| Literature DB >> 25202489 |
Karen L Bell1, Daniel J Murphy2, Michael G Gardner3.
Abstract
PREMISE OF THE STUDY: We isolated 15 polymorphic microsatellite markers from Vachellia farnesiana for use in population genetic studies to determine the native range of the species. • METHODS ANDEntities:
Keywords: 454 GS-FLX; Acacia farnesiana; Vachellia farnesiana; cross-species transferability; microsatellites; shotgun sequencing
Year: 2013 PMID: 25202489 PMCID: PMC4103469 DOI: 10.3732/apps.1300035
Source DB: PubMed Journal: Appl Plant Sci ISSN: 2168-0450 Impact factor: 1.936
Characterization of 15 polymorphic microsatellite loci of Vachellia farnesiana.
| Locus | Primer sequences (5′–3′) | GenBank accession no. | Repeat motif | Allele size (bp) | |
| Af18V | F: GCCACAACTAAAGTCATATCACCA | KF030919 | (TA)9 | 108 | 58 |
| R: CCTTCTTACGCTCCATGATTC | |||||
| Af24P | F: CATGGCCTATTTCCACCACT | KF030921 | (AT)9 | 94 | 58 |
| R: TTGGTGCAATTGATAGCGTT | |||||
| Af05P | F: TTGGACATTCCAATTGAGATTATTA | KF030916 | (TG)8 | 118 | 58 |
| R: AGCAGGAACTTGCTTAGATGC | |||||
| Af38F | F: GATTGCTATGTCATCTCCCTCC | KF030926 | (GT)10 | 98 | 58 |
| R: GTGCGAGATCTATCGACGAC | |||||
| Af19F | F: ACTTCGAGATGAACCTCCCA | KF030920 | (AT)11 | 106 | 58 |
| R: CGAGACCCAAATCAGTCGAT | |||||
| Af32N | F: CAGTTCAAACTATCATCTCTATTCACA | KF030925 | (AT)8 | 90 | 58 |
| R: GTGATATGTTTACGGTGCCGA | |||||
| Af25N | F: GATGGCGGCAACACAGTAT | KF030922 | (CT)10 | 109 | 58 |
| R: AAGTGAACAATATTGAAGCGCA | |||||
| Af03N | F: TTAATGCAATTGGGAATCACTT | KF030915 | (GA)15 | 150 | 58 |
| R: GACACTCCCACCTGTATCGG | |||||
| Af10F | F: GAAGTTATTCTTAATTGCTACCATTCC | KF030917 | (AC)12 | 91 | 58 |
| R: TTGACCAACTCTACTCTTAATTGATTG | |||||
| Af26F | F: CAGCTCGATAGCTAAACAAGGA | KF030923 | (CA)10 | 108 | 58 |
| R: GGTGTTTGGATGGAAGTTCG | |||||
| Af47F | F: CCTGAGACAGTTGTGTTTGATTG | KF030929 | (AC)11 | 121 | 58 |
| R: ATCATGCCTTGTCAGCATCC | |||||
| Af14N | F: ATTACACCACTCGGTCGGTC | KF030918 | (AAG)5 | 90 | 58 |
| R: CCCATCTTCTCCAGCATCAT | |||||
| Af29N | F: GGAATCCAATGTATTTGGCG | KF030924 | (AT)8 | 109 | 58 |
| R: AGGTTCACAAGGCAACCTGT | |||||
| Af42N | F: AAACTCAATAACTTGCTTAACTGAAA | KF030927 | (TC)5 | 120 | 58 |
| R: CCAATTTGCTTGCTTGACTTG | |||||
| Af46N | F: TGAAGAATAATAGCTAGCGGCTG | KF030928 | (AG)9 | 91 | 58 |
| R: TGAGAAGGCCCAATGAAATC |
Note: Ta = annealing temperature.
Superscripts F, N, V, and P indicate loci were 5′ labeled with the dyes 6-FAM, NED, VIC, and PET, respectively.
Locality data for the seven individuals of Vachellia farnesiana used in the initial screening of 47 loci.
| Country | Collection locality | Geographic coordinates |
| USA | Arizona: Maricopa County | 33.2932°N, 112.428°W |
| Mexico | Veracruz: Los Negritas | 18.8383°N, 96.07°W |
| Mexico | San Luis Potosí | 22.2°N, 101°W |
| Madagascar | Antsiranana: Diana: south of Diego Suarez | 12.4321°S, 49.3567°E |
| Madagascar | Nosy Be | 13.3833°S, 48.2°E |
| Australia | Queensland: 31 km W of Cloncurry | 20.7584°S, 140.2327°E |
| Australia | Western Australia: 180 km E of Halls Creek | 17.944°S, 128.8816°E |
Genetic properties of 15 microsatellite loci of Vachellia farnesiana.
