Literature DB >> 25202403

Detection of aberrant promoter methylation of RNF180, DAPK1 and SFRP2 in plasma DNA of patients with gastric cancer.

Xie Zhang1, Xuesong Zhang1, Beilei Sun1, Hongna Lu1, Danping Wang2, Xiaogang Yuan1, Zhigang Huang1.   

Abstract

Gastric cancer (GC) is one of the most frequently diagnosed malignancies in East Asia, particularly in China, and remains the second leading cause of cancer-associated mortality worldwide. However, no effective plasma biomarkers have been identified for the diagnosis of patients with GC. The aim of this study was to investigate the DNA methylation status of the ring finger protein 180 (RNF180), secreted frizzled-related protein 2 (SFRP2) and death-associated protein kinase 1 (DAPK1) genes in the plasma samples of 57 GC patients and 42 control individuals with no malignant disease, and to evaluate the clinical utility of these makers. A significantly higher level of methylation was observed in the plasma DNA of GC patients when compared with that of controls for the three genes investigated (RNF180, 57.89% vs. 23.81%; DAPK1, 49.12% vs. 28.57%; and SFRP2, 71.93% vs. 42.86%). No association was identified between the DAPK1 or SFRP2 methylation level in the plasma DNA and the clinicopathological parameters of patients. Notably, RNF180 methylation was found to positively correlate with tumor size (P=0.018), histological type (P=0.025), TNM stage (P=0.002), lymph node metastasis (P=0.008) and distant metastasis (P=0.018). Overall, 50 cancer patients (87.72%) exhibited methylation of at least one of the three markers, while 26 normal subjects presented methylation in plasma DNA [specificity, 38.1%; odds ratio (OR), 4.4]. The combined use of RNF180 and SFRP2 as methylation markers appeared to be the most preferable predictor with regard to predictive power and cost-performance (OR, 5.57; P=0.0002). The results of the present study indicate that aberrant promoter methylation of genes in the plasma may be detected in a substantial proportion of GC patients and thus, these genes must be evaluated in the screening and surveillance of GC.

Entities:  

Keywords:  DAPK1; RNF180; SFRP2; gastric cancer; hypermethylation; methylation-specific polymerase chain reaction

Year:  2014        PMID: 25202403      PMCID: PMC4156173          DOI: 10.3892/ol.2014.2410

Source DB:  PubMed          Journal:  Oncol Lett        ISSN: 1792-1074            Impact factor:   2.967


Introduction

Gastric cancer (GC) is one of the most frequently diagnosed malignancies in East Asia, particularly in China (1,2). Detection of the disease in the preclinical or pre-symptomatic phases is the key to successful treatment and patient outcome. In China, gastroscopy is increasingly used as a primary detection tool due to its diagnostic accuracy. However, less than half of eligible individuals (>50 years of age) undergo GC screening. Numerous patients are diagnosed at an advanced stage, leading to a high mortality rate of GC (3). The identification of more reliable and noninvasive screening tests may increase compliance with GC screening guidelines by individuals who are reluctant to undergo invasive tests, or when gastroscopy detection is not feasible or readily available. A number of studies have demonstrated that cancer patients exhibit significantly higher serum levels of tumor-specific DNA mutations, with >90% of the total circulating cell-free DNA (cfDNA) derived from malignant tissue, compared with those with non-malignant diseases (4–8). The mechanism of cfDNA release into the circulation is poorly understood; however, it is hypothesized that methylation of gene promoter regions is crucial for tumor carcinogenesis (6). These alterations have been shown to occur early in the development of cancer (9), suggesting that the detection of free methylated circulating DNA presents a promising approach for the development of plasma-based screening methods for non-invasive monitoring of GC progression. The aim of the present study was to evaluate the potential of using the promoter methylation status of a panel of apoptosis-related genes, including the ring finger protein 180 (RNF180) (10), death-associated protein kinase 1 (DAPK1) (11,12) and secreted frizzled-related protein 2 (SFRP2) (11,13) genes, in circulating plasma DNA for the detection of GC. The three genes included in this study were selected as they are known to be functional tumor suppressor genes in GC, and have previously been reported to be highly methylated in tumors and the serum/plasma of GC patients (11–15). The methylation-specific polymerase chain reaction (PCR) (MSP) technique was used to analyze the specificity and sensitivity of this method for GC detection and to evaluate the clinical diagnostic significance of these DNA methylation-based plasma markers.

