Literature DB >> 25173977

Prostaglandin signalling regulates ciliogenesis by modulating intraflagellar transport.

Daqing Jin1, Terri T Ni2, Jianjian Sun1, Haiyan Wan2, Jeffrey D Amack3, Guangju Yu1, Jonathan Fleming4, Chin Chiang4, Wenyan Li1, Anna Papierniak5, Satish Cheepala6, Gwenaëlle Conseil7, Susan P C Cole7, Bin Zhou8, Iain A Drummond9, John D Schuetz6, Jarema Malicki5, Tao P Zhong10.   

Abstract

Cilia are microtubule-based organelles that mediate signal transduction in a variety of tissues. Despite their importance, the signalling cascades that regulate cilium formation remain incompletely understood. Here we report that prostaglandin signalling affects ciliogenesis by regulating anterograde intraflagellar transport (IFT). Zebrafish leakytail (lkt) mutants show ciliogenesis defects, and the lkt locus encodes an ATP-binding cassette transporter (ABCC4). We show that Lkt/ABCC4 localizes to the cell membrane and exports prostaglandin E2 (PGE2), a function that is abrogated by the Lkt/ABCC4(T804M) mutant. PGE2 synthesis enzyme cyclooxygenase-1 and its receptor, EP4, which localizes to the cilium and activates the cyclic-AMP-mediated signalling cascade, are required for cilium formation and elongation. Importantly, PGE2 signalling increases anterograde but not retrograde velocity of IFT and promotes ciliogenesis in mammalian cells. These findings lead us to propose that Lkt/ABCC4-mediated PGE2 signalling acts through a ciliary G-protein-coupled receptor, EP4, to upregulate cAMP synthesis and increase anterograde IFT, thereby promoting ciliogenesis.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25173977      PMCID: PMC4154319          DOI: 10.1038/ncb3029

Source DB:  PubMed          Journal:  Nat Cell Biol        ISSN: 1465-7392            Impact factor:   28.824


INTRODUCTION

In mammals, prostaglandins (PGs) regulate a wide variety of important physiological processes, including pain perception and body temperature, cardiovascular homeostasis, reproduction, and cancer progression[1, 2]. The prostaglandin precursor PGH2 is synthesized by COX-1 and COX-2 in the endoplasmic reticulum from arachidonic acid, a 20-carbon polyunsaturated fatty acid released from membrane phospholipids[1]. COX-1 serves a homeostatic function and is responsible for basal, constitutive prostaglandin synthesis, whereas COX-2 increases production of prostaglandins during inflammatory response and in cancer[1]. The PG precursor is metabolized by prostaglandin synthases to form structurally related, bioactive prostanoids in various tissues, including PGE2, PGD2, PGF2α PGI2 and Thromboxane A2 (TxA2)[1]. PGE2 functions through activation of G-protein-coupled receptors (GPCRs), including EP1 through EP4. Among them, EP2 and EP4 increase the intracellular cyclic adenosine monophosphate (cAMP) and activate protein kinase A (PKA) signaling[1, 3]. Although prostaglandins have important functions in a variety of physiological and pathological processes, their roles in ciliogenesis have not been previously investigated and remain virtually unknown. Cilia are formed and extended by IFT, which transports cargo proteins along microtubules from the base to the tip of the cilium and back to the cell body. This process is mediated by kinesins in the anterograde direction and by cytoplasmic dynein motor in the retrograde direction[4, 5]. Basal body proteins are also essential for cilia formation. They anchor the cilium at the cell surface, provide template for microtubules in the ciliary axoneme, and serve as a relay station for protein and lipid traffic from the Golgi complex to the ciliary membrane[6, 7]. Ciliary dysfunction causes multisystemic genetic disorders commonly known as human ciliopathies[5, 8]. Many developmental pathways have been shown to function in ciliogenesis[4, 5]. Fibroblast growth factor (FGF) signalling regulates cilia length and function through ciliogenic transcription factor Foxj1 in diverse epithelia[9]. In zebrafish Kupffer’s vesicle (KV), both Wnt/β-catenin and Notch pathway regulate Foxj1 expression and controls ciliogenesis[10, 11]. Components of the phosphatidylinositol signaling cascade also regulate cilia formation in zebrafish. This conclusion is based on observations that knockdown of inositol-pentakisphosphate 2-kinase (Ipk1) reduced cilia length and decreased the cilia beating frequency[12]. Our understanding of ciliogenesis regulation is, however, incomplete. Using zebrafish genetics and cultured human epithelial cells we reveal for the first time the roles of prostaglandin signaling in vertebrate ciliogenesis.

RESULTS

leakytail mutants display defective ciliogenesis

In the course of a zebrafish genetic screen for mutations that affect organogenesis, we identified the leakytail (lkt) mutant that displayed randomized heart looping (Fig. 1g–i), as well as cilia-associated phenotypes, including ventrally curved body axis (Fig. 1a, b), hydrocephalus (Fig. 1c, d), abnormal otolith number (Fig. 1e, f), and laterality defects of the brain and other organs (Supplementary Fig. S1a–d, g). Randomized expression of a nodal-related gene southpaw (spaw)[13] and a nodal target gene pitx2[13] occurred in the lateral plate mesoderm (Fig. 1v, w; Supplementary Fig. 1h). To test roles of lkt in ciliogenesis, we visualized cilia formation in developing embryos. At 24 hour post-fertilization (hpf), zebrafish otic vesicles (OVs) contain two clusters of long tether cilia and many short cilia distributed throughout OVs (Fig. 1j). In contrast to wild-type OVs (Fig. 1j), mutant OVs lacked short cilia but had relatively normal tether cilia (Fig. 1k). At 96 hpf, cristae kinocilia in ear semicircular canals were lost in lkt mutants (Fig. 1l, m). In Kupffer’s vesicle (KV), we observed cilia loss and length reduction in mutant embryos relative to wild-type (Fig. 1n, o; r, s). lkt mutants also exhibited a loss of ependymal cell cilia in the spinal canal (Fig. 1p, q). However, lkt mutants do not form kidney cysts (Fig. 1t, u), and the formation and growth of pronephric cilia are not affected in lkt mutants either (Supplementary Fig. 1e, f).
Figure 1

lkt mutants exhibit cilia loss and cilia-associated phenotypes

(a–f) Lateral views showing a ventrally curved body (b), hydrocephalus (red arrow) (d) and three otoliths (red arrows) (f) in lkt mutants compared to wild-type (wt) embryos at 72 hpf (a, c, e). (g–i) Cardiac-specific EGFP fluorescence displaying normal right-looped heart in wild-type (wt) Tg(cmlc2:EGFP) embryos in ventral view (g). Reversed left-looped heart is present in ~38% of lkt mutants (i), and right-looped heart in ~62% of lkt mutants (h) at 48 hpf. (j, k) Acetylated tubulin staining revealing two clusters of long tether cilia (arrows) and short cilia throughout the otic vesicle in wt embryos at 24 hpf (j). The absence of short cilia and relatively normal tether cilia are observed in the otic vesicle of lkt mutants (k). (l, m) Acetylated tubulin staining revealing kinocilla loss at the lateral crista of semicircular canals in lkt mutants (m) compared to normal kinocilia in wt embryos at 96 hpf (l). (n, o) Confocal microscopy images depicting KV cilia (red) and epithelial cells (green) immunostained with anti-acetylated tubulin and anti-αPKC antibodies, respectively, in wt (n), and lkt mutant embryos at 13 hpf (o). (p, q) Immunostaining of ependymal cell cilia in the spinal canal of wt (p) and in lkt mutants (q) at 48 hpf. (r, s) KV cilia length and number in wild-type embryos and lkt mutants. n = 3 independent experiments, in which 12 total wild-type embryos and 12 total lkt mutant embryos were visualized. Graph shows mean ± s.d.; Student’s t-test: **P <0.01, ***P <0.001. Data are pooled from 3 independent experiments. (t, u) Histological sections showing normal pronephric duct development (arrows) without cyst formation in lkt mutants compared to wild-type embryos. (v, w) spaw (v) and pitx2 (w) expression in LPM showed normal left-sided expression of these genes in wild-type embryos, whereas expression in lkt mutants was often randomized. Dotted line denotes the midline. L=left, R=right. Scale bar: 100 μm (a–i; t, u; v, w). 10 μm (j–q). Statistics source data for Fig. 1r, s can be found in Supplementary Table 2.

