University of Panama (PMA) and University of Michigan, Ann Arbor (MICH). Genomic DNA was extracted with the cetyltrimethylammonium bromide (CTAB) method of Doyle and Doyle (1987).

Bioinformatics pipeline

Researchers from the United States Department of Agriculture (USDA) previously developed an EST library of F. elastica to characterize the genetic basis of rubber biosynthesis (McMahan and Whalen, personal communication). We compared 9289 unique F. elastica ESTs from the National Center for Biotechnology Information (NCBI) database with the annotated genomes of A. thaliana (Brassicaeae) and P. trichocarpa (Salicaceae) using the informatics pipeline developed by Li et al. (2010). Briefly, we (1) retrieved coding sequences (CDS) that were longer than 100 bp from the annotated genomes of A. thaliana and P. trichocarpa. (2) We compared those CDS with the genome of the same species to identify “single-copy” CDS. (3) The candidate single-copy CDS thus identified were subsequently compared to the EST library of F. elastica to find markers that were conserved (identity >80%) among all three species. (4) After locating the single-copy conserved CDS, we screened for CDS flanking small introns, which were smaller than 1000 bp in the compared genomes, to facilitate the subsequent PCR and sequencing steps. Primers based on the F. elastica exons were initially designed by eye and subsequently checked with the Primer3 web interface program (Rozen and Skaletsky, 2000).

Primer assays

PCR was performed in a final volume of 20 μL containing 10 mM Tris–HCl (pH 8.4), 50 mM (NH4)2SO4, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.1 μM each primer, 2 ng of genomic DNA, and 0.5 units of Taq polymerase (BioTherm, Gaithersburg, Maryland, USA). The amplification profiles included an initial denaturing at 94°C for 5 min; followed by 35 cycles of 50 s at 94°C, 50 s at 54°C, and 1 min at 72°C; and a final extension step of 10 min at 72°C. PCR products were ligated into the pMD 18-T plasmid vector (Promega Corporation, Madison, Wisconsin, USA) and transformed into E. coli strain (DH5α, Promega Corporation). Insert-positive plasmids were isolated using the E.Z.N.A. Plasmid Mini Kit I (Omega Bio-Tek, Norcross, Georgia, USA) and amplified using M13 primers. Forward and reverse strands of each amplicon were sequenced on an ABI 3730xL DNA sequencer (Applied Biosystems, Carlsbad, California, USA) at the University of Michigan Sequencing Core Facility. All Ficus insert sequences have been deposited in GenBank (accession numbers JQ341915–JQ341980; also see Table 1). For comparisons with ITS, we also obtained ITS sequences for F. obtusifolia, F. maxima, and P. armata (GenBank accessions JX137113–JX137114) using standard methods.
Table 1.

Characterization of 31 EPIC markers designed to amplify broadly across the genus Ficus.