Materials and methods

Patients and samples

A total of 42 controls and 57 GC patients diagnosed at Li Huili Hospital (Ningbo, China) between July 2011 and July 2012 were enrolled in this study. None of the enrolled patients had received preoperative chemotherapy or radiation therapy. This study was approved by the ethics committee of Li Huili Hospital (Ningbo, China) and informed consent was obtained from all participants. All patients were diagnosed with GC based on pathological and/or cytological evidence. The clinicopathological features are shown in Table I. Tumor stage was determined according to the tumor node metastasis (TNM) criteria of the Union for International Cancer Control/American Joint Committee on Cancer, 2010 (16). The plasma samples were acquired prior to treatment in the patient and control groups. The plasma samples were immediately isolated by centrifugation at 1,000 × g for 10 min and stored at −80°C until DNA was extracted.
Table I

Clinicopathological features and RNF180, DAPK1 and SFRP2 DNA methylation status in plasma samples of 57 patients with gastric cancer.

RNF180DAPK1SFRP2



ParametersnMUP-valueMUP-valueMUP-value
Gender0.1370.9280.446
 Male39201519202712
 Female1813999144
Age, years0.6270.9100.569
 <602413111212168
 ≥603320131617258
Tumor size, cm30.0180.7050.784
 <6239141211176
 ≥634241016182410
Histological type0.0250.9400.769
 Differentiated1441077104
 Undifferentiated43291421223112
TNM stage0.0020.6470.683
 I–II20614911155
 III–IV37271019182611
Lymph node metastasis0.0080.6720.660
 N0249151113186
 N1–33324917162310
Distant metastasis0.0180.9610.882
 M050262424263515
 M17704361

RNF180, ring finger protein 180; DAPK1, death-associated protein kinase 1; SFRP2, secreted frizzled-related protein 2; TNM, tumor node metastasis; M, methylated; U, unmethylated.

DNA extraction and bisulfite modification

A total of 400 μl DNA from each plasma sample was extracted using the QIAamp DNA Blood mini kit (Qiagen, Hilden, Germany)according to the manufacturer’s instructions. Plasma DNA was eluted in a total volume of 80 μl elution buffer (EB) and stored at −20°C. Sodium bisulfite modification was conducted using the Qiagen Epitect Plus DNA bisulfite kit (Qiagen), according to the manufacturer’s instructions. DNA was then resuspended in 30 μl EB and stored at −20°C.

MSP

Methylated and unmethylated primers specific for the promoter sequences of the target genes, RNF180, DAPK1 and SFRP2, were designed to amplify the bisulfite-modified DNA. The primer sequences used are shown in Table II. The 50-μl reaction mixture contained 2 μl of DNA template, 10 μl of KAPA2G buffer (Kapa Biosystems, Woburn, MA, USA), 1 μl of 10 mM dNTP mix (Kapa Biosystems), 1 μl of each primer at 50 mM, and 0.5 units of KAPA2GTM Robust Hotstart DNA polymerase (Kapa Biosystems).
Table II

Primer sequences and annealing temperatures used for the methylation-specific polymerase chain reaction.

PrimerSequence, 5′-3′Annealing temperature, °CProduct size, bpReference
RNF180 MFGGAGAAAAATTTTTTTACGGTTTC50109
RNF180 MRCACGTCTACGAATTCCCAC
RNF180 UFAGGGAGAAAAATTTTTTTATGGTTTT46109
RNF180 URCACATCTACAAATTCCCACCC
DAPK1 MFGGATAGTCGGATCGAGTTAACGTC5298(14)
DAPK1 MRCCCTCCCAAACGCCGA
DAPK1 UFGGAGGATAGTTGGATTGAGTTAATGTT56106
DAPK1 URCAAATCCCTCCCAAACACCAA
SFRP2 MFGGGTCGGAGTTTTTCGGAGTTGCGC58138(13)
SFRP2 MRCCGCTCTCTTCGCTAAATACGACTCG
SFRP2 UFTTTTGGGTTGGAGTTTTTTGGAGTTGTGT54145
SFRP2 URAACCCACTCTCTTCACTAAATACAACTCA

RNF180, ring finger protein 180; DAPK1, death-associated protein kinase 1; SFRP2, secreted frizzled-related protein 2; MF, methylated forward; MR, methylated reverse; UF, unmethylated forward, UR, unmethylated reverse; bp, base pair.

