Literature DB >> 25133686

Transferred BCR/ABL DNA from K562 extracellular vesicles causes chronic myeloid leukemia in immunodeficient mice.

Jin Cai1, Gengze Wu2, Xiaorong Tan2, Yu Han2, Caiyu Chen2, Chuanwei Li2, Na Wang2, Xue Zou2, Xinjian Chen2, Faying Zhou2, Duofen He2, Lin Zhou2, Pedro A Jose3, Chunyu Zeng2.   

Abstract

Our previous study showed that besides mRNAs and microRNAs, there are DNA fragments within extracellular vesicles (EVs). The BCR/ABL hybrid gene, involved in the pathogenesis of chronic myeloid leukemia (CML), could be transferred from K562 EVs to neutrophils and decrease their phagocytic activity in vitro. Our present study provides evidence that BCR/ABL DNAs transferred from EVs have pathophysiological significance in vivo. Two months after injection of K562 EVs into the tail vein of Sprague-Dawley (SD) rats, they showed some characteristics of CML, e.g., feeble, febrile, and thin, with splenomegaly and neutrophilia but with reduced neutrophil phagocytic activity. These findings were also observed in immunodeficient NOD/SCID mice treated with K562 EVs; BCR/ABL mRNA and protein were found in their neutrophils. The administration of actinomycin D, an inhibitor of de novo mRNA synthesis, prevented the abnormalities caused by K562 EVs in NOD/SCID mice related to CML, including neutrophilia and bone marrow hyperplasia. As a specific inhibitor of tyrosine kinases, imatinib blocked the activity of tyrosine kinases and the expression of phospho-Crkl, induced by the de novo BCR/ABL protein caused by K562 EVs bearing BCR/ABL DNA. Our current study shows the pathophysiological significance of transferred tumor gene from EVs in vivo, which may represent an important mechanism for tumorigenesis, tumor progression, and metastasis.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25133686      PMCID: PMC4136837          DOI: 10.1371/journal.pone.0105200

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Extracellular vesicle (EV) is an important mode of intercellular communication, besides soluble factor and tunneling nanotubule. EVs carry signals within or at their limiting membrane, providing a mechanism by which cells can exchange more complex information than previously thought [1]–[3]. Several studies have shown that in addition to proteins, mRNAs, and microRNAs, there are DNA fragments within EVs [4]–[8]. Our previous study showed the existence of DNA in EVs that could be transferred from one cell to another by endocytosis or fusion. The transferred EV DNAs have pathophysiological significance, not only to increase the DNA-coding mRNA and protein levels, but also influence the function of the recipient cells [4]. There is increasing evidence that EVs play a pivotal role in tumorigenesis, which can occur in adjacent and remote locations. EVs shed from tumor cells have the potential to increase tumor survival and expansion, independent of cell-to-cell contact. Tumor-derived EVs are fully equipped to facilitate the escape of tumor cells from immune surveillance and at the same time be involved in the establishment of an optimal environment for newly formed and metastatic tumor cells. It is interesting to find that the tumor-derived EVs could prod normal cells towards a tumor phenotype [9]. The role of the EV DNAs in this phenomenon is not clear. As a special tumor, chronic myeloid leukemia (CML) is a clonal myeloproliferative disease, characterized by the oncogenic Philadelphia chromosome, formed by a reciprocal translocation between chromosomes 9 and 22, resulting in the novel chimeric protein BCR/ABL (breakpoint cluster region, BCR; Abelson murine leukemia viral oncogene, ABL), that dictates the pathophysiology of CML [10]–[12]. There are several pieces of evidence of increased quantity of malignant and invasive tumor-EVs in the body fluids that may contribute to the progression and metastasis in CML patients [9], [13]. Our previous in vitro study showed that the BCR/ABL hybrid gene could be transferred from K562 EVs to neutrophils, causing a decrease in their phagocytic activity. Whether or not the transferred BCR/ABL DNA has pathophysiological significance in-vivo is not known. Our present study provides the evidence that transferred EV BCR/ABL DNA has pathophysiological significance in vivo experiment. After injection, via tail vein, of K562 EVs into Sprague-Dawley (SD) rats or immunodeficient NOD/SCID mice for two months, the SD rats and NOD/SCID mice showed some characteristics of CML, e.g., feeble, febrile, thin, with splenomegaly and neutrophilia but with reduced neutrophil phagocytic activity. We found the BCR/ABL DNA, mRNA, and protein in the neutrophils of K562 EV-treated animals. Moreover, inhibition of de novo mRNA synthesis by actinomycin D prevented the features caused by K562 EVs in NOD/SCID mice, including characteristics of CML such as neutrophilia and bone marrow hyperplasia. As a specific inhibitor of tyrosine kinases, imatinib blocked the activity of tyrosine kinases and the expression of phospho-Crkl, induced by the de novo BCR/ABL protein caused by K562 EVs bearing BCR/ABL DNA. Our present study shows the pathophysiological significance of transferred tumor gene by EVs in vivo, which may represent an important mechanism for tumorigenesis, tumor progression, and metastasis.

