Literature DB >> 25202484

Development of microsatellite markers in Cratylia mollis and their transferability to C. argentea (Fabaceae).

M Cristina López-Roberts1, Luciano Paganucci de Queiroz1, Cássio van den Berg1.   

Abstract

PREMISE OF THE STUDY: This work aimed to develop microsatellite markers for Cratylia mollis as tools to assess its genetic diversity and structure and to evaluate their potential cross-amplification in related species. • METHODS AND
RESULTS: Microsatellite markers were developed using a microsatellite-enriched library and an intersimple sequence repeat library. From a set of 19 markers, 12 microsatellite loci were polymorphic and presented considerable variation in allele number (2-11), expected heterozygosity (0.226-0.883), and polymorphism information content per locus (0.212-0.870). Cross-amplification in C. argentea was successful in 16 loci, 12 of which were polymorphic (2-10 alleles). •
CONCLUSIONS: The polymorphism of this set of microsatellite markers for C. mollis, as well as their successful cross-amplification in C. intermedia and C. bahiensis and their transferability to C. argentea, supports their use in future comparative studies to understand the mechanism involved in population divergence and speciation in the genus.

Entities:  

Keywords:  Cratylia; Fabaceae; cross-amplification; microsatellite; population divergence; transferability

Year:  2013        PMID: 25202484      PMCID: PMC4103464          DOI: 10.3732/apps.1300015

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Cratylia (Desv.) Kuntze is a South American genus distributed eastward from the Andes and southward from the Amazon River Basin. Five species are currently accepted: C. argentea (Desv.) Kuntze, C. bahiensis L. P. Queiroz, C. hypargyrea Mart. ex Benth., C. intermedia (Hassl.) L. P. Queiroz & R. Monteiro, and C. mollis Mart. ex Benth. (Queiroz and Coradin, 1995). Cratylia argentea is the most widespread, occurring from western Peru to Bolivia and Brazil in habitats including cerrado and seasonally dry forests. The other species are restricted to a particular type of vegetation: C. hypargyrea is found in Brazilian coastal Atlantic Forest, C. bahiensis and C. mollis grow in seasonally dry forest of northeastern Brazil, and C. intermedia occurs to the west of Paraná and to the northeast of Misiones Province in Argentina (Queiroz and Coradin, 1995). Cratylia mollis and C. argentea are multipurpose shrub legumes with high potential for animal nutrition due to their nutritive value, particularly for dry season supplementation and silage (Argel and Lascano, 1998), and also show also tolerance to drought and adaptation to acidic soils (Andersson et al., 2006). Recent studies revealed that C. mollis seeds are an important lectin source (known as Cramoll) with applications for medicine (Fernandes et al., 2010). In the current study, our aim was to develop microsatellite markers to assess the genetic variation of C. mollis, and to assess their potential transferability to C. argentea and cross-amplification in other species of the genus.