leakytail locus encodes the ABCC4 transporter

To determine the molecular underpinnings of lkt ciliopathy, we mapped lkt to chromosome 6 of the zebrafish genome using whole genome bulk segregant analyses (Fig. 2a)[14]. Subsequent fine mapping refined lkt genetic interval to a single bacterial artificial chromosomal clone (BAC) (Fig. 2a). One of four transcribed regions on this BAC encodes ABCC4 (Mrp4), a subfamily ‘C’ member of the ATP-binding cassette (ABC) superfamily of transport proteins (Fig. 2a, b)[15-17]. At the amino acid level, zebrafish Lkt/ABCC4 is 68.5% identical to the human ABCC4 transporter (Supplementary Fig. 2), with a high degree of conservation in transmembrane (TM) domains and nucleotide binding domains (NBD)[18] critical for normal ABC transporter function (Fig. 2b; Supplementary Fig. 2). Sequencing of abcc4 from lkt mutants identified a threonine to methionine substitution at position 804 (T804M) (Fig. 2b, c). This threonine localizes to the third cytoplasmic loop of the lkt polypeptide and is evolutionarily conserved from Drosophila to human (Fig. 2b, d). We next performed abcc4 knockdown and rescue experiments to verify that abcc4 was indeed the gene affected in lkt mutants. Injection of antisense abcc4 morpholinos (abcc4-MO) caused ciliogenesis defects and phenocopied lkt mutants (Supplementary Fig. 3a–h). abcc4 mRNA injection also rescued lkt mutant phenotypes (Supplementary Fig. 4a–i). Together, these findings lead us to conclude that the lkt locus encodes ABCC4 and that lkt is a loss of function allele.
Figure 2

Positional cloning identifies leakytail as the ABCC4 transporter.<

br>(a) An integrated genetic and physical map of the lkt genomic region. Arrowheads indicate recombinants. Red arrow: lkt mutation in exon17. The genomic interval covering the lkt mutation was defined by genotyping 1745 mutant embryos (3490 meioses). Z17212, Z6907, VU1, and VU2 are single strand length polymorphisms (SSLP). Single nucleotide polymorphisms (SNP): SNP1, SNP2. (b) Schematic diagram of the predicted Lkt/ABCC4 protein secondary structure. The lkt mutation resides within the third cytoplasmic loop connecting transmembrane domain 8 and 9. NBD: nucleotide binding domain. (c) Electropherograms of wild-type and lkt genomic DNA depicting a C-to-T substitution (arrow). (d) Alignment of lkt/abcc4 amino acid sequences across species. Red arrow: conserved threonine. TM8: transmembrane subunit 8.

Lkt/ABCC4 controls cilia-driven fluid flow in the Kupffer’s vesicle

To assess roles of lkt/abcc4 in ciliogenesis, we examined its expression during embryo development. lkt/abcc4 transcripts are maternally deposited in cleavage-stage embryos (Fig. 3a), then distributed throughout blastula embryos (Fig. 3b). During somitogenesis, lkt/abcc4 is expressed in neural crest cells, the notochord and KV (Fig. 3c, d). At 36–48 hpf, lkt/abcc4 transcripts are enriched in some of ciliated tissues, including olfactory placodes, otic vesicles, midbrain-hindbrain boundary area and the hindbrain (Fig. 3e–g). Furthermore, lkt/abcc4 expression coincides with insulin expression in the pancreas but not with wt1b in the kidney primordium (Supplementary Fig. 3i–n). This may explain why lkt mutants do not form kidney cysts (Fig. 1t, u).
Figure 3

lkt/abcc4 is expressed during embryonic development and regulates organ laterality in DFC/KV cells

(a, b) Whole mount RNA in situ hybridizations revealing ubiquitous lkt/abcc4 expression at the two-cell stage (a), and the 40%-epiboly stage (b). (c, d) At the 6-somite stage (12 hpf), lkt/abcc4 is expressed in neural crest cells (c; black arrows), the notochord (d; red arrowhead) and KV (d; red arrow). (e–g) From 36 hpf onwards, lkt/abcc4 expression was detected in the olfactory placodes (e and f; green arrows), branchial arches (eg; white arrows), midbrain-hindbrain boundary (e and f; red stars), hindbrain (e and f; brown arrow), pancreas (e; black arrowhead) and the otic vesicle (g; outlined by red circle). e: eye. (h–k) Fluorescent bead tracking in the KV revealed that wt embryos (h) and ctrl-MO injected embryos (j) exhibit strong directional fluid flow, whereas flow was either absent or reduced in lkt mutants (i) and lkt/abcc4 morphants (k). (l–o) spaw expression (arrows) in wt embryos, DFCctrl-MO, DFC-MO, and Yolk-MO mosaic embryos. (p) Percentages of embryos showing strong, reduced or absent KV flow. n = 2 independent experiments. Number of embryos analyzed: Wt=22; Control=19; lkt mutant=4; abcc4 morphant=14. Source data for Fig. 3p can be found in Supplementary Table 1. (q) Percentages of DFC-MO and control embryos (Wt, DFCctrl-MO or Yolk-MO) showing different spaw expression patterns. The percentage of embryos with LR defects is significantly higher in DFC-MO embryos than Wt, DFCctrl-MO or Yolk-MO embryos, but not statistically different among Wt, DFCctrl-MO or Yolk-MO embryos (Yates corrected Chi-square test, ***P < 0.0001, degree of freedom = 1; n = 3 independent experiments in which 104 wild-type embryos, 81 DFCctrl-MO injected embryos, 59 DFC injected embryo and 33 Yolk injected embryos were examined. Control-MO: standard fluorescein-MO. Statistics source data for Fig. 3q can be found in Supplementary Table 2.

Organ laterality in zebrafish is established by cilia-driven fluid flow in KV[19, 20]. Since lkt/abcc4 deficiency causes a loss of KV cilia (Fig. 1n, o, r, s; Supplementary Fig. 3c), we assessed the status of KV fluid flow in lkt/abcc4-deficient embryos. Fluorescent beads were injected into KV of lkt mutants and abcc4 morphants. While both wild-type and control embryos displayed strong directional flow in KV (Fig. 3h, j, p; Supplementary table 1, Supplementary video 1), lkt mutants or abcc4 morphants exhibited absent or reduced KV flow (Fig. 3i, k, p; Supplementary table 1; Supplementary video 2). Given that lkt/abcc4 is expressed in KV, we evaluated whether lkt regulates Nodal signaling autonomously in KV cells by depleting lkt/abcc4 expression in dorsal forerunner cells (DFCs), precursors of KV cells[21]. Thus, abcc4-MO was co-injected with standard fluorescein-MO into the yolk cell at the 1000-cell stage, when yolk-DFC bridges are open, allowing abcc4-MO diffusion into DFCs but not into other embryonic cells. The resulting DFC-MO mosaic embryos showed random spaw expression (Fig. 3n, q). In comparison, normally asymmetric expression of spaw was observed in uninjected wild-type embryos, as well as in embryos injected with control-MO (DFCctrl-MO embryos), or embryos injected with abcc4-MO when yolk-DFC bridges have closed, restricting the morpholinos to the yolk cell (Yolk-MO) (Fig. 3l, m, o, q). These findings indicate that Lkt/ABCC4 functions autonomously in DFC/KV cells to regulate ciliogenesis and organ laterality.

Lkt/ABCC4 transporter regulates ciliogenesis through PGE2 secretion

Mammalian ABCC4 has been shown to transport several physiological substrates such as prostaglandins, cyclic nucleotides, steroid conjugates and folates [15]. Among related ABCC subfamily members, only ABCC4 is known to directly transport PGE2[22]. We hypothesized that defective ciliogenesis in lkt/abcc4 mutants could be caused by diminished PGE2 export resulting in PGE2 signaling defects. To test this idea, we assessed whether addition of exogenous PGE2 could rescue cilia-associated phenotypes in lkt mutants. Mutant embryos were incubated in media supplemented with PGE2 or PGF2α. lkt mutants treated with PGE2 exhibited straight body axis, normal heart looping and otolith biogenesis (Fig. 4a, b; Supplementary Fig. 5a), while all mutants treated with PGF2α showed cilia-associated phenotypes (Supplementary Fig. 5a). We then assessed whether PGE2 treatment could reverse defective ciliogenesis in lkt mutants. In PGE2-treated lkt mutants, reduction of KV cilia number and length was partially reversed (Fig. 4c, d, i, j); restoration of kinocilia or spinal canal cilia was also evident (Fig. 4e–h). Together, these findings are consistent with the idea that PGE2 deficiency is responsible, at least in part, for ciliogenesis defects in lkt mutants.
Figure 4