Materials and Methods

1. Cell isolation and culture

K562 and HEK293 cells were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). These cells were cultured at 37°C in 95% air/5% CO2 atmosphere in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Life Technologies), supplemented with 10% fetal bovine serum (Gibco, Life Technologies).

2. Isolation of EVs

EVs were isolated from cell culture medium by differential centrifugation according to our previous study [4]. After removing cells and other debris by centrifugation at 500×g for 20 min, the supernatants were centrifuged again at 1,500×g for 20 min and the initial pellets were discarded. After re-centrifugation at 110,000×g for 70 min, pellets containing the EVs were resuspended in phosphate-buffered saline (PBS). The isolated EVs were then subjected to DNase I (20 Kunitz units/ml EVs) (Sigma-Aldrich Co., St. Louis, MO, USA) digestion (30 min at 37°C) to remove any DNA outside of the EVs. EDTA (10 mmol/L EVs) was then added to the EVs, and incubated for 5 min at 65°C to inactivate any residual DNase. These were the EVs used in the experiments.

3. DNA extraction from EVs

The isolated EVs were subjected to DNase digestion to remove the DNA exterior of the EV, as described above. Total DNA was extracted from EVs with the TIANamp Genomic DNA Kit (Tiangen Biotech Co. Ltd., Beijing, China), following the manufacturer's instructions. The DNA deposit was eluted by about 50 µl of sterile deionized water. The quality and quantity of extracted DNA were measured by spectrophotometry (A260 nm) and agarose gel electrophoresis [14].

4. Qualitative PCR of DNA

DNAs within EVs were amplified by qualitative PCR, using 2×Taq PCR MasterMix (Tiangen), according to the manufacturer's instructions. Twenty-five microliters of the final reaction contained 12.5 µl of 2×Taq PCR MasterMix, 1 µl of sense primer, 1 µl of antisense primer, and 10.5 µl of DNA extract. Thermocycling was conducted using a MyCycler thermal cycler (Bio-Rad Laboratories, Inc., Hercules, California, USA), initiated by a 5 min incubation at 94°C, followed by 40 cycles at 94°C for 30 sec, 58°C for 45 sec and 72°C for 45 sec. All primers used are listed in .
Table 1

Sequence of PCR amplification primers.

Primer nameSequence (5′–3′)Product lengthAmplified gene
BCR/ABL-gD-FP 5′-TCCACTCAGCCACTGGATTTAAGCA-3′ 418 bpK562 BCR/ABL gDNA[10]
BCR/ABL-gD-RP 5′-GGTGAATTGGAAAGAAGCAGCAGGT-3′
BCR/ABL-cD-FP 5′-CGGGAGCAGCAGAAGAAGTGT-3′ 259 bpK562 BCR/ABL mRNA
BCR/ABL-cD-RP 5′-AAAGGTTGGGGTCATTTTCAC-3′
ACTB-cD-FP 5′- CCACGAAACTACCTTCAACTCC -3′ 132 bpHuman ACTB mRNA
ACTB-cD-RP 5′- GTGATCTCCTTCTGCATCCTGT -3′