METHODS AND RESULTS

Genomic DNA was isolated from one individual cultivated on the campus of the Universidade Estadual de Feira de Santana (J. G. Rando 1257, see Appendix 1) and extracted using the cetyltrimethylammonium bromide (CTAB) 2× protocol. Microsatellite markers were developed using both microsatellite-enriched library and intersimple sequence repeat (ISSR)–based cloning methods. A microsatellite-enriched library was built using the biotin-labeled microsatellite oligoprobes (GT)8 and (CT)8 and streptavidin-coated magnetic beads (Promega Corporation, Madison, Wisconsin, USA) according to Billotte et al. (1999). For the ISSR method, we performed PCR reactions with the ISSR primers GGCC(AG)8, GGCC(AC)8, CCGG(AG)8, CCGG(AC)8, GCGC(AG)8, and GCGC(AC)8 following closely the protocol of Provan and Wilson (2007). The selected fragments obtained by both methods were linked into pGEM-T Easy Vector (Promega Corporation, São Paulo, Brazil) and then transformed and cloned in TOP10 competent cells (Invitrogen, Life Technologies, Vila Guarani, São Paulo, Brazil). Positive clones were amplified with the T7 (5′-TAATACGACTCACTATAGGG-3′) and SP6 (5′-ATTTAGGTGACACTATAGAA-3′) primers using the following conditions: denaturation step of 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 15 s, annealing at 55°C for 35 s, and extension at 72°C for 90 s; final extension was at 72°C for 7 min. DNA sequencing was performed with Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, São Paulo, Brazil). The software Imperfect Microsatellite Extractor (Mudunuri and Nagarajaram, 2007) was used for identification of simple sequence repeats in the nonredundant sequences. Primers were designed using Primer3Plus (Rozen and Skaletsky, 2000) using the following criteria: product size range 100–300 bp, primer melting temperature (Tm) 50–60°C, primer GC 40–60%, maximum Tm difference: 2°C. Genotyping reactions were carried out in 10 μL with the Top Taq Master Mix kit (QIAGEN, Hilden, Germany) with approximately 4 ng of genomic DNA, 0.15 μM of the forward primer (added M13 sequence: 5′-CACGACGTTGTAAAACGAC-3′), 0.30 μM of the reverse primer, and 0.60 μM of an M13-labeled tail (with one of four fluorescent dyes: 6-FAM, VIC, NED, or PET). For each primer pair, the optimal annealing temperature was established in gradient PCRs from 61–45°C; however, a touchdown program (60–54°C) was needed in some cases. For polymorphism assessment, individuals of two C. mollis populations (CMPOP_1, N = 24; CMPOP_2, N = 25) and 20 individuals cultivated from seeds of CMPOP_2 were genotyped. To test the cross-amplification and potential transferability, we sampled individuals obtained from the Laboratory of Plant Molecular Systematics (LAMOL) DNA bank at the Universidade Estadual de Feira de Santana (see Appendix 1): C. argentea (N = 9), C. bahiensis (N = 2), C. hypargyrea (N = 2), and C. intermedia (N = 2). Microsatellite profiles were analyzed with GeneMapper 4.0 (Applied Biosystems). The estimates of allelic diversity and deviations from Hardy–Weinberg equilibrium were carried out using GenAlEx 6.5 (Peakall and Smouse, 2006). We amplified and sequenced 180 of 192 positive clones derived from the microsatellite-enriched and ISSR libraries and found 78 nonredundant sequences containing microsatellite loci. Percentage of dinucleotide motifs was higher (62%) than trinucleotide motifs (34%) or tetra-, penta-, and octanucleotide repeats (4% combined). The number of repetitions in dinucleotides varied from three to nine, in trinucleotides from three to five, in tetranucleotides from three to four, and in pentanucleotides from four to five. The motifs found in the sequences of the enriched library had fewer repetitions (3–4) than the ISSR library, and for this reason most of these were not used to design primers. Therefore, 32 primers pairs were designed (30 corresponding to the ISSR library), from which 19 presented amplification patterns compatible with the expected fragment sizes (Table 1).
Table 1.

Characterization of 19 microsatellite markers developed for Cratylia mollis.