Lkt/ABCC4 exports PGE2 and regulates ciliogenesis.<

br>(a, b) lkt mutants with PGE2 treatment (50 μM; 10–72 hpf) display straight body axes (b; n=34; 86% were rescued) compared to untreated lkt mutant embryos (a). (c, d) Acetylated tubulin staining showing rescued KV cilia in lkt mutants treated with PGE2 (d; 50 μM; 3–13 hpf; n=12; 75% were rescued) compared to those in untreated lkt mutants (c). (e, f) Kinocilia loss was partially reversed in lkt mutants treated with PGE2 (f; 50 μM; 24–96 hpf; n=12) compared to those in untreated lkt mutants (e). (g, h) PGE2 treatment rescued ependymal cilia loss (50 μM; 10–48 hpf; n=10) in lkt mutants (h) compared to those in untreated lkt mutants (g). Embryos with lkt genotypes but showing abundant cilia and straight axes were scored as rescued mutants. (i, j) Bar charts depicting statistical analyses of KV cilia number and length in wt embryos, lkt mutants or PGE2-treated lkt mutants Graph shows mean ± s.d.; Student’s t-test: **P <0.01, ***P <0.001. n = 3 independent experiments in which 12 wt embryos, 12 lkt mutants or 12 PGE2-treated lkt mutants were analyzed. (k) Lkt/ABCC4T804M transporter disrupts PGE2 export. Bar charts displaying percentages of intracellular and extracellular PGE2 in MEF cells transfected with empty vector, or vectors encoding human ABCC4 (huABCC4), zebrafish ABCC4 (zfABCC4), zebrafish mutant Lkt/ABCC4T804M (zfABCC4T804M) as indicated. huABCC4- and zfABCC4-transfected cells were also treated with MK571. n = 2 independent experiments. (l) ATP-dependent uptake of PGE2 in inside-out membrane vesicles prepared from HEK293T cells expressing zfABCC4 and control vectors. n = 2 independent experiments. (m–o) Immunostaining images revealing murine ABCC4 on the plasma cell membrane (green) but not in the cilium (red). (p–r) Zebrafish EGFP-ABCC4 protein fusion (EGFP-zfABCC4) was detected on the plasma cell membrane (green) but not in the cilium (red). (s–u) Zebrafish EGFP-ABCC4T804M mutant protein fusion (EGFP-zfABCC4T804M) was found in the cytoplasm (green) but not in the cilium (red). Green: EGFP fusions; Red: ARL13B in cilia; Blue: DAPI in nuclei. Scale bar: 1 mm (a, b); 10 μm (c–h); 10 μm (m–u). Statistics source data for Fig. 4i, j, k, l can be found in Supplementary Table 2.

To assess whether Lkt/ABCC4 exports PGE2, we performed PGE2 efflux assays using abcc4-deficient murine embryonic fibroblasts (MEF)[23] expressing human ABCC4, zebrafish Lkt/ABCC4 or mutant Lkt/ABCC4T804M. Transfection of human or zebrafish ABCC4 increased extracellular PGE2 and reduced intracellular PGE2, relative to vehicle-transfected cells (Fig. 4k). In contrast, cells expressing the Lkt/ABCC4T804M mutant were defective in PGE2 export (Fig. 4k). Addition of MK571, an inhibitor of ABCC4 transporter[15, 22], blocked ABCC4-mediated PGE2 export, mimicking the effect of the Lkt/ABCC4T804M mutation (Fig. 4k). These data reveal the molecular bases of Lkt/ABCC4 function, linking PGE2 export to ciliogenesis. To determine whether zfABCC4 directly exports PGE2 across the plasma membrane, we performed vesicular transport assays using inside-out membrane vesicles[22, 24]. The ATP-dependent PGE2 uptake levels were 3-fold greater in vesicles expressing ABCC4 than vesicles derived from untransfected controls (Fig. 4l). We next assessed the sub-cellular localization of mammalian ABCC4 and zebrafish Lkt/ABCC4. Although ABCC4 was reported to localize to the plasma cell membrane, its sub-cellular localization in ciliated cells was not examined[15]. We observed that murine ABCC4 localizes to the plasma cell membrane but not to the cilium in inner medullary collecting duct 3 (IMCD3), ciliated cells (Fig. 4m–o). We next transfected IMCD3 cells with constructs encoding zebrafish lkt/abcc4 or lkt/abcc4 mutant gene fused with EGFP. Similar to its mammalian counterpart, zebrafish Lkt/ABCC4 protein (EGFP-zfABCC4) was detected on the plasma cell membrane but not in the cilium (Fig. 4p–r). In contrast, Lkt/ABCC4T804M mutant protein (EGFP-zfABCC4T804M) was mis-localized in the cytoplasm in ciliated cells (Fig. 4s–u). Collectively, these findings demonstrate that zebrafish Lkt/ABCC4 has a strong activity in exporting PGE2, whereas the T804M mutation, likely due to its loss of normal membrane localization, is incapable of PGE2 export.

COX-EP4 signaling regulates Lkt/ABCC4-mediated ciliogenesis

PGE2 is synthesized by COX-1 and COX-2, and after secretion from the cell, it binds and signals through G-protein-coupled receptors EP1–4[1, 3]. Knowing that cox1, cox2 and ep4 are expressed during zebrafish development[25-28], where cox1 is expressed in the gastrula and cox2 is detected in the anterior neuroectoderm[25], we assessed whether embryos deficient in PGE2 signaling exhibit ciliogenesis defects. Microinjection of cox1-MO[25, 27] into wild-type embryos at low doses caused cilia-associated phenotypes, including hydrocephalus, randomized heart looping, abnormal otolith number and curved body axis (Fig. 5a–c, g–h; Supplementary Fig. 5h, i), whereas cox2-MO[25, 27] injection resulted in hydrocephalus, abnormal otoliths and curved body axis, but did not affect heart looping (Fig. 5g, h; Supplementary Fig. 5b, c; h, i). DFC/KV-targeted injection of cox1-MO but not cox2-MO caused a decrease in KV cilia number and length (Fig. 5i, j; u, v). These findings are consistent with the expression patterns of cox1 and cox2 during zebrafish development[25]. Embryos injected with both cox1-MO and cox2-MO displayed even more severe cilia-related abnormalities (Fig. 5g; Supplementary Fig. 5h, i). lkt heterozygous embryos and wild-type homozygous embryos injected with cox1-MO or ep4-MO display comparable percentages of cilia-associated phenotypes (Supplementary Fig. 6a, b), indicating that a partial loss of lkt/abcc4 function does not sensitize the embryo to the reduction of PGE2 signaling. Finally, microinjections of either cox1-MO or cox2-MO at low doses caused cilia loss in ears and the spinal canal (Fig. 5o–q; Supplementary Fig. 5d, e, f). These cilia defects and malformations are partially rescued by the PGE2 addition (Fig. 5k, r, g, h, u, v; Supplementary Fig. 5h, i). Thus, PGE2 synthesis is required for normal ciliary development.
Figure 5