The conditions for amplification included a single cycle at 95°C for 5 min and a subsequent 10 cycles at 95°C for 30 sec, melting temperature 8°C (Tm; 0.8°C, descending by 0.8°C for each cycle) for 60 sec and 72°C for 30 sec; then 38 cycles at 95°C for 30 sec, Tm for 60 sec and 72°C for 30 sec; followed by a final extension step of 10 min at 72°C. The PCR products were then electrophoresed on a 2.5% agarose gel and visualized under ultraviolet illumination (ChemiDoc XRS; Bio-Rad, Hercules, CA, USA). Each experiment was repeated at least three times. The operator who performed all assays was blinded to all clinical information.

Statistical analysis

SPSS, version 13.0 (SPSS, Inc., Chicago, IL, USA) was used for all statistical analyses. The mean of variables was compared between two groups using Student’s t-test. The association between the methylation status of various genes and the clinicopathological characteristics of patients was evaluated using the χ2 test or the Fisher’s exact test. To estimate the predictive power of clinical and plasma markers for the presence of GC, multivariate logistic regression analyses were performed. Odds ratios (ORs) with 95% confidence intervals (CIs) were used as a measure of association. P<0.05 was considered to indicate a statistically significant difference.

Results

Patient characteristics

A total of 57 GC patients and 42 healthy controls donated blood within a 12-month time period prior to receiving any treatment. The mean age ± standard deviation of patients with GC was 61.49±12.02 years, while that of the controls was 57.21±8.45 years. The ratio of male to female patients was 39:18 in the cancer group and 27:15 in the control group. No significant differences in age and gender were identified between the two groups (data not shown). The clinicopathological characteristics of the 57 GC patients are shown in Table I.

Detection of aberrant RNF180, DAPK1 and SFRP2 promoter methylation in plasma

To determine whether the DNA methylation status of the RNF180, DAPK1 and SFRP2 genes in plasma samples had diagnostic value for GC, MSP analysis was used to investigate the frequency of DNA methylation of these genes in the plasma samples of 42 control and 57 GC patients. In the peripheral blood plasma, RNF180 methylation was detected in 57.89% (33/57) of GC patients, while methylation of this gene was observed in 23.81% (10/42) of noncancerous control patients (P=0.0007; Fig. 1). The methylation frequencies of DAPK1 were 49.12% (28/57) in GC patients and 28.57% (12/42) in noncancerous controls (P=0.0394; Fig. 1). Regarding SFRP2, methylation was detected in 71.93% (41/57) of GC patients and 42.86% (18/42) of control patients (P=0.0036; Fig. 1). Representative agarose gel electrophoresis results of the MSP for the three genes are shown in Fig. 2.
Figure 1

Frequency of detecting methylated DNA in the plasma of gastric cancer patients and controls. RNF180, ring finger protein 180; DAPK1, death-associated protein kinase 1; SFRP2, secreted frizzled-related protein 2.

Figure 2

Representative MSP results of RNF180, DAPK1 and SFRP2 aberrant methylation in (A) gastric cancer and (B) control patients. U, results obtained using unmethylated primers; M, results obtained using methylated primers; MSP, methylation-specific polymerase chain reaction; RNF180, ring finger protein 180; DAPK1, death-associated protein kinase 1; SFRP2, secreted frizzled-related protein 2.

Association between promoter methylation in plasma DNA and clinicopathological parameters of GC patients

The clinicopathological characteristics of the GC patients and the methylation status of RNF180, DAPK1 and SFRP2 are shown in Table I. No association between DAPK1 and SFRP2 methylation in the plasma DNA, and gender, age, tumor size, differentiation status, TNM stage, lymph node metastasis or distant metastasis were identified. However, the methylation levels of the RNF180 gene were found to positively correlate with tumor size (P=0.018), histological type (P=0.025), TNM stage (P=0.002), lymph node metastasis (P=0.008) and distant metastasis (P=0.018).