LocusPrimer sequences (5′–3′)Repeat motifProduct size (bp)aTa (°C)M13 5′ PigtailGenBank accession no.
CM_1FCAAGAAAGTGACCTAAATGG(TC)2AC(TC)2210–22456PETKC351492
CM_1RCTGATTCAGCTAAGGTAGACA
CM_4FCGTAGGAAGCACATGGTGTA(GTGCT)2TGCT121566-FAMKC351493
CM_4RCCAGAGCCACAAGGATAGAT
CM_5FCCTTGGAAAAGCTGAAGAGAAA(AG)3AA(AG)3136–14260VICKC351494
CM_5RATGGCCTCCTTCACATGC
CM_6FGGAGGCCATCTTTGAAGC(AGG)3130–13858–606-FAMKC351494
CM_6RGATGGTGGCTGTGATGGT
CM_7FGCTCAAGAGATTGTGAATGTG(AG)4N12(AGA)3A(AGA)112–120596-FAMKC351495
CM_7RCCTTCTACCTCACTCACTGCT
CM_8FGCAGTGAGTGAGGTAGAAGGAA(AATTA)4(TTAAAAA)4180–228TD 60–54NEDKC351495
CM_8RCGAGGAAAACAAAACCCAAA
CM_9FCAATGGAAGACTTGGGGTTT(GA)4170–18058–60VICKC351496
CM_9RGGTTGGGCCTCTAATCTCCT
CM_10FGTTACTGGGTTCACTTTGGT(AGA)3GGAAGA167–173TD 60–54VICKC351497
CM_10RCTTCAACTTCTGGTTAATGG
CM_11FCATCATTAACATTGGACGGAAG(TG)9186–21259NEDKC351499
CM_11RCAACCAACACTCTCCACCTG
CM_15FCACGGTGCTCTGAAAGTTGT(CT)6149–18358VICKC351502
CM_15RAGAAGAGGGGAATGGGTTGT
CM_18FGCGTGAAGTATTGTATCAAG(ATA)3ATT304–33658–60PETKC351504
CM_18RCAGTCACTACAAGTGCAGTAT
CM_19FCACGGGAGACAAGAGCGTA(GT)4226–23658–60PETKC351505
CM_19RGGTCGCTGTACAATGAACCA
CM_20FCCTTGGAAAAGCTGAAGAGAAA(AG)3AA(AG)3246–25856PETKC351506
CM_20RCTTCAAGATGGTGGCTGTGA
CM_21FCAAGGTATGGGTAGGACAAGG(AG)7125–13960–546-FAMKC351507
CM_21RACAACACAAGCACACTGCAA
CM_22FTGCAGTGTGCTTGTGTTGTCT(TC)4134–14456VICKC351507
CM_22RTGCCCCTTCTTCTCTCTG
CM_23FACACGGAGCGAGAAAAGTGT(AG)4172–19256NEDKC351508
CM_23RGGAAGCTTCAATCCACCAAT
CM_25FCAACATTCGGGAGGCTTTTAATGTG(ATG)2300–309TD 60–54PETKC351509
CM_25RCACCCTCCAAGCACATCAAT
CM_27FGTCTCGCGGATCAGTTAAGC(CT)9112–120TD 60–546-FAMKC351510
CM_27RCATGGCTCGGCTTTACATTT
CM_31FTGTGACAAAGTAATGTGAAAGCAA(ATG)3ATATG24656PETKC351513
CM_31RCCCAGCCACTTCAGTTTTCT

Note: Ta = annealing temperature; TD = touchdown program.

Expected size based on the cloned fragment, excluding the 5′ M13 universal sequence.

Characterization of 19 microsatellite markers developed for Cratylia mollis. Note: Ta = annealing temperature; TD = touchdown program. Expected size based on the cloned fragment, excluding the 5′ M13 universal sequence. Twelve microsatellite loci were polymorphic and presented considerable variation in allele number (2–11), observed heterozygosity (0.040–0.792), expected heterozygosity (0.226–0.883), and polymorphic information content per locus (0.212–0.870). The markers that were monomorphic in CMPOP_1 (CM_7, CM_15, CM_20) exhibited polymorphism in CMPOP_2 and vice-versa (CM_10), reflecting population differentiation in this species. Cross-amplification in C. argentea was successful in 16 loci; 12 of these were polymorphic, displaying an allele range of 2–4 in only nine individuals evaluated. Four monomorphic loci in C. mollis showed polymorphism in C. argentea. Cross-amplification success rates were also high in C. intermedia (15 loci) and C. bahiensis (12 loci); however, in C. hypargyrea only two microsatellite loci were successfully amplified (Table 2). Significant values (P < 0.01) of deviation from Hardy–Weinberg equilibrium were found in two loci of CMPOP_1 and one locus of CMPOP_2, where levels of observed heterozygosity were lower than expected (Table 2).
Table 2.