COX-EP4 signaling pathway is required for ciliogenesis.<

br>(a–c) Embryos injected with cox1-MO (8 ng) exhibited a curved body axis, hydrocephalus (a; arrow), reverse-looped heart (b) and three otoliths (c; arrows). (d–f) ep4-MO-injected embryos (1 ng) featured a curved body axis, hydrocephalus (d; arrow), a reversed looped-heart and three otoliths (f; arrows). (g–h) Percentages of embryos with phenotypes grouped in hydrocephalus (g) and LR randomization (h). PGE2 treatment (50 μM) of cox1/2 morphants and cox1 morphants partially rescued hydrocephalus (10–72 hpf) and LR randomization (3–24 hpf). Treating ep4 morphants with forskolin (FSK; 50 μM) but not PGE2 rescued hydrocephalus and LR randomization. Ctrl: Ctrl-MO-injected embryos. The total numbers of embryos pooled from n = 3 independent experiments are indicated on the top of each bar. Yates corrected Chi-square test, ***P < 0.0001, degree of freedom =1. NS: Not significant. (i–k) Acetylated tubulin staining revealed normal KV cilia in DFCctrl-MO embryos (i), cilia loss in DFC-MO embryos (j) (8 ng; n=12), and restored cilia in PGE2-treated DFC-MO embryos (k) (50 μM; 3–13 hpf; n=12). (l, m) KV cilia loss in DFC-MO embryos (1 ng; n=11), PGE2-treated DFC-MO embryos (50 μM; 3–13 hpf; n=13). (n) Rescued KV cilia loss in DFC-MO embryos treated with FSK (50 μM; 3–13 hpf; n=11). (o–q) Kinocilia loss in embryos injected with cox1-MO (8 ng; n=15) (p) or cox2-MO (q) (8 ng; n=18), compared with controls (o). (r) PGE2 treatment rescued cox1/2-morphants (50 μM; 24–96 hpf; n=12). (s) ep4-MO-injected embryos (1 ng) exhibited kinocilia loss (s) (n=14); (t) FSK treatment rescued kinocilia loss in ep4 morphants (50 μM; 24–96 hpf; n=10). (u, v) Quantification of KV cilia number and length in DFCctrl-MO, DFC-MO, DFC-MO, PGE2–treated DFC-MO embryos, and in DFCctrl-MO, DFC-MO, PGE2–treated DFC-MO, FSK-treated DFC-MO embryos. Error bar shows mean ± s.d.; Student’s t-test: **P < 0.01, ***P < 0.001. NS: Not significant (P > 0.05). n = 3 independent experiments in which 12 DFCctrl-MO, 12 DFC-MO, 12 DFC-MO, 12 PGE2–treated DFC-MO embryos (left bar graphs), and 12 DFCctrl-MO, 11 DFC-MO, 13 PGE2–treated DFC-MO and 11 FSK-treated DFC-MO embryos (right bar graphs) were analyzed. Scale bar: 100 μm (a–f); 10 μm (i–t). Statistics source data for Fig. 5g, h, u, v can be found in Supplementary Table 2.

To evaluate whether EP4 acts as a receptor of Lkt/ABCC4-mediated PGE2 signaling during ciliogenesis, we performed EP4 knockdown experiments. Injection of ep4-MO[25, 27] targeting DFC/KV cells caused cilia loss and length reduction in KV (Fig. 5i, l; u, v), whereas injection of ep4-MO (1 ng) into one-cell embryos caused loss of kinocilia in ears and the spinal canal (Fig. 5o, s; Supplementary Fig. 5g), resulting in multiple organ defects similar to lkt mutants (Fig. 5d–f, g, h; Supplementary Fig. 5h, i). PGE2 addition failed to reverse cilia loss or organ malformation in ep4-deficient embryos (Fig. 5l, m, g, h, u, v; Supplementary Fig. 5h, i), indicating that EP4 acts downstream of secreted PGE2 required for ciliogenesis. Furthermore, co-injection of cox1 mRNA, cox2 mRNA and ep4 mRNA with cox1-MO, cox2-MO and ep4-MO, respectively, suppressed hydrocephalus, indicating the functional specificity of cox1-MO, cox2-MO and ep4-MO (Supplementary Fig. 4j). EP4 is a GPCR that activates Gs to increase the intracellular cAMP[3], which, in turn, activates PKA and promote ciliogenesis[29]. Addition of forskolin (FSK), an activator of adenylate cyclase, suppressed partially cilia loss in KV and ears (Fig. 5l, n; s, t; u, v), and reversed organ malformation in ep4-morphants (Fig. 5g, h; Supplementary Fig. 5h, i). The expression of transcription factors Foxj1a and Foxj1b, which are required for cilia biosynthesis[30, 31], is not altered in lkt mutants, cox1/cox2 morphants or ep4 morphants (Supplementary Fig. 6c–n), suggesting that COX-Lkt/ABCC4-EP4 signaling functions downstream or in parallel to their function by activating cAMP signaling in promoting ciliogenesis. We next assessed roles of PGE2 signaling in ciliogenesis using pharmacological approaches. Administration of wild-type embryos with SC560 (Cox1 inhibitor), AH23848 (Ep4 inhibitor) or indomethacin (Cox1 and Cox2 inhibitor) at relevant time frames resulted in cilia-associated phenotypes (Fig. 6a–d) and cilia defects in ears and KV (Fig. 6e–g; h–i), similar to these seen in embryos injected with cox1-MO, ep4-MO, or both cox1-MO and cox2-MO. In contrast to that, administration of Cox2 inhibitor NS398 only caused hydrocephalus and three otoliths but not randomized heart laterality and KV cilia reduction (Fig. 6a–d; h, i), thus phenocopying cox-2 morphants. Moreover, Indomethacin treatment in lkt mutants exacerbated ciliogenesis defects in KV and ears (Fig. 6j–q). These findings complement our antisense knockdown studies and refine our understanding of time frames when PGE2 singling functions in ciliogenesis.
Figure 6

Inhibition of the COX-EP4 signaling pathway using pharmacological agents leads to ciliogenesis defects.<

br>(a) A diagram depicting the timeframe of pharmacological treatment for SC560 (125 uM, Cox1 inhibitor,), NS398 (125 uM, Cox2 inhibitor), Indomethacin (150 uM, Cox1 + Cox2 inhibitor), AH23848 (10 uM, Ep4 inhibitor). The resulting phenotypes are listed to the right: LR: Left-right randomization (3–24 hpf for SC560, H238480; 10–24 hpf for AH23848). HP: Hydrocephalus (10–48 hpf). OD: Otolith defect (10–36 hpf). (b–d) Bar charts displaying percentages of embryos with cilia-associated phenotypes following chemical treatments. Left-right randomization (b), Hydrocephalus (c) and otolith defects (d) are shown. Control: DMSO (0.1%)-treated embryos. The total numbers of embryos pooled from n = 3 independent experiments are indicated on the top of each bar. Yates corrected Chi-square test, ***P < 0.0001, degree of freedom = 1. NS: Not significant. (e–g) Acetylated tubulin immunostaining showing kinocilia loss in Indomethacin- (150 uM; 10–48 hpf; n=12) and AH23848-treated (10 uM; 10–48 hpf; n=15) embryos at 96 hpf, compared with DMSO-treated embryos. (h, i) Bar graphs depicting KV cilia length and number in embryos treated with SC560 (100 uM), NS398 (100 uM), Indomethacin (150 uM) and AH23848 (10 uM) compared with 0.1% DMSO-treated controls from 3 to 13 hpf. Error bar represents mean ± s.d.; Student’s t-test: *P <0. 01. NS: Not significant. n = 3 independent experiments in which 12 DMSO- treated, 12 SC560-treated, 9 NS398-treated, 10 indomethacin-treated and 12 AH23848-treated embryos were analyzed. (i-l) Acetylated tubulin staining reveals reduction of KV cilia in lkt mutants treated with Indomethacin (150 uM; 3–14 hpf; n=10) compared to DMSO-treated lkt mutants (0.1%; 3–14 hpf; n=12) and wild-type embryos. (m–o) Acetylated tubulin staining reveals kinocilia loss in lkt mutants treated with Indomethacin (150 uM; n=12; 10–48 hpf) compared with DMSO-treated lkt mutants (0.1%; n=12;10–48 hpf) and wild-type embryos at 96 hpf. (p, q) Quantification of KV cilia length and number in DMSO-treated wild-type embryos, DMSO-treated lkt mutants, Indomethacin-treated lkt mutants. Student’s t-test: ***P <0.001; Error bar represents mean ± s.d.; n = 3 independent experiments in which 12 DMSO-treated WT embryos, 12 DMSO-treated lkt mutants and 10 Indomethacin-treated lkt mutants were analyzed. Scale bar: 10 μm (e–g; j–l; m–o). Statistics source data for Fig. 6b–d; h, I; p, q can be found in Supplementary Table 2.