5. RNA isolation and RT-PCR of mRNA

Total RNA of EVs or cells was extracted using TRIzol Reagent (Life Technologies Co., Carlsbad, California, USA). Residual DNA was removed by DNase I digestion following RNA isolation, as described below. The mixture of 11 µl purified RNA and 1 µl of 25 pmol/µl randomized primer (Toyobo Co., Osaka, Japan) in an RNase-free microcentrifuge tube was denatured by boiling at 65°C for 5 min, followed by immediate cooling on ice. Twelve µl of denatured RNA, 4 µl of 5× RT buffer (Toyobo), 2 µl dNTP mixture (10 mM each of dNTPs, Toyobo), 1 µl of 10 U/µl RNase inhibitor (Toyobo), and 1 µl ReverTre Ace (a reverse transcriptase) (Toyobo) were mixed into a total volume of 20 µl transcriptase reagents. The mixture was incubated at 30°C for 10 min, 42°C for 30 min, 85°C for 5 min, and 4°C for 5 min to allow for the synthesis of first-strand complimentary DNA (cDNA). Subsequently, qualitative PCR of cDNA was performed using 2×Taq PCR MasterMix (Tiangen) by the MyCycler thermal cycler (Bio-Rad), as described above.

6. Immunoblotting

The polyclonal rabbit anti-human and rat c-ABL (BCR-ABL) antibodies were purchased from Cell Signaling Technology, Inc., Danvers, MA and diluted 1∶1000 [11]. Proteins were visualized using the enhanced chemiluminescence system.

7. Animal experiments

SD rats or NOD/SCID mice were maintained on a 12 hr light/dark cycle in a pathogen-free animal facility at Daping Hospital. The fresh isolated EVs were injected to rats or mice every day. At 4 weeks of age, the rats were injected with PBS (200 µl), actinomycin D (7 µg/kg), K562 EVs (2×106) and actinomycin D (7 µg/kg), K562 EVs (2×106 EVs in 200 µl) or K562 cells (2×106 cells in 200 µl) via the tail-vein. Rectal temperatures and body weights were recorded every week. After 2 months, the animals were sacrificed, the spleens were obtained, and spleen to body weight ratio was calculated. In addition, blood neutrophils were counted using Sysmex XE-2100 hematology analyzer (Sysmex Inc., Kobe, Japan). Bone marrow cells on a bone marrow smear with Wright's staining were examined under a microscope using 10×10 lens. Sections of NOD/SCID mice spleens were stained with hematoxylin-eosin (HE) and examined under a microscope using 10×40 lens. Neutrophils were isolated from rat or mouse peripheral blood with neutrophil separating medium (TBD Co. Ltd., Tianjin, China) and then washed with PBS three times to remove any contaminating EVs. For measurement of BCR/ABL levels, genomic DNA, total RNA, and cell lysates were extracted from the neutrophils, and then analyzed by PCR, RT-PCR, and immunoblotting, as previously described [4]. All experiments were approved by the Third Military Medical University Animal Use and Care Committee.

8. Assay for phagocytic activity of neutrophils

Phagocytic activity of neutrophils was detected by ink phagocytosis test. After the addition of 10 µl India ink, 100 µl of heparin anti-coagulated peripheral blood were incubated at 37°C for 4 hrs and the blood smears stained with Wright's stain. To evaluate the level of phagocytic activity of neutrophils, ink-phagocytic cells and ink-particles within these cells were counted from 100 neutrophils on a blood smear with Wright's stain, under a microscope using 10×100 oil lens. Phagocytic rate (the sum of ink-phagocytic cells per 100 neutrophils) and index (the sum of ink-phagocytic particles per 100 neutrophils) were calculated.

9. Activity of tyrosine kinases by ELISA

Mouse neutrophils were incubated with K562 EVs (105/mL) and/or imatinib (0.5 µmol/L), a specific inhibitor of tyrosine kinases, for 24 h. About 106/mL of neutrophils in 100 µL PBS were collected by centrifugation at 500×g for 20 min. Then, the cell lysates of neutrophils were prepared by freeze-thawing for three times. The supernatants samples were obtained by centrifugation at 1800×g for 30 min. Tyrosine kinases activity was determined using a protein tyrosine kinases ELISA kit (R&D Systems, Inc.) according to the manufacturer's recommendation.