Comparison of the predictive power of RNF180, DAPK1 and SFRP2 methylation and their combination for GC detection

Multivariate regression analyses revealed a significant correlation between GC and RNF180 methylation (OR, 3.528; 95% CI, 0.542–0.861; P=0.007) and SFRP2 methylation (OR, 2.647; 95% CI, 1.080–6.487; P=0.033), but not for DAPK1 methylation (OR, 1.540; 95% CI, 0.610–3.890; P=0.361), in GC patients and controls (Table III).
Table III

Multivariate regression analysis for methylation in gastric cancer patients and controls.

Gene methylationOdds ratio (95% confidence interval)P-value
RNF1803.528 (0.542–0.861)0.007
DAPK11.540 (0.610–3.890)0.361
SFRP22.647 (1.080–6.487)0.033

RNF180, ring finger protein 180; DAPK1, death-associated protein kinase 1; SFRP2, secreted frizzled-related protein 2.

The ORs (95% CI) for predicting the presence of GC using the RNF180 (P=0.0007), DAPK1 (P=0.0394) and SFRP2 methylation statuses (P=0.0036) were 4.40 (1.82–10.65), 2.41 (1.03–5.63) and 3.42 (1.47–7.92), respectively (Table IV). Furthermore, if RNF180 and DAPK1 methylation were combined, the OR (95% CI) for cancer prediction [OR, 4.86 (2.03–11.66); P=0.0003] was similar to that of the RNF180 methylation [OR, 4.40 (1.82–10.65); P=0.0007] alone and to that of the methylation of the three genes combined [OR, 4.40 (1.61–12.03); P=0.0026]. When RNF180 and SFRP2 methylation were combined, the OR (95% CI) for cancer prediction [OR, 5.57 (2.13–14.57); P=0.0002] was superior to that for RNF180 methylation alone [OR, 4.40 (1.82–10.65); P=0.0007]; however, the specificity (47.62%) for cancer prediction was markedly lower than that of RNF180 methylation alone (76.19%).
Table IV

Comparison of the predictive powers for gastric cancer between RNF180, DAPK1 and SFRP2 methylation alone and in combination.

Gene methylationSensitivity, % (95% CI)Specificity, % (95% CI)Odds ratio (95% CI)P-value
RNF18057.89 (44.08–70.86)76.19 (60.55–87.95)4.40 (1.82–10.65)0.0007
DAPK149.12 (35.63–62.71)71.43 (55.42–84.28)2.41 (1.03–5.633)0.0394
SFRP271.93 (58.46–83.03)57.14 (40.96–72.28)3.42 (1.47–7.92)0.0036
RNF180 + DAPK176.79 (63.58–87.02)59.52 (43.28–74.37)4.86 (2.03–11.66)0.0003
RNF180 + SFRP285.96 (74.21–93.74)47.62 (32.00–63.58)5.57 (2.13–14.57)0.0002
DAPK1 + SFRP282.46 (70.09–91.25)42.86 (27.72–59.04)3.53 (1.41–8.81)0.0057
RNF180 + DAPK1 + SFRP287.72 (76.32–94.92)38.10 (23.57–54.36)4.40 (1.61–12.03)0.0026

RNF180, ring finger protein 180; DAPK1, death-associated protein kinase 1; SFRP2, secreted frizzled-related protein 2; CI, confidence interval.

Overall, the combination of RNF180 and SFRP2 methylation appeared to be the most effective predictor of GC, with regard to predictive power and cost-performance.