Lkt/ABCC4 function in ciliogenesis is conserved in mammalian cells

To assess roles of Lkt/ABCC4-mediated PGE2 signaling in ciliogenesis in mammalian cells, we depleted ABCC4 or EP4 in human retinal pigment epithelial 1 (hRPE1) cells using short-interfering RNA (siRNA)[32]. Immunoblotting confirmed that both ABCC4 and EP4 protein levels were significantly reduced in cells transfected with ABCC4-siRNA or EP4-siRNA (Fig. 7e, f). We observed that depletion of ABCC4 or EP4 in hRPE1 cells caused a reduction of ciliaformation and elongation when compared with use of the control siRNA (Fig. 7a, b, c). Bothcilia length and percentages of ciliated cells were significantly reduced in ABCC4 or EP4 depleted cells (Fig. 7g. h). Addition of exogenous PGE2 increased both cilia length and percentages of ciliated cells in control cells but not in EP4-depleted cells (Fig. 7a, d; g, h), indicating that EP4 acts downstream of PGE2 signaling during ciliogenesis. Moreover, depletion of ABCC4 or EP4 in IMCD3 cells resulted in similar results to those in hRPE1 cells (Supplementary Fig. 8a–h). We next assessed the sub-cellular localization of human EP4. EP4 staining in the plasma cell membrane has been described previously[33]. We observed that EP4 localizes to the cilium and is enriched in the perciliary cell membranę in hRPE1 cells (Fig. 7i–k). Similar ciliary localization of EP4 was also seen in IMCD3 cells (Fig. 7l). Consistent with the plasma membrane localization of murine and zebrafish Lkt/ABCC4 transporters (Fig. 4m–r), human ABCC4 also localizes to the plasma membrane but not to the cilium (Fig. 7m, n), whereas EP4 is detected on the cilum in the same hRPE cell (Fig. 7m, n). Collectively, these findings suggest that PGE2 released by ABCC4 binds and signals through the EP4 receptor in the cilium.
Figure 7

Lkt/ABCC4-mediated PGE2 signaling promotes ciliogenesis in mammalian cells

(a–d) Immunostaining analyses showing individual cilia in hRPE1 cells treated with control siRNA (100 nM), ABCC4 siRNA (100 nM), EP4 siRNA (100 nM) or PGE2 (10 μM; 12 h). Insets reveal high-magnification images of cilia (red arrows). Green: ARL13B for cilium; Red: γ-tubulin for centrosome; Blue: DAPI; Arrow: cilium. (e, f) Immunoblot analysis showing ABCC4 or EP4 protein levels in hRPE1 cells transfected with control siRNA, ABCC4 siRNA or EP4 siRNA. (g, h) Statistical analyses of average length of cilia and percentages of ciliated cells in hRPE1 cells transfected with control siRNA (357), ABCC4 siRNA (541), EP4 siRNA (479), EP4 siRNA plus PGE2 treatment (352), or control siRNA plus PGE2 treatment (313). Cell numbers (provided in parentheses) for each experiment are pooled from n= 3 independent experiments. Error bar represents mean ± s.d.; Student’s t-test: **P < 0.01, ***P < 0.001. (i–k) Immunostaining for EP4 (i), ARL13B (j) or the co-localization of EP4 with ARL13B in the cilium (k) in hRPE1 cells. (l) Localization of EP4 in the cilium in IMCD3 cells. (m–n) EP4 localizes to the cilium, whereas ABCC4 localizes on the plasma membrane in the same hRPE1 cell. Insets show high-magnification images of cilia (red arrows). Green: EP4; Red: ARL13B; Blue: DAPI or ABCC4 (i–l) or ABCC4 (m–n); Arrow: cilium. Scale bar: 10 μm (a–d; i–l); 15 μm (m, n). Statistics source data for Fig. 7g, h can be found in Supplementary Table 2.

PGE2 signaling affects anterograde velocity of IFT during ciliogenesis

cAMP signaling is known to promote ciliogenesis by increasing anterograde IFT[29]. Given that PGE2 acts upstream of cAMP signaling, we assessed the possibility that Lkt/ABCC4-mediated PGE2 signaling regulates ciliogenesis via the control of IFT. To test this idea, we imaged the movement of IFT particles in IMCD3 cells stably expressing IFT88-EYFP using time-lapse microscopy[34]. As expected, we observed that IFT particles are transported along axonemal microtubules from the ciliary base to the tip of the cilium (Fig. 8a). To determine velocities of individual IFT88 particles, the time-lapse image sequences were converted into kymographs (Fig. 8b–d). We observed that similar to FSK treatment[29], PGE2 increased anterograde velocities of IFT88 particles but had no obvious effects on retrograde velocities (Fig. 8g; Supplementary Fig. 7). Moreover, PGE2-treated cells displayed more intense fluorescence at the cilium tip revealing accumulation of IFT88 particles (Fig. 8e, f). Furthermore, we found that PGE2 treatment partially rescues cilia defect in oval/ift88 mutants (Fig. 8h, i, l, n). A rescue is not observed however for elipsa/ift54 at this stage (Fig. 8j, k, m, n). This is most likely due to the fact that elipsa/ift54 phenotype is more severe, compared to that seen in oval/ift88[7, 35]. These observations are consistent with the increased IFT velocity and efficiency in PGE2-treated cells. Hence, PGE2 signaling increases the anterograde speed of IFT, thereby accelerating the movement of cargos into the axoneme and resulting in enhanced ciliogenesis.
Figure 8

PGE2 signaling increases anterograde velocity of IFT

(a) Time-lapse images illustrating changes in the positions of IFT88-EYFP particles along the ciliary axoneme. White arrow: particle position. Red arrowhead: cilium tip. White arrowhead: Basal body. (b–d) Time- lapse images were assembled into kymographs. Red and white dotted lines indicate anterograde and retrograde transport, respectively. Distance scale bar (horizontal): 4 μm. Time scale bar (vertical): 10 sec. (e, f) The accumulation of fluorescent IFT88 was observed at cilia tips in PGE2-treated cells (f) compared to control cells (e). Arrow: cilium tip. (g) Bar graph depicting IFT velocities. Sample sizes for the measurements of the anterograde and reterograde velocities of individual IFT88-EYFP particles are as follows: 55 anterograde and 52 retrograde particles for control cells; 51 anterograde and 53 retrograde particles for PGE2-treated cells; 38 anterograde and 35 retrograde particles for FSK-treated cells. Student’s t-test, mean ± s.d. < 0.01. n = 5 independent experiments. (h–k) Acetylated tubulin staining of cilia (arrows) at 3 dpf in the anterior macula of oval/ift88 (h, i) and elipsa/ift54 (j, k) mutants subjected to PGE2 (50–70 uM PGE2; 24 to 72 hpf) or control (0.01% DMSO) treatments as indicated. (l–n) Scatter diagram displays individual cilium length in the anterior macula of PGE2- and DMSO-treated oval/ift88 mutants (l), as well as PGE2- and DMSO-treated elipsa/ift54 embryos (m). Cilia from PGE2-treated oval/ift88 embryos (80), DMSO-treated oval/ift88 embryos (63), PGE2-treated elipsa/ift54 embryos (42) and DMSO-treated elipsa/ift54 embryos (33) were analyzed. The results were subjected to Mann-Whitney U Tests (*P < 0.05; total number of embryos pooled from n = 3 independent experiments presented in parentheses), and presented as boxplots (n). (o) A model of prostaglandin signaling in ciliogenesis. PGE2 is synthesized by COX1 and COX2 and exported via the Lkt/ABCC4 transporter on the cell membrane. Released PGE2 binds to the EP4 receptor on the cilium, resulting in the activation of Gs and adenylate cyclase to increase cAMP, thereby increasing the anterograde IFT and enhancing ciliogenesis. Scale bar: 5 μm (a, e, f); 10 μm (h–k). Statistics source data for Fig. 8n can be found in Supplementary Table 2. Uncropped images of the immunoblots are shown in Supplementary Figure 9.

DISCUSSION

In this study, we demonstrate that normal cilia formation and elongation require the COX-Lkt/ABCC4-EP4 signaling cascade. While ABCC4 has the ability to transport a variety of physiological metabolites[15], the current study reveals a crucial and unexpected role for Lkt/ABCC4-mediated PGE2 export in ciliogenesis. cAMP-dependent kinase signaling is known to increase anterograde IFT during ciliogenesis[29]. Our data suggest that Lkt/ABCC4-mediated PGE2 signaling affects cAMP level and promotes ciliogenesis via an increase in the anterograde velocity of IFT. These results reveal a conserved ciliogenic cascade. A model is proposed where PGE2 is exported from cells via Lkt/ABCC4 on the plasma cell membrane and signals through the EP4 receptor on the cilium or at the base of the cilium, thereby activating Gs and cAMP signaling to promote the anterograde IFT (Fig. 8o). In support of this model, we found that PGE2 treatment causes an increase of intracellular cAMP but not Ca2+ during ciliogenesis in IMCD3 cells (Supplementary Fig. 8i, j), which is consistent with PGE2 studies in other cells and tissues[36, 37]. Furthermore, adenylate cyclase is detected in the cilium[38]. Cilia formation requires coordinated regulation of the bidirectional IFT particle traffic, including its frequency and speed[39, 40]. The dynamic modulation of IFT velocity by COX-Lkt/ABCC4-EP4 signaling represents a key regulatory step in axoneme formation and elongation. PGE2 is derived from the prostaglandin precursor, PGH2, which is biosynthesized by COX1 and COX2 enzymes from arachidonic acid, a 20-carbon polyunsaturated fatty acid[1, 41]. We propose that after being exported from cells, PGE2 acts in an autocrine and/or paracrine manner, as it is known that cells can respond to PGE2 released by either themselves or by their neighbors[42]. In human cancer cells, interaction of PGE2 with EP4 receptor induces Wnt/β-catenin signaling resulting in COX2 expression, thereby setting up a positive feedback loop leading to further PGE2 synthesis[42]. Such positive feedback loop in PGE2 autocrine signaling mechanism may enable cells in the epithelial field of the KV or the otic vesicle to rapidly upregulate ciliogenesis[43]. This effect may be further enhanced by paracrine PGE2 signaling between neighboring cells. The interplay between PGE2 autocrine and paracrine signaling may create a community effect, whereby all cells in the epithelial field are coherently activated to generate cilia and ciliary motility. Although PGE2 is implicated in influencing the ciliary beat frequency of cultured nasal mucosa cells[44], the role of PGE2 signaling in cilia formation was not reported in previous murine genetic studies[45-47]. This is most likely due to the presence of maternal contribution of prostaglandins in the placenta, which allows PGE2-deficient mouse embryos to develop normally[48]. The use of externally developing zebrafish embryos allowed us to reveal the ciliogenenic roles of PGE2 signaling. In agreement with animal model studies, cultured mammalian cells deficient in PGE2 signaling also display defective ciliogenesis. Given the role of cilia dysfunction in human disorders[49, 50], our findings suggest the existence of a previously unexplored aspect of human ciliopathies arising from abnormal prostagladin signaling.