LocusbPrimer sequences (5′–3′)Total/intron length (bp) (+range)No. of polymorphic sitesNucleotide diversityGenBank accession no.Reference locuscGene abbreviationd
FA08190F: CCAAATTGTTGCGAGGATCT484/435 (+2)240.05053JQ341915AT1G08190ATVAM2
R: TTTAGAGCATCGGTCATGGAJQ341916
FA02580F: CTAGATCTTGCACAGCAGCAG487/381 (+2)220.04593JQ341917AT4G02580T10P11_14
R: GCATGGTGTAGTGCCACAAAJQ341918
FA03310F: GCGGGTATAAGAAGGGAACC740/581 (+2)430.05866JQ341919AT3G03310LCAT3
R: GGTGCATTGACCACCTTGATJQ341920
FA07360aF: GCTGATAAAATGGTTGCTGCTG540/287290.05410JQ341921AT2G07360T13E11.13
R: CCCCTTGATCTTCCCCATTACTJQ341922
FA08510F: TGCTGGACTTCTTGGTGATG893/741510.05724JQ341923AT1G08510FATB
R: CAATCACGACGCATACCATTCJQ341924
FA11980F: AGTTGGGCCATGCATCAGA851/734 (+4)350.04142JQ341925AT5G11980F14F18_150
R: ACCCAACGATGTGAATCCAAJQ341926
FA14000F: TCCAGTGCTGATCATTTGAAAG443/278 (+7)230.05349JQ341927AT1G14000F7A19_9
R: GGCTGCCTCATAAGGCTCAJQ341928
FA16180bF: CGGACTTATGGAACCAGAGTAATTC417/281 (+3)210.05147JQ341929AT4G16180DL4130C
R: GATGCTCCAGTACAATGACAACATJQ341930
FA16690bF: TCACAATTCTCCAGTGGTCATAAT964/674 (+3)400.04171JQ341931AT5G16690ATORC3
R: TTCTCAGAAAAACTGCAACCTTJQ341932
FA19690*F: ACTTGGCCTTCTTACTTCATGG386/258 (+2)120.03158JQ341933AT5G19690STT3A
R: AGCAATCCCAGACATGATGCJQ341934
FA23640*F: ATTCCTTTTGGTCCTCCACATC1032/821 (+1)550.05478JQ341935AT3G23640HGL1
R: ACCCCCAATCCAGGGAACTAJQ341936
FA24620aF: CCTTACAAGGACAGCCTTTTG513/323200.04219JQ341937AT4G24620PGI1
R: CTCAAGCTCCCAATCATGGJQ341938
FA24620bF: TGGCTAGATTTCCCATGTTTG980/827 (+4)500.05149JQ341939AT4G24620PGI1
R: AGCTGCTGCAGATACCGACTJQ341940
FA26990F: GGAAGCGTACAGGGTGATGT476/246130.02760JQ341941AT2G26990FUS12
R: CATCAGAGCCATCTTCCTTTTGJQ341942
FA32180F: TGCTCGAACTAAGGGAAGAATG741/628 (+13)380.05163JQ341943AT4G32180ATPANK2
R: GCTGCAAGAACACCTTCAATAAJQ341944
FA32910F: GGTTGGAATTCTTGGAGAAAATAC455/284 (+2)120.02655JQ341945AT4G32910F26P21_30
R: GTGAAGCCAAAACTTGAGCATAJQ341946
FA36880bF: GCTGTTGGGACATTGTTGAC1044/896 (+6)410.03958JQ341947AT5G36880F5H8_15
R: ATAACCGCTACACTCCCCTTCJQ341948
FA45300F: GGAGGACTTGGTCTTGGTTACTT890/684410.04622JQ341949AT3G45300ATIVD
R: CCATTAGTGCACCACATCTTGTJQ341950
FA48520*F: TCATCCATATTTGGTCGGAGAT1059/890 (+4)710.07305JQ341951AT5G48520ATAUG3
R: CCACCCATTGTCTTTCACTTGJQ341952
FA73180F: CGGGACTTATCTTCAGACTTTTCA470/235180.03863JQ341953AT1G73180T18K17_15
R: GTGCCTTAGAAAGCTCAACTGCJQ341954
FP04090bF: GGAATGCAAGCAATTGATGA438/275 (+10)150.03529JQ341955POPTR_0006s00800CYP97B3
R: AGGTCCAGCAACCTCAGCTAJQ341956
FP08470F: GCGATGTGCTGCGTGTATTT550/404 (+7)250.04630JQ341957POPTR_0017s08470BGAL9
R: GGTCCATAAAGACTTGGAGAGGJQ341958
FP08550F: CCGCTATCCTTTGGCTGTTA741/451 (+5)360.05233JQ341959POPTR_0006s08550F6E21_100
R: CACATGCTTCTGCACGTTCTJQ341960
FP09670F: GCAGCAACGTGGTGATAAGA642/509320.05016JQ341961POPTR_0001s09670XPB1
R: ATCACATTAGCCTCGGGAATATCJQ341962
FP10430F: GTGGGATGTCAGTTTGGATTT1021/658 (+161)440.05176JQ341963POPTR_0009s10430FUT11
R: CAGCCCAGGAAAAGTATCCAJQ341964
FP10550F: GGTGAAGGTGCAGTTGATCAGT473/325 (+1)240.05172JQ341965POPTR_0008s10550ALDH22a1
R: GCTTGACAGCCTCTTCATCAGTJQ341966
FP11540bF: GATTACAACAACCTCTGCCAGT661/496 (+4)280.04328JQ341967POPTR_0017s11540MZN14.21
R: AGCATGTGCTTGTACTCATCAACJQ341968
FP12610aF: GGATGCACTGGTTATGGTCA362/238140.03889JQ341969POPTR_0011s12610uncharacterized
R: TCGTAAGGAGCACCAGCAACJQ341970
FP13070F: GGCACATTTGCTTCCATTCT844/748 (+2)380.04612JQ341971POPTR_0013s13070uncharacterized
R: TAATGCATGATTCCTGTTCCAAJQ341972
FP17290F: CTCACATGCCTCACTCATGC781/642 (+2)330.04465JQ341973POPTR_0001s17290F18B13_28
R: GTCTCCACACGGTCCTTTCTJQ341974
FP35460F: TCTCTGGTTGTTGCTGATTTTGG735/634 (+8)410.05840JQ341975POPTR_0001s35460unknown
R: TGGGGTCTGCTCCTCCAGTJQ341976

The locus descriptions (total and intron length, polymorphism) represent comparisons between Ficus obtusifolia (sect. Americana) and F. maxima (sect. Pharmacocysea).

The first two letters of the marker name indicate the genomic comparisons (e.g., FA = Ficus/Arabidopsis; FP = Ficus/Populus) followed by the numerical locus identifier of the reference genome.

Full reference genome locus name.