Discussion

Aberrant promoter methylation is the predominant mechanism which inactivates tumor-associated genes, particularly tumor suppressor genes, along with genetic silencing, which ultimately leads to gastric carcinogenesis. Numerous genes have been found to be methylated in GC, including hMLH1, p16, RUNX3, DAPK1, SFRP2 and RNF180. hMLH1 encodes DNA repair proteins and is closely associated with poor prognosis of GC patients; the frequency and specificity were found to be 8.6–80 and 4.1–80%, respectively (17–19). P16 inhibits cell cycle progression, and has been found to correlate with poor tumor differentiation, lymph node metastasis and poor survival. The frequency and specificity of P16 were found to be 30.4–44.2 and 76–100%, respectively (15,18,20). RUNX3 belongs to the RUNX family of transcriptional factors, and has been found to correlate with depth of tumor invasion, lymph node and distant metastasis. The frequency and specificity of RUNX3 were 56–75.2 and 92.6%, respectively (21–23). DAPK1 is a positive regulator of cell apoptosis, and has been found to correlate with poorly differentiated tumors and lymph node metastasis. The frequency and specificity of DAPK1 were 30.9–83.2 and 57.8–100%, respectively (12,15,24–26). No significant correlation has been identified between SFRP2, a candidate tumor-suppressor gene, and clinical outcomes. The frequency and specificity of SFRP2 were 80.0–90.0 and 31.0–73.3%, respectively (13,27). RNF180 is a novel potential tumor suppressor in GC; however, no correlation with clinical outcomes was identified. The frequency and specificity of RNF180 were 76% and 100%, respectively (10). However, our preliminary study revealed that the methylation of hMLH1, P16 and RUNX3 plasma biomarkers was extremely low in GC patients (data not shown). Of note, in the current study, the methylation levels of the apoptosis-related genes, RNF180, DAPK1 and SFRP2, were observed to be significantly higher in the plasma DNA of GC patients when compared with controls. The methylation of a core functional region of the promoter of RNF180, a novel ring finger-encoded product, has been suggested to significantly correlate with human GC development and pre-cancerous lesions. RNF180 acts as a potential tumor suppressor, exhibiting a critical role in the suppression of cell proliferation and induction of apoptosis (27). Cheung et al (10) demonstrated that methylation of RNF180 was detected in 56.25% (18/32) of plasma samples from cancer patients, whereas RNF180 methylation was not detected in the plasma of 64 normal controls. In the present study, the results revealed that the methylation of RNF180 was detected in 57.89% (33/57) of GC patient plasma samples and in 23.81% (10/42) of the controls. The frequency of RNF180 methylation was 23.81% (10/42) in controls. Although the specificity was lower, the GC patient population tested in the current study was larger than that of the previous report (10). Additionally, in the present study, the association of plasma DNA methylation of RNF180 in each sample with clinical outcomes was investigated. DAPK1 is a calcium/calmodulin-dependent serine/threonine protein kinase involved in apoptosis and tumor suppression (14,15). Reduced expression and aberrant methylation of DAPK1 has been reported in numerous human cancers, including GC (28,29). In previous studies, the sensitivity and specificity of predicting GC using the serum DNA methylation status of DAPK1 were found to be 48.1% (26/54) and 100% (0/30), respectively (12). However, in the present study, DAPK1 plasma methylation was detected in 49.12% (28/57) of GC patient, and in 28.57% (12/42) of the controls. Although the sensitivity was higher than previously reported, the specificity remained low. SFRP2 has been identified as a modulator of the Wnt signaling pathway, which is associated with multiple tumor types, including GC (13,31). Recent epigenetic studies have demonstrated that silencing of the SFRP2 by promoter methylation at CpG islands enhanced tumor growth and expansion in GC (13,32,33). Cheng et al (13) revealed that serum SFRP2 methylation was a potential biomarker for GC, as SFRP2 methylation was detected in a total of 66.7% (12/18) GC patients, however, no SFRP2 methylation was detected in the sera of 18 normal subjects. Similarly, in the current study, SFRP2 methylation was detected in 71.93% of GC patient plasma samples, however, the specificity of this single biomarker was relatively low (57.14%). Considering that aberrant DNA methylation of plasma exhibits a significant role in GC development and progression, the clinical significance of DNA methylation was investigated to evaluate the diagnostic power of the RNF180, DAPK1 and SFRP2 markers in plasma. Firstly, the association between the plasma DNA methylation status of RNF180 in each sample and clinical data was evaluated. Of note, tumor size (P=0.018), histological type (P=0.025), TNM stage (P=0.002), lymph node metastasis (P=0.008) and distant metastasis (P=0.018) were found to be significantly associated with RNF180 methylation, indicating that this epigenetic alteration may be a valuable marker for the prognosis of GC patients. However, no significant correlation was identified between DAPK1 and SFRP2 methylation in the plasma DNA and the clinicopathological characteristics evaluated, indicating that these epigenetic events are involved in the multistep process of gastric carcinogenesis, and may present potential biomarkers for early diagnosis in GC. Further studies may be required to characterize the source of cfDNA and the mechanisms involved in its release into the blood to provide an improved explanation for this observation. One strategy to improve GC diagnosis is to combine multiple methylation biomarkers in plasma that have potential clinical applications. In particular, the high specificity of RNF180 methylation is an attractive candidate as a marker for such a panel, which would exhibit increased sensitivity without major impacts on specificity. The combination of RNF180, DAPK1 and SFRP2 methylation in this study did increase sensitivity, but at a cost to specificity. Thus, a pilot study investigating the performance of RNF180 methylation in combination with SFRP2 was carried out. As expected, the combination of RNF180 and SFRP2 methylation exhibited a significantly higher OR and a marginal reduction in diagnostic sensitivity, as well as a higher specificity, when compared with the combination of RNF180, DAPK1 and SFRP2 methylation. Therefore, the combination of RNF180 and SFRP2 methylation may be optimal for GC diagnosis. In conclusion, using an MSP approach, RNF180 was identified as a novel plasma hypermethylated gene in GC. Although the functional effect of RNF180 methylation in GC was not identified, its high potential as a biomarker in plasma-based DNA testing was demonstrated. Furthermore, this study suggests that combining RNF180 and SFRP2 methylation may be particularly promising. The full potential of this marker or its combination with SFRP2 requires validation in a larger, well-controlled cohort study to verify its performance in detecting GC, and to investigate the potential clinical application for monitoring GC treatment and predicting responses to chemotherapy and radiotherapy.
  33 in total