Methods

Zebrafish maintenance

Zebrafish (Danio rerio, AB line) care and breeding were described previously[1]. Embryos were staged according to their morphology[51]. lkt mutants were isolated from a large-scale N-ethyl-N-nitrosourea (ENU) mutagenesis (Boston screen 2000)[52]. Fudan Animal Care Committee advises animal care and research.

Genetic mapping and positional cloning of lkt

Genetic mapping, whole genome bulk segregant analyses and positional cloning of lkt were conducted as previously described[14]. The genomic region covering the lkt interval was defined by genotyping 1745 mutant embryos (3490 meioses) using single strand length polymorphism (SSLP) markers Z17212 and Z6907. Additional SSLP markers VU1 (F: 5′-CAATGCCAATCAGCTCCATA; R: 5′-AGCAACGACGCTACCAAAAA) and VU2 (F: 5′-GGGTGAGGAGGCTTTTTGTC; R: 5′-AGATGATTGCTTCCAGCACA) were generated using genomic sequence (http://www.ensembl.org/Danio_rerio/index.html) between Z17212 and Z6907. BAC241A1 was identified in the sequence contig flanked by Z17212 and Z6907. Several single nucleotide polymorphism (SNP) markers were generated by sequencing intron regions and 3′-UTR in abcc4, including SNP1 (F: 5′-TAGCCTGGAAGTGCCTGATGT; R: 5′-ATGAGAATTAGTTGGCATGTAG) and SNP2 (F: 5′-GTGTTTGTGGTATTCTGAAGG; R: 5′-AGTCCGGACTGCTGAAGCTC). Total RNAs were extracted using Trizol (Invitrogen) from wild-type (Wt) and lkt mutant embryos. Eight independent clones from mutant and Wt embryos were subjected to sequencing analyses. A 4.5 kb PCR product of lkt from Wt embryos was amplified using primers abcc-Sac and abcc-Eco (abcc-Sac: 5′-ACTGCCGCGGATGGAGCCGATAAAGAAAGATGC; abcc-Eco: 5′-ACTGGATATCAACGGTCTTAATTGCTG) and subcloned into expression vector pcGlobinII by EcoRV/SacII. Four base changes were detected between Wt and lkt mutants. Through sequencing the genomic regions in multiple Wt strains, including EK, TL and AB, and lkt mutants, three of these changes (S691L, V719L and T1301A) were determined to be polymorphisms, and one change at amino acid 804 from ACG to ATG was determined to be a genuine lkt mutation.

In situ hybridization and immunofluorescence analysis

Single label whole-mount in situ hybridization and immunofluorescent staining were described previously[53]. To generate lkt/abcc4 (GenBank: EU586042.1) in situ probes, a 1.8 kb lkt fragment was amplified from pcGlobin-lkt plasmid by primers abcc-F5 and abcc-Eco (abcc-F5: 5′-TTCATTCAGGTGTTTCTGCA; abcc-Eco: 5′-ACTGGATATCAACGGTCTTA ATTGCTG) and subcloned into pCRII-TOPO vector (Invitrogen). lkt antisense probes were synthesized with SP6 RNA polymerase (Roche) using HindIII linearized pCRII-TOPO-lkt constructs. Double in situ hybridization was conducted as described[54]. The embryos were hybridized simultaneously with digoxigenin-labeled lkt/abcc4 antisense probes and fluorescein-labeled insulin or wt1b antisense probes, then incubated with anti-digoxigenin conjugated to alkaline phosphatase Fab fragments (Roche) and detected by NBT/BCIP (Roche). To inactivate anti-digoxigenin alkaline phosphatase antibodies, embryos were fixed in 4% paraformaldehyde and incubated in 10 mM EDTA in MABT (maleic acid buffer containing Tween 20) for 10 minutes at 70°C. Following rehydration, embryos were incubated with anti-fluorescent alkaline phosphatase Fab fragments (Roche) and were visualized with INT/BCIP (Roche). Cilia immunofluorescence in KV, ears, spinal cord or otic vesicles was performed using anti-acetylated tubulin monoclonal antibody[20] (1:200; Sigma, T6793). KV cilia were visualized by double immunofluorescence using anti-acetylated tubulin antibody, anti-αPKC rabbit antibody[9] (1:100; Santa Cruz Biotechnology, sc-216). Secondary antibodies include Alexa Fluor 555 goat anti-mouse IgG (H+L) (1:1000; Life Technologies, A21434) and Alexa Fluor 488 goat anti-rabbit IgG (H+L) (1:1000; Life Technologies, A11008). Stained embryos were mounted in 1% low melting agarose and imaged using a 63×water-dipping objective on a Zeiss LSM710 Laser Scanning Confocal Microscope.

Antisense morpholinos, mRNAs design and injection

Antisense morpholinos were designed and synthesized by Gene Tools, LLC. lkt/abcc4-MO (5′-CATTAGGACTGACCTTTCCAGCTCC) targets the donor site of intron10. Control morpholinos (Ctrl-lkt/abcc4-MO) contains 5 mismatched nucleotides, which are underlined in lkt/abcc4-MO (5′-CATTACGACTGAGCATAGCAGCTCC). cox1-MO (5′-TCAGCAAAAAGTTACACTCTCTCAT), cox2-MO (5′-GCTGTTGAAGCAGAGATGCGTTACT) and ep4-MO (5′–CACGGTGGGCTCCATGCTGCTGCTG) were designed as previously described (ref.25, 27). MO injections were conducted as described to generate whole embryo knockdowns[3] or DFCMO mosaic embryos[21]. Standard fluorescein-tagged morpholinos (fluorescein-MO) (ref.21) were used to create DFCctrl-MO. For generating DFCMO mosaic embryos, lkt/abcc4-MO, ep4-MO or both cox1-MO and cox2-MO were co-injected with standard fluorescein-tagged morpholinos (fluorescein-MO) into the yolk cell at ~1000-cell stage. Embryos, in which fluorescein-MO diffused throughout the yolk and entered the DFC/KV cells but not other embryoic cells, were selected for mosiac analyses. For DFCctrl-MO embryos, fluorescein-MO were injected into the yolk cell at ~1000-cell stage. For yolk-MO embryos, lkt-MO was injected with fluorescein-MO into the yolk cell between the dome stage and 30% epiboly stage, when connections between the yolk and DFC precursors have closed and morpholinos are restricted to the yolk cell. For rescue experiments, whole-length capped mRNAs of abcc4, cox1, cox2 and ep4 were synthesized using mMessage mMachine SP6 kit (Ambion, AM1340). Since cox1-MO inhibits the ATG start codon, cox1 mRNA was designed to contain 5 mismatched nucleotides (underlined: 5′-ATGAGGGAAT CAATTTCTTG CTGA) so that it could not be bound by the cox1-MO in rescue experiments involving injection of mRNA and morpholino at the same time. As ep4-MO, cox2-MO and abcc4-MO were designed against 5′-UTR and splicing sties, wild-type mRNAs of abcc4-MO, cox2-MO and ep4-MO were synthesized.