Abbreviation for the putative gene function.

Denotes markers that were not transferable to the Poulsenia armata (Moraceae) outgroup.

Characterization of 31 EPIC markers designed to amplify broadly across the genus Ficus. The locus descriptions (total and intron length, polymorphism) represent comparisons between Ficus obtusifolia (sect. Americana) and F. maxima (sect. Pharmacocysea). The first two letters of the marker name indicate the genomic comparisons (e.g., FA = Ficus/Arabidopsis; FP = Ficus/Populus) followed by the numerical locus identifier of the reference genome. Full reference genome locus name. Abbreviation for the putative gene function. Denotes markers that were not transferable to the Poulsenia armata (Moraceae) outgroup.

Data analyses

DNA chromatograms were edited using the SEQUENCHER program (Gene Codes Corporation, Ann Arbor, Michigan, USA). DNA sequences were initially aligned using ClustalX version 1.81 (Thompson et al., 1997) with default settings, and subsequently aligned manually using Se-Al (Rambaut, 1996). We determined number of polymorphic sites, nucleotide diversity (π), and GC content using MEGA 5 software (Kumar et al., 2008).

Results

We identified 200 ESTs that satisfied our criterion of 80% exon identity with the published genomes. Based on intron length, we selected a subset of 80 ESTs for further marker development, of which 31 amplified successfully in Ficus species from both subgenera, 16 amplified in one species only, and 33 did not amplify in either species. The 31 cross-amplifying primer pairs were further tested in P. armata, of which 29 amplified successfully (Table 1). The number of polymorphic sites in F. obtusifolia and F. maxima comparisons ranged from 12 to 71 (mean = 32), whereas nucleotide diversity ranged from 0.02655 to 0.07305 (mean = 0.0470) (Table 1). In comparison, there were 45 variable sites in ITS between F. obtusifolia and F. maxima, falling within the range of the EPIC marker variation.

CONCLUSIONS

The 31 EPIC markers that amplified between the two Ficus subgenera indicate that these markers might be useful across the full phylogenetic breadth of the >60 Ma genus and its >750 species. The markers that transfer to Poulsenia indicate an even broader phylogenetic utility within the Moraceae (ca. 40 genera and 1000 species), which probably originated in the Cretaceous. These markers should therefore be extremely useful for phylogenetic analysis at the family level and potentially beyond. The markers show a level of intron divergence that is of a similar magnitude as ITS, which is one of the most informative and broadly used markers in plant molecular systematics. These EPIC loci should be useful for analyzing recent divergences in which incomplete lineage sorting and/or introgression may be factors, including recent speciation, hybridization, and comparative phylogeography. In combination with EPIC markers developed for chalcid wasps (Lohse et al., 2011), it should now be possible to jointly analyze wasp and host plant phylogenies to study coevolution at both population and phylogenetic scales.
  9 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

Review 2.  How to be a fig wasp.

Authors:  George D Weiblen
Journal:  Annu Rev Entomol       Date:  2002       Impact factor: 19.686

Review 3.  Critical review of host specificity and its coevolutionary implications in the fig/fig-wasp mutualism.

Authors:  Carlos A Machado; Nancy Robbins; M Thomas P Gilbert; Edward Allen Herre
Journal:  Proc Natl Acad Sci U S A       Date:  2005-04-25       Impact factor: 11.205

4.  60 million years of co-divergence in the fig-wasp symbiosis.

Authors:  Nina Rønsted; George D Weiblen; James M Cook; Nicolas Salamin; Carlos A Machado; Vincent Savolainen
Journal:  Proc Biol Sci       Date:  2005-12-22       Impact factor: 5.349

5.  MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences.

Authors:  Sudhir Kumar; Masatoshi Nei; Joel Dudley; Koichiro Tamura
Journal:  Brief Bioinform       Date:  2008-04-16       Impact factor: 11.622

6.  On the origin of the fig: phylogenetic relationships of Moraceae from ndhF sequences.

Authors:  Shannon L Datwyler; George D Weiblen
Journal:  Am J Bot       Date:  2004-05       Impact factor: 3.844

7.  The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Authors:  J D Thompson; T J Gibson; F Plewniak; F Jeanmougin; D G Higgins
Journal:  Nucleic Acids Res       Date:  1997-12-15       Impact factor: 16.971

8.  Developing EPIC markers for chalcidoid Hymenoptera from EST and genomic data.

Authors:  Konrad Lohse; Barbara Sharanowski; Mark Blaxter; James A Nicholls; Graham N Stone
Journal:  Mol Ecol Resour       Date:  2010-12-20       Impact factor: 7.090

9.  Exon-primed intron-crossing (EPIC) markers for non-model teleost fishes.

Authors:  Chenhong Li; Jean-Jack M Riethoven; Lingbo Ma
Journal:  BMC Evol Biol       Date:  2010-03-31       Impact factor: 3.260

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.