10. Expression of phospho-Crkl by immunfluorescence

The expression of phospho-Crkl in the neutrophils was detected by immunofluorescence. The polyclonal rabbit anti-mouse phospho-Crkl antibodies (Tyr207) were purchased from Cell Signaling Technology, Inc., and diluted 1∶100. Goat anti-rabbit antibodies labeled with FITC (1∶200) were binding to phospho-Crkl antibodies. Nuclei (DAPI-staining, blue) and phospho-Crkl (FITC, green) were viewed through a Zeiss LSM 510 META laser confocal microscope (Carl Zeiss) at individual excitation wavelengths (350 nm for DAPI and 490 nm for FITC). Fluorescence intensity of phospho-Crkl in neutrophils was determined under four visual fields.

11. Statistical analysis

The data are expressed as mean ± SD. Comparison within groups was made by ANOVA for repeated measures, and comparison among groups was made by factorial ANOVA and Duncan's test (t-test when only 2 groups were compared). A value of P<0.05 was considered significant.

Results

1. Effect of K562 EVs on the pathophysiological changes in SD rats

Our previous study showed that that BCR/ABL hybrid gene could be transferred from K562 EVs to HEK293 cells or neutrophils [4]. To determine whether or not there is pathophysiological significance of the transferred BCR/ABL hybrid gene in EVs in vivo, we injected, via the tail vein, K562 EVs into SD rats. To decrease the immunological response due to the xenogeneic immunological incompatibility between humans and rats, we treated the SD rats with dexamethasone sodium phosphate (1.0 mg/kg/day) [15]. Two months later, SD rats, injected with K562 EVs, showed some characteristics of CML, e.g., feeble, febrile, thin, with splenomegaly and neutrophilia ( ), but with reduced neutrophil phagocytic activity ( ), similar to those seen in CML [16]. Consistent with the in vitro study, the neutrophils of the K562 EV-injected SD rats were found to express BCR/ABL protein ( ).
Figure 1

Effect of K562 EVs on several pathophysiological parameters in SD rats.

(A): Pathophysiological parameters in SD rats bearing K562 EVs. SD rats were injected, via tail-vein, with K562 cells (2×106), K562-derived-EVs (2×106) or vehicle (PBS). Rectal temperature (a), body weight gain (b), spleen to body weight ratio (c), and neutrophils count (d) were obtained at 12week-old of age (* P<0.05 vs. control n = 3). (B): Phagocytic activity of neutrophils in SD rats bearing K562 EVs. (a): Representative images of India ink-exposed neutrophils. 1. neutrophils from SD control rat without incubation with ink; 2. neutrophils from SD control rat; 3. neutrophils from K562 EVs-bearing SD rat; 4. neutrophils from K562 cell-bearing SD rat. (b) and (c): SD rats injected via tail-vein with K562 cells (2×106), K562 EVs (2×106) or vehicle (PBS). Neutrophil phagocytic rate (b) and index (c) from SD rats were determined by ink phagocytosis test (* P<0.01 vs. control n = 3). (C): BCR/ABL protein expression of neutrophils in SD rats bearing K562-derived-EVs. SD rats were injected, via tail vein, with K562 cells (2x106) (lane 3), K562-derived-EVs (2×106) (lane 4) or vehicle (PBS) (lane 5). The neutrophils were collected and the expression of BCR/ABL protein was detected by immunoblotting. Samples from HEK293 and K562 cells were taken as negative and positive controls, respectively (lanes 1 and 2). (D): Immune and inflammatory responses of SD rats bearing EVs. SD rats were injected, via tail-vein, with vehicle (PBS), K562-derived-EVs (2×106) or K562 cells (2×106). (a): ratio of CD4+ and CD8+ T lymphocytes; (b) plasma CRP (* P>0.05 vs. control, n = 3).