1.  Aberrant DNA methylation of P16, MGMT, hMLH1 and hMSH2 genes in combination with the MTHFR C677T genetic polymorphism in gastric cancer.

Authors:  Hai-Lin Xiong; Xun-Qi Liu; Ai-Hua Sun; Ying He; Jun Li; Yuan Xia
Journal:  Asian Pac J Cancer Prev       Date:  2013

Review 2.  Cell-free nucleic acids as biomarkers in cancer patients.

Authors:  Heidi Schwarzenbach; Dave S B Hoon; Klaus Pantel
Journal:  Nat Rev Cancer       Date:  2011-05-12       Impact factor: 60.716

Review 3.  Emerging molecular biomarkers--blood-based strategies to detect and monitor cancer.

Authors:  Samir M Hanash; Christina S Baik; Olli Kallioniemi
Journal:  Nat Rev Clin Oncol       Date:  2011-03       Impact factor: 66.675

4.  Association between p16, hMLH1 and E-cadherin promoter hypermethylation and intake of local hot salted tea and sun-dried foods in Kashmiris with gastric tumors.

Authors:  Manzoor R Mir; Nadeem Shabir; Khursheed A Wani; Sheikh Shaff; Ishraq Hussain; Manzoor A Banday; Naveed A Chikan; S Bilal; Sheikh Aejaz
Journal:  Asian Pac J Cancer Prev       Date:  2012

5.  Characterization of the gene structure, functional significance, and clinical application of RNF180, a novel gene in gastric cancer.

Authors:  Kin-Fai Cheung; Cleo N Y Lam; Kaichun Wu; Enders K O Ng; Wilson W S Chong; Alfred S L Cheng; Ka-Fai To; Daiming Fan; Joseph J Y Sung; Jun Yu
Journal:  Cancer       Date:  2011-06-29       Impact factor: 6.860

Review 6.  The epigenomics of cancer.

Authors:  Peter A Jones; Stephen B Baylin
Journal:  Cell       Date:  2007-02-23       Impact factor: 41.582

Review 7.  Cell-free DNA in the circulation as a potential cancer biomarker.

Authors:  Corina Kohler; Zeinab Barekati; Ramin Radpour; Xiao Yan Zhong
Journal:  Anticancer Res       Date:  2011-08       Impact factor: 2.480

8.  DNA methylation profiles of gastric carcinoma characterized by quantitative DNA methylation analysis.

Authors:  Gyeong Hoon Kang; Sun Lee; Nam-Yun Cho; Tasha Gandamihardja; Tiffany I Long; Daniel J Weisenberger; Mihaela Campan; Peter W Laird
Journal:  Lab Invest       Date:  2007-12-24       Impact factor: 5.662

Review 9.  Alterations of tumor suppressor and tumor-related genes in the development and progression of gastric cancer.

Authors:  Gen Tamura
Journal:  World J Gastroenterol       Date:  2006-01-14       Impact factor: 5.742

10.  Frequent epigenetic inactivation of secreted frizzled-related protein 2 (SFRP2) by promoter methylation in human gastric cancer.