Drug treatments

PGE2 (Sigma, P0409), PGF2α (Santa Cruz Biotechnology, SC-201227), SC560 (Sigma, S2064), AH23848 (Sigma, A8227) were dissolved in DMSO for a 50 mM stock solution. NS398 (Cayman, 70590) and Indomethacin (Sigma, I7378) were dissolved in DMSO to a 100 mM stock solution. Embryos were incubated in embryo media containing drugs at desired concentrations at relevant timeframes (see Figure 6 Legends), and then subjected to phenotype and immunostaining analyses.

Video microscopy analysis of KV fluid flow and cilia motility

Fluorescent beads (Polysciences, Inc.) were injected into KV and fluid flow was analyzed as previously described[19]. Details of videomicroscopy analysis of KV flow and cilia motility were described[19]. Flow was imaged using a Zeiss Axio Imager M1 microscope with a 63x Plan Apochromat water-dipping objective. Movies were generated using a Zeiss Axiocam high speed monochromatic digital camera and Axiovision (Zeiss) and Quicktime (Apple) software.

PGE2 cell export assay

Extracellular and intracellular PGE2 were extracted and measured using PGE2 EIA kit (Enzo Life sciences). MEF−/− Cells transfected with pAcGFP-huABCC4, pAcGFP-zfABCC4 or pAcGFP-zfABCCT804M were seeded into six-well plates at 2×105 cells/well in 1 ml of complete medium. 24hr after the transfection 1ml fresh DMEM 10% FBS media was fed to the transiently transfected cells. Supernatant was collected and processed for measurement of extracellular PGE2 levels after 12h incubation. Purification of extracellular PGE2 was accomplished using C-18 mini columns. Cell monolayer was rinsed twice with ice-cold PBS and cells were collected by scraping into 1 ml of ice-cold PBS. Cells were pelleted and stored at 80°C before the purification of intracellular PGE2. Frozen cell pellets were taken up in 1 ml of homogenization buffer and then sonicated briefly three times in 3-second bursts. Duplicate sets of samples were saved for determination of cellular protein concentrations using western analysis. An aliquot of each sample was spiked with PGE2 (20 pg) before purification for monitoring the recovery rate. After the addition of 1 ml of acetone, samples were vortexed, allowed to stand for 20 min and centrifuged at 25°C for 10 min; the acetone was then evaporated under a gentle stream of nitrogen. The pH of samples was adjusted to 4.0 using 1N HCl and the C-18 columns were activated before addition of sample with 10 ml of ethanol and 10 ml of water. After the sample addition, columns were washed with 10 ml of 15% ethanol followed by 10 ml of hexanes and PGE2 was eluted with 10 ml of ethyl acetate. Samples were subsequently dried under a gentle stream of nitrogen for the ELISA PGE2 determinations.

PGE2 vesicular transport assay

Membrane vesicles were prepared from both the SV40-transformed HEK293T cells and those cells transiently expressing pAcGFP-zfABCC4. pAcGFP-zfABCC4 was transfected into HEK293T cells using PolyJet (FroggaBio) after 48 h, inside-out membrane vesicles were prepared and zfAbcc4 levels in the membrane vesicles were confirmed by immunoblotting using Living Colors® EGFP(Clonetech). ATP-dependent uptake of 3H-labeled prostaglandin E2 (PGE2) (180 Ci/mmol) by the membrane vesicles was measured using a rapid filtration technique. Briefly, 30 μl reaction mixtures containing 5 μM [3H]PGE2 (100 nCi), 4 mM AMP or ATP, 10 mM MgCl2, and membrane vesicle protein (10 μg) were incubated at 37°C for 10 min. Uptake was stopped by rapid dilution of the reaction mixtures in ice-cold buffer and vesicles were immediately collected by filtration through a Unifilter-96 GF/B plate (Perkin Elmer) using a Packard Filtermate harvester. Tritium associated with the vesicles was counted using a Top Count NXT microplate scintillation counter (Perkin Elmer). Uptake in the presence of AMP was subtracted from uptake in the absence of ATP to determine ATP-dependent uptake values. Experiments were carried out in duplicate and repeated twice.

Cell culture, siRNA and immunostaining analyses

Primary IMCD3 (ATCC®CRL-2123™)[32] and hRPE1 cells (ATCC® CRL-4000™)[32] were plated on Poly-L-Lysine-coated cell culture plates and were cultured at 37°C, 5% CO2 in DMEM/F12 medium (GIBCO) containing 10% FBS. At 60% confluence, IMCD3 cells were transfected with ABCC4 siRNA at 75 nM (Qiagen; SIO2833040, 5′–AAGGACCTTGTGATTAG TCAA; SIO2833019, 5′–AACGGATGAGTTAATACAACA), EP4 SMARTpool siRNA at 100 nM (Dharmacon; M-048700-01-0005; 5′–CTAGAGAACAGGCGAGCTC, 5′–CAGCTAATATTGTC GATGT, 5′–CCACCAACGTAACGGCCTA, 5′–CCAGTGAAACTCTGAAATT) or control siRNA (Ribo; siN-05815122147) at 100 nM using Lipofectamine RNAimax (Life Technologies). hRPE1 cells were transfected with 100 nM ABCC4 siRNA (Ribo; siG-000010257A; 5′–GAGCAATCATAAAGTGTTA), 100 nM EP4 SMARTpool siRNA (Dharmacon; M-005714-00-0005; 5′–CTGAGGACTTTGCGAATAT, 5′–GTGAAACACTGAACTTATC, 5′–CATCAACCATGCCTATTTC, 5′–TATATATCCTCCTGAGAAA) or 100 nM control siRNA using Lipofectamine RNAimax (Life Technologies). To examine cilia formation, the culture medium was switched to DMEM containing 0.5% FBS for 48 h after transfection and incubation for 24 h. Both IMCD3 and hRPE1 cells were then treated with 100 μM Forskolin (Sigma, F6886), 10 μM PGE2 (Sigma) or 0.1% DMSO (Control) for 12 hours. Treated cells were fixed in 4% PFA at room temperature for 20 minutes, permeabilized in 0.2% Triton X-100 in PBS for 20 minutes, and blocked in 2% heat-inactivated goat serum for 60 minutes prior to staining with antibodies against acetylated -tubulin[26] (1:1000; Sigma, T6557), ARL13B (1:1000; Proteintech, 17711-1-AP) and DAPI (Invitrogen). To determine the sub-cellular location of EP4 and ABCC4 proteins in cilia cells, antibodies against EP4 (1:100; Santa Cruz Biotechnology, sc-55596)[55, 56], ABCC4 (1:50; Alexis Biochemical, ALX-801-038-C150)[57, 58] and antibodies against EGFP (1:1000; Abcam, ab5450) were used. Secondary antibodies used include Alexa Fluor 488 goat against mouse IgG (H+L) (1:1000; Life Technologies, A11001), Alexa Fluor 555 goat against rat IgG (H+L) (1:1000; Life Technologies, A21434), Alexa Fluor 594 goat against mouse IgG (H+L) (1:1000; Life Technologies, A11005), Alexa Fluor 594 goat against rabbit IgG (H+L) (1:1000; Life Technologies, A11012) and Alexa Fluor 488 donkey against goat IgG (H+L) (1:1000; Life Technologies, A11055). Imaging was performed using a Zeiss Axio Observer inverted fluorescence Imaging was performed using Zeiss Axio Observer inverted fluorescence microscope with a 63x NA1.15 water-dipping objective.

Live cell imaging of intraflagellar transport

M368-4 cells (clonal line of IMCD3 cells stably expressing IFT88-EYFP, a gift from Jagesh V. Shah, Harvard Medical School, Boston, USA; ref. 34) were cultured and treated with 10 μM PGE2 (Sigma) for 12 hours and DMSO, respectively. Cells were plated on Poly-L-Lysine-coated glass coverslips and were cultured at 37°C, 5% CO2 in DMEM medium containing 10% FBS until reaching 100% confluency. Cells were examined for IFT88 movement at 37°C on an OLYMPUS ZX81 inverted microscope system equipped with a spinning disk confocal head (ANDOR) using a 150 x oil immersion objective (1.45 NA). Time-lapse images (200 frames) were captured continuously with exposure 150 ms and 7 frames per second. Time-lapse image sequences were assembled into kymographs and the velocities of IFT88-EYFP particles was calculated using the ImageJ software package (http://rsbweb.nih.gov/ij) as described (ref. 29, 34).