Effect of K562 EVs on several pathophysiological parameters in SD rats.

(A): Pathophysiological parameters in SD rats bearing K562 EVs. SD rats were injected, via tail-vein, with K562 cells (2×106), K562-derived-EVs (2×106) or vehicle (PBS). Rectal temperature (a), body weight gain (b), spleen to body weight ratio (c), and neutrophils count (d) were obtained at 12week-old of age (* P<0.05 vs. control n = 3). (B): Phagocytic activity of neutrophils in SD rats bearing K562 EVs. (a): Representative images of India ink-exposed neutrophils. 1. neutrophils from SD control rat without incubation with ink; 2. neutrophils from SD control rat; 3. neutrophils from K562 EVs-bearing SD rat; 4. neutrophils from K562 cell-bearing SD rat. (b) and (c): SD rats injected via tail-vein with K562 cells (2×106), K562 EVs (2×106) or vehicle (PBS). Neutrophil phagocytic rate (b) and index (c) from SD rats were determined by ink phagocytosis test (* P<0.01 vs. control n = 3). (C): BCR/ABL protein expression of neutrophils in SD rats bearing K562-derived-EVs. SD rats were injected, via tail vein, with K562 cells (2x106) (lane 3), K562-derived-EVs (2×106) (lane 4) or vehicle (PBS) (lane 5). The neutrophils were collected and the expression of BCR/ABL protein was detected by immunoblotting. Samples from HEK293 and K562 cells were taken as negative and positive controls, respectively (lanes 1 and 2). (D): Immune and inflammatory responses of SD rats bearing EVs. SD rats were injected, via tail-vein, with vehicle (PBS), K562-derived-EVs (2×106) or K562 cells (2×106). (a): ratio of CD4+ and CD8+ T lymphocytes; (b) plasma CRP (* P>0.05 vs. control, n = 3). To determine the immune and inflammatory responses of SD rats bearing K562 cells or their EVs, we measured the ratio of CD4+ T lymphocytes to CD8+ T lymphocytes and plasma C-reactive protein (CRP) levels. We found that those above-mentioned parameters were not different among control SD rats and SD rats treated with K562 cells or K562 EVs ( -a and 1D-b).

2. Effect of K562 EVs on the pathophysiological changes in NOD/SCID mice

Although the SD rats were treated with dexamethasone prior to administration of the K562 EVs, it would be difficult to eliminate completely the immunological reaction due to the xenogeneic immunologically incompatible systems. Therefore, we re-performed the rat experiment in the immunodeficient mouse, NOD/SCID mouse. NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D, via tail-vein, every three days for 2 months. Two months later, NOD/SCID mice, injected with K562 EVs, showed characteristics of CML similar to the SD rats injected with K562 EVs, e.g., feeble, febrile and, thin, and with splenomegaly, ( -a). The spleens were swollen and infiltrated by leukemia cells, observed by H.E. staining ( -b). Hyperplastic bone marrow ( ) and increased neutrophils count in peripheral blood ( ) were observed in the K562 EV-injected mice.
Figure 2

Pathophysiological parameters in NOD/SCID mice injected with K562 EVs.

NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D via tail-vein, every three days for 2 months. Rectal temperature (A), body weight (B), and spleen weight (C-a) were measured and histologies (C-b) were examined (* P<0.05 vs. control, n = 3). In Figure C-b, sections of spleen of NOD/SCID mouse stained with hematoxylin-eosin (HE) were examined under a microscope using 10×40 lens. Spleens of NOD/SCID mice treated with vehicle (PBS) (1), actinomycin D (7 µg/kg) (2), K562 EVs (2×106) and actinomycin D (7 µg/kg) (3), K562 EVs (2×106) (4), and K562 cells (2×106) (5).

Figure 3

Bone marrow studies and neutrophils count in NOD/SCID mice.