Authors:  Y Y Cheng; J Yu; Y P Wong; E P S Man; K F To; V X Jin; J Li; Q Tao; J J Y Sung; F K L Chan; W K Leung
Journal:  Br J Cancer       Date:  2007-09-11       Impact factor: 7.640

View more
  11 in total

Review 1.  How to stomach an epigenetic insult: the gastric cancer epigenome.

Authors:  Nisha Padmanabhan; Toshikazu Ushijima; Patrick Tan
Journal:  Nat Rev Gastroenterol Hepatol       Date:  2017-05-17       Impact factor: 46.802

Review 2.  Clinical effect of DAPK promoter methylation in gastric cancer: A systematic meta-analysis.

Authors:  Wenzhuo Jia; Tao Yu; Xianglong Cao; Qi An; Hua Yang
Journal:  Medicine (Baltimore)       Date:  2016-10       Impact factor: 1.889

3.  Promoter methylation of RNF180 is associated with H.pylori infection and serves as a marker for gastric cancer and atrophic gastritis.

Authors:  Fang Han; Li-Ping Sun; Shuang Liu; Qian Xu; Qiao-Yi Liang; Zhe Zhang; Hai-Chao Cao; Jun Yu; Dai-Ming Fan; Yong-Zhan Nie; Kai-Chun Wu; Yuan Yuan
Journal:  Oncotarget       Date:  2016-04-26

4.  Early detection of gastric cancer using global, genome-wide and IRF4, ELMO1, CLIP4 and MSC DNA methylation in endoscopic biopsies.

Authors:  Francesca Pirini; Sassan Noazin; Martha H Jahuira-Arias; Sebastian Rodriguez-Torres; Leah Friess; Christina Michailidi; Jaime Cok; Juan Combe; Gloria Vargas; William Prado; Ethan Soudry; Jimena Pérez; Tikki Yudin; Andrea Mancinelli; Helen Unger; Carmen Ili-Gangas; Priscilla Brebi-Mieville; Douglas E Berg; Masamichi Hayashi; David Sidransky; Robert H Gilman; Rafael Guerrero-Preston
Journal:  Oncotarget       Date:  2017-06-13

5.  DNA Methylation Profiling of Breast Cancer Cell Lines along the Epithelial Mesenchymal Spectrum-Implications for the Choice of Circulating Tumour DNA Methylation Markers.

Authors:  Anh Viet-Phuong Le; Marcin Szaumkessel; Tuan Zea Tan; Jean-Paul Thiery; Erik W Thompson; Alexander Dobrovic
Journal:  Int J Mol Sci       Date:  2018-08-28       Impact factor: 5.923

6.  The Silencing of SFRP2 Expression in ESCC Is Due to Methylation of the Gene Promoter.

Authors:  Qian Liu; Ya-Xing Zhou; Qiao-Xin Li; Miao Wu; Yu-Qing Ma
Journal:  Technol Cancer Res Treat       Date:  2019-01-01

7.  Cell-free DNA promoter hypermethylation in plasma as a predictive marker for survival of patients with pancreatic adenocarcinoma.

Authors:  Stine Dam Henriksen; Poul Henning Madsen; Anders Christian Larsen; Martin Berg Johansen; Inge Søkilde Pedersen; Henrik Krarup; Ole Thorlacius-Ussing
Journal:  Oncotarget       Date:  2017-09-30

8.  Promoter methylation of tumor-related genes as a potential biomarker using blood samples for gastric cancer detection.

Authors:  Jinfeng Wen; Tuo Zheng; Kefeng Hu; Chunxia Zhu; Lihua Guo; Guoliang Ye
Journal:  Oncotarget       Date:  2017-09-08

9.  Feasibility of Plasma-Methylated SFRP2 for Early Detection of Gastric Cancer.

Authors:  Jin Miao; Yi Liu; Guodong Zhao; Xiaoyu Liu; Yong Ma; Hui Li; Shiming Li; Yun Zhu; Shangmin Xiong; Minxue Zheng; Sujuan Fei
Journal:  Cancer Control       Date:  2020 Apr-Jun       Impact factor: 3.302

10.  Circulating methylated Septin 9 and ring finger protein 180 for noninvasive diagnosis of early gastric cancer.

Authors:  Chang-Qi Cao; Lin Chang; Qi Wu
Journal:  Transl Cancer Res       Date:  2020-11       Impact factor: 1.241

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.