| Mexico | Australia | Total | Amplification of other | ||||||||||||||||||
| Locus | Allele size range (bp) | HWE | Allele size range (bp) | HWE | Allele size range (bp) | ||||||||||||||||
| Af18 | 21 | 111–127 | 3 | 0.95 | 0.57 | 0.001 | 20 | 111–129 | 3 | 1.00 | 0.59 | 0.000 | 41 | 111–129 | 4 | 0.98 | 0.64 | P | + | + | + |
| Af24 | 21 | 113–121 | 5 | 0.95 | 0.74 | 0.031 | 19 | 113–121 | 5 | 0.79 | 0.65 | 0.647 | 40 | 113–121 | 5 | 0.88 | 0.75 | P | − | − | − |
| Af05 | 21 | 141–155 | 5 | 0.19 | 0.17 | 1.000 | 20 | 141–143 | 2 | 0.00 | 0.10 | 0.000 | 41 | 141–155 | 5 | 0.10 | 0.14 | M | + | − | − |
| Af38 | 21 | 113–117 | 3 | 0.10 | 0.19 | 0.997 | 20 | 113–115 | 2 | 0.25 | 0.22 | 0.523 | 41 | 113–117 | 3 | 0.17 | 0.16 | M | + | + | + |
| Af19 | 20 | 122–146 | 6 | 1.00 | 0.68 | 0.032 | 16 | 121–144 | 8 | 0.94 | 0.84 | 0.489 | 36 | 121–146 | 9 | 0.97 | 0.81 | M | + | + | + |
| Af32 | 20 | 102–106 | 2 | 0.00 | 0.09 | 0.000 | 18 | 106–114 | 5 | 0.17 | 0.72 | 0.000 | 38 | 102–114 | 6 | 0.08 | 0.68 | – | − | − | − |
| Af25 | 21 | 124–132 | 4 | 0.38 | 0.46 | 0.142 | 18 | 124–130 | 4 | 0.11 | 0.21 | 0.006 | 39 | 124–132 | 5 | 0.26 | 0.35 | P | + | − | − |
| Af03 | 21 | 149–169 | 4 | 0.28 | 0.63 | 0.000 | 18 | 149–167 | 6 | 0.89 | 0.73 | 0.0233 | 9 | 149–169 | 7 | 0.56 | 0.80 | M | − | − | − |
| Af10 | 21 | 93–105 | 4 | 0.71 | 0.68 | 0.001 | 20 | 103–107 | 3 | 0.90 | 0.52 | 0.004 | 41 | 93–107 | 5 | 0.81 | 0.70 | – | + | − | − |
| Af26 | 21 | 125 | 1 | 0.00 | 0.00 | ND | 20 | 125–129 | 3 | 0.10 | 0.36 | 0.002 | 41 | 125–129 | 3 | 0.05 | 0.20 | P | + | − | − |
| Af47 | 21 | 139–149 | 4 | 0.71 | 0.57 | 0.000 | 20 | 137–147 | 3 | 0.10 | 0.34 | 0.000 | 41 | 137–149 | 5 | 0.42 | 0.49 | P | + | − | − |
| Af14 | 20 | 108–111 | 2 | 1.00 | 0.50 | 0.000 | 20 | 108–111 | 2 | 1.00 | 0.50 | 0.000 | 40 | 108–111 | 2 | 1.00 | 0.50 | M | + | + | − |
| Af29 | 21 | 124–138 | 6 | 0.91 | 0.77 | 0.434 | 20 | 124–152 | 9 | 1.95 | 0.82 | 0.003 | 41 | 124–152 | 12 | 0.93 | 0.84 | P | + | + | − |
| Af42 | 20 | 139 | 1 | 0.00 | 0.00 | ND | 20 | 139 | 1 | 0.00 | 0.00 | ND | 40 | 139 | 1 | 0.00 | 0.00 | P | + | + | + |
| Af46 | 20 | 108 | 1 | 0.00 | 0.00 | ND | 19 | 104–108 | 2 | 0.05 | 0.51 | 0.906 | 39 | 104–108 | 2 | 0.03 | 0.03 | P | + | + | + |
Note: – = no amplification; + = successful amplification; A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; M = monomorphic; N = sample size; ND = not done; P = polymorphic.
Mexican samples are from Puebla (18.8°N, 99°W), with an extra herbarium specimen from Oaxaca, also in southern Mexico (16.302°N, 96.286°W). Australian samples are from a broader range of populations across northwestern Australia (latitude range 14.463–21.629°S, longitude range 114.918–132.259°E).
Allele size range is the size of the PCR product including the 454A sequencing tag.
Indicates significance after corrections for multiple tests.
Voucher information for Vachellia species used in this study.
| Species | Voucher specimen accession no. | Collection locality | Geographic coordinates | No. of individuals |
| MO6178804 | Oaxaca, Mexico | 16.302°N, 96.286°W | 1 | |
| K.L. Bell 128 | Katherine, Northern Territory, Australia | 14.463°S, 132.259°E | 1 | |
| ASU 279693 | Maricopa County, Arizona, USA | 33.2932°N, 112.428°W | 1 | |
| MEL 2370354A | Diana, Antsiranana, Madagascar | 12.4321°S, 49.3567°E | 1 | |
| MEL 2263911 | Bolivia | 20.105°S, 63.487°W | 1 | |
| MEL 2263912 | Bolivia | 17.9°S, 64.558°W | 1 | |
| MEL 2066644 | Wyndham-East Kimberley, Western Australia, Australia | 16.3839°S, 126.4975°E | 1 | |
| MEL 2066645 | Wyndham-East Kimberley, Western Australia, Australia | 16.3839°S, 126.4975°E | 1 | |
| MEL 260774 | Queensland, Australia | 21.267°S, 141.3°E | 1 | |
| MEL 2080462 | Queensland, Australia | 20.05°S, 148.25°E | 1 | |
| MEL 2204859 | Western Australia, Australia | 15.803°S, 128.75°E | 1 | |
| MEL 2293312 | Queensland, Australia | 23.446°S, 150.439°E | 1 |
Lodged at the National Herbarium of Victoria (MEL), except where noted.
Lodged at the Missouri Botanical Garden (MO).
Lodged at MEL, but not yet accessioned.
Lodged at the Arizona State University Vascular Plant Herbarium (ASU).