(A): Bone marrows in NOD/SCID mice. NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D (7 µg/kg), via tail-vein every three days for 2 months. Wright's stained bone marrow cells were examined under a microscope using 10×10 lens. Bone marrow of NOD/SCID mice were treated with vehicle (PBS) (a), actinomycin D (7 µg/kg) (b), K562 EVs (2×106) and actinomycin D (7 µg/kg) (c), K562 EVs (2×106) (d), and K562 cells (2×106) (e). Red and green arrows indicate the immature and mature granulocytes, respectively. (B): Neutrophils count in NOD/SCID mice. NOD/SCID mice were injected with K562 EVs (2×106) or K562 (2×106) cells and/or actinomycin D (7 µg/kg), via tail-vein every three days for 2 months. The number of neutrophils in the blood of the NOD/SCID mice was counted using Sysmex XE-2100 hematology analyzer (* P<0.05 vs. control, n = 3).

Pathophysiological parameters in NOD/SCID mice injected with K562 EVs.

NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D via tail-vein, every three days for 2 months. Rectal temperature (A), body weight (B), and spleen weight (C-a) were measured and histologies (C-b) were examined (* P<0.05 vs. control, n = 3). In Figure C-b, sections of spleen of NOD/SCID mouse stained with hematoxylin-eosin (HE) were examined under a microscope using 10×40 lens. Spleens of NOD/SCID mice treated with vehicle (PBS) (1), actinomycin D (7 µg/kg) (2), K562 EVs (2×106) and actinomycin D (7 µg/kg) (3), K562 EVs (2×106) (4), and K562 cells (2×106) (5).

Bone marrow studies and neutrophils count in NOD/SCID mice.

(A): Bone marrows in NOD/SCID mice. NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D (7 µg/kg), via tail-vein every three days for 2 months. Wright's stained bone marrow cells were examined under a microscope using 10×10 lens. Bone marrow of NOD/SCID mice were treated with vehicle (PBS) (a), actinomycin D (7 µg/kg) (b), K562 EVs (2×106) and actinomycin D (7 µg/kg) (c), K562 EVs (2×106) (d), and K562 cells (2×106) (e). Red and green arrows indicate the immature and mature granulocytes, respectively. (B): Neutrophils count in NOD/SCID mice. NOD/SCID mice were injected with K562 EVs (2×106) or K562 (2×106) cells and/or actinomycin D (7 µg/kg), via tail-vein every three days for 2 months. The number of neutrophils in the blood of the NOD/SCID mice was counted using Sysmex XE-2100 hematology analyzer (* P<0.05 vs. control, n = 3). Our published in vitro study showed that the transferred BCR/ABL DNA from K562 EVs were functional, which could be transcribed into BCR/ABL mRNA and protein that subsequently affected the phagocytic activity of neutrophils. To determine whether or not the transcription of BCR/ABL gene played a key role in the pathogenesis of CML, we treated the NOD/DCID mice with actinomycin D (7.0 µg/kg), an inhibitor of de novo mRNA synthesis. Although actinomycin D, by itself had no effect, it blocked the development of CML caused by K562 EVs ( -a), i.e., the hyperplastic bone marrow and neutrophilia in the K562 EVs-treated mice were no longer observed ( ), indicating that there was de novo transcription of BCR/ABL mRNA, as well as protein synthesis in vivo.

3. BCR/ABL expression in neutrophils from NOD/SCID mice

As indicated in our published in vitro study, the de novo transcription of BCR/ABL DNA transferred by K562 EVs plays an important role in the pathogenesis of CML [4], Therefore, we examined the expressions of BCR/ABL DNA, mRNA, and protein in the peripheral blood of NOD/SCID mice injected with K562 EVs or K562 cells and found them to be expressed in their neutrophils ( ). Actinomycin (7.0 µg/kg), by itself, had no effect on BCR/ABL DNA expression ( ), but it decreased the BCR/ABL mRNA and protein expressions in the neutrophils ( ) of K562 EV-injected NOD/SCID mice.
Figure 4

BCR/ABL expression in neutrophils from NOD/SCID mice.

(A): BCR/ABL DNA expression in neutrophils from NOD/SCID mice. NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D, via tail-vein every three days for 2 months. (a) The upper figure shows