Cyclic AMP measurement

IMCD3 cells were cultured in DMEM containing 10% fetal bovine serum, 5% CO2, 1% penicillin and streptomycin at 37°C. IMCD3 cells were treated with 100 μM Forskolin (Sigma), 10 μM PGE2 (Sigma) or DMSO (vehicle only) for 3 hours. Treated IMCD3 were lysed in 0.1M HCl, and then centrifuged to pellet cellular debris. Supernatants were aspirated to measure cAMP concentrations using complete ELISA kit (ENZO, Life Science, ADI-901-163).

Calcium measurement

IMCD3 cells were cultured in DMEM containing 10% fetal bovine serum, 1% penicillin and streptomycin, 5% CO2, at 37°C overnight. IMCD3 cells were treated with 100 μM Forskolin (Sigma), 10 μM PGE2 (Sigma) or DMSO (vehicle only) for 3 hours and then incubated with 5 μM Fura-2-acetoxymethyl ester (Sigma, 47989) for 1 hour at 37°C. Calcium concentrations were measured using an inverted fluorescent microscope (Nikon Eclipse Ti). Calcium concentration was indicated as the ratio of fluorescence intensity at excitation wavelengths of 340 and 380 nm (F ratio).

Statistics Methods

For comparing two independent groups on a given variable, independent sample t-tests are justified when the dependent variable is normally distributed. When the normality assumption is violated, non-parametric Mann-Whitney U Tests are justified to be appropriate. For determining independent association between two categorical variables, non-parametric Chi-square tests are justified. For Student t-test, the minimal sample size for embryo was determined to be 10 and the minimal sample size for cell was determined to be 50. This sample size is able to detect a standardized effect size 0.2 and to reject the null hypothesis that the two population means are equal with probability (power) 0.85. For continuity-corrected chi-square test, the minimal sample size for embryo was determined to be 20. This gives power 0.80 to detect true difference 0.4 with default Type I error probability 0.05. Each subject (embryo, cell or image field) was randomly chosen and allocated to their respective group, and we were not blinded to the group allocation.
  57 in total

Review 1.  Cyclooxygenase-deficient mice. A summary of their characteristics and susceptibilities to inflammation and carcinogenesis.

Authors:  R Langenbach; C D Loftin; C Lee; H Tiano
Journal:  Ann N Y Acad Sci       Date:  1999       Impact factor: 5.691

Review 2.  Cyclooxygenases: structural, cellular, and molecular biology.

Authors:  W L Smith; D L DeWitt; R M Garavito
Journal:  Annu Rev Biochem       Date:  2000       Impact factor: 23.643

3.  Cyclooxygenase-1-derived PGE2 promotes cell motility via the G-protein-coupled EP4 receptor during vertebrate gastrulation.

Authors:  Yong I Cha; Seok-Hyung Kim; Diane Sepich; F Gregory Buchanan; Lilianna Solnica-Krezel; Raymond N DuBois
Journal:  Genes Dev       Date:  2006-01-01       Impact factor: 11.361

4.  Cyclooxygenase-1 signaling is required for vascular tube formation during development.

Authors:  Yong I Cha; Seok-Hyung Kim; Lilianna Solnica-Krezel; Raymond N Dubois
Journal:  Dev Biol       Date:  2005-06-01       Impact factor: 3.582

5.  gridlock, an HLH gene required for assembly of the aorta in zebrafish.

Authors:  T P Zhong; M Rosenberg; M A Mohideen; B Weinstein; M C Fishman
Journal:  Science       Date:  2000-03-10       Impact factor: 47.728

6.  Mechanism of transport of IFT particles in C. elegans cilia by the concerted action of kinesin-II and OSM-3 motors.

Authors:  Xiaoyu Pan; Guangshuo Ou; Gul Civelekoglu-Scholey; Oliver E Blacque; Nicholas F Endres; Li Tao; Alex Mogilner; Michel R Leroux; Ronald D Vale; Jonathan M Scholey
Journal:  J Cell Biol       Date:  2006-09-25       Impact factor: 10.539

7.  Coordinated regulation of fetal and maternal prostaglandins directs successful birth and postnatal adaptation in the mouse.

Authors:  J Reese; B C Paria; N Brown; X Zhao; J D Morrow; S K Dey
Journal:  Proc Natl Acad Sci U S A       Date:  2000-08-15       Impact factor: 11.205

8.  Functional importance of three basic residues clustered at the cytosolic interface of transmembrane helix 15 in the multidrug and organic anion transporter MRP1 (ABCC1).

Authors:  Gwenaëlle Conseil; Roger G Deeley; Susan P C Cole
Journal:  J Biol Chem       Date:  2005-10-17       Impact factor: 5.157

9.  Failure of ductus arteriosus closure and remodeling in neonatal mice deficient in cyclooxygenase-1 and cyclooxygenase-2.

Authors:  C D Loftin; D B Trivedi; H F Tiano; J A Clark; C A Lee; J A Epstein; S G Morham; M D Breyer; M Nguyen; B M Hawkins; J L Goulet; O Smithies; B H Koller; R Langenbach
Journal:  Proc Natl Acad Sci U S A       Date:  2001-01-23       Impact factor: 11.205

10.  Secreting and sensing the same molecule allows cells to achieve versatile social behaviors.

Authors:  Hyun Youk; Wendell A Lim
Journal:  Science       Date:  2014-02-07       Impact factor: 47.728

View more
  37 in total

Review 1.  Ins and outs of GPCR signaling in primary cilia.

Authors:  Kenneth Bødtker Schou; Lotte Bang Pedersen; Søren Tvorup Christensen
Journal:  EMBO Rep       Date:  2015-08-21       Impact factor: 8.807

Review 2.  G-Protein-Coupled Receptor Signaling in Cilia.

Authors:  Kirk Mykytyn; Candice Askwith
Journal:  Cold Spring Harb Perspect Biol       Date:  2017-09-01       Impact factor: 10.005

3.  Prostaglandin signaling in ciliogenesis during development.

Authors:  Daqing Jin; Peiyun Liu; Tao P Zhong
Journal:  Cell Cycle       Date:  2015       Impact factor: 4.534

4.  Direct visualization of cAMP signaling in primary cilia reveals up-regulation of ciliary GPCR activity following Hedgehog activation.

Authors:  Jason Y Jiang; Jeffrey L Falcone; Silvana Curci; Aldebaran M Hofer
Journal:  Proc Natl Acad Sci U S A       Date:  2019-05-29       Impact factor: 11.205

5.  Discovering small molecules as Wnt inhibitors that promote heart regeneration and injury repair.

Authors:  Shuying Xie; Wenbin Fu; Guangju Yu; Xueli Hu; Kaa Seng Lai; Xiangwen Peng; Yating Zhou; Xuejiao Zhu; Plamen Christov; Leah Sawyer; Terri T Ni; Gary A Sulikowski; Zhongzhou Yang; Ethan Lee; Chunyu Zeng; Wei E Wang; Tao P Zhong
Journal:  J Mol Cell Biol       Date:  2020-01-22       Impact factor: 6.216

Review 6.  The primary cilium as a cellular receiver: organizing ciliary GPCR signaling.

Authors:  Keren I Hilgendorf; Carl T Johnson; Peter K Jackson
Journal:  Curr Opin Cell Biol       Date:  2016-02-27       Impact factor: 8.382

7.  An ABC of ciliogenesis.

Authors:  Pascal Barbry; Laure-Emmanuelle Zaragosi
Journal:  Nat Cell Biol       Date:  2014-09       Impact factor: 28.824

Review 8.  Cellular signalling by primary cilia in development, organ function and disease.

Authors:  Zeinab Anvarian; Kirk Mykytyn; Saikat Mukhopadhyay; Lotte Bang Pedersen; Søren Tvorup Christensen
Journal:  Nat Rev Nephrol       Date:  2019-04       Impact factor: 28.314

9.  ABCC5 is required for cAMP-mediated hindgut invagination in sea urchin embryos.

Authors:  Lauren E Shipp; Rose Z Hill; Gary W Moy; Tufan Gökırmak; Amro Hamdoun
Journal:  Development       Date:  2015-09-22       Impact factor: 6.868

10.  The Hedgehog pathway effector smoothened exhibits signaling competency in the absence of ciliary accumulation.

Authors:  Chih-Wei Fan; Baozhi Chen; Irene Franco; Jianming Lu; Heping Shi; Shuguang Wei; Changguang Wang; Xiaofeng Wu; Wei Tang; Michael G Roth; Noelle S Williams; Emilio Hirsch; Chuo Chen; Lawrence Lum
Journal:  Chem Biol       Date:  2014-12-04
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.