Results of initial microsatellite marker screening in two populations of Cratylia mollis and cross-amplification in other species.

C. mollisCross-amplification and transferability
CMPOP_1 (N = 24)CMPOP_2 (N = 25)CMPOP_2 (seeds) (N = 20)C. argentea (N = 9)Cross-amplification
LocusAHoHePICP (HWE)AHoHePICP (HWE)AAC. bahiensis (N = 2)C. hypargyrea (N = 2)C. intermedia (N = 2)
CM_1130.1760.4200.3770.5802nononoyes
CM_41122yesnoyes
CM_550.4580.6710.6290.31730.0420.5150.4030.91931yesnoyes
CM_61111yesyesyes
CM_7150.5420.6030.5520.10212nonono
CM_880.2610.5260.5070.50450.5000.5480.5180.08733yesnoyes
CM_91112yesnoyes
CM_1030.3680.4810.4060.23312nononoyes
CM_1190.4500.8360.8170.462110.2610.8830.8700.704103yesnoyes
CM_15150.0400.4980.4620.92024yesnoyes
CM_1820.5450.4960.373−0.100*30.4580.4780.4100.04212nonoyes
CM_191113nonoyes
CM_20130.2500.2260.212−0.108*32yesyesyes
CM_2140.7920.6010.524−0.318*80.4580.6660.6440.31252yesnoyes
CM_221142yesnono
CM_231113yesnoyes
CM_25113nononono
CM_27n/an/a51nonono
CM_311111yesnoyes

Note: — = value not calculated; A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; N = number of individuals; n/a = no amplification; PIC = polymorphism information content.

* Significant values (P < 0.01).

Results of initial microsatellite marker screening in two populations of Cratylia mollis and cross-amplification in other species. Note: — = value not calculated; A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; N = number of individuals; n/a = no amplification; PIC = polymorphism information content. * Significant values (P < 0.01). This heterozygote deficiency could reflect patterns of the population distribution and reproductive biology of C. mollis. This species presents a facultative breeding system, and experimental tests showed similar success in allogamous and autogamous crosses (Queiroz et al., 1997). It is pollinated by the carpenter bees Xylocopa grisescens Lepeletier and X. cearensis Ducke, which visit flowers that are simultaneously open in the same inflorescence before moving to other inflorescences, thus promoting geitonogamous crosses (L. P. Queiroz, unpublished observations). In addition, the species forms patchy populations on sandy soils (L. P. Queiroz, personal communication), which together with the pollinator behavior favors autogamy and low heterozygosity.

CONCLUSIONS

This is the first report of microsatellite markers in C. mollis and the genus as a whole. The observed polymorphism in 12 of 19 microsatellite loci in C. mollis, their successful cross-amplification in C. intermedia and C. bahiensis, and their transferability to C. argentea indicate promising applications for the study of genetic diversity and structure, gene flow, and mating system in the species. These studies can be followed by comparative studies to understand the mechanisms involved in population divergence and speciation in this neotropical genus.
  4 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  IMEx: Imperfect Microsatellite Extractor.

Authors:  Suresh B Mudunuri; Hampapathalu A Nagarajaram
Journal:  Bioinformatics       Date:  2007-03-22       Impact factor: 6.937

3.  Mechanism of Trypanosoma cruzi death induced by Cratylia mollis seed lectin.

Authors:  M P Fernandes; N M Inada; M R Chiaratti; F F B Araújo; F V Meirelles; M T S Correia; L C B B Coelho; M J M Alves; F R Gadelha; A E Vercesi
Journal:  J Bioenerg Biomembr       Date:  2010-02-13       Impact factor: 2.945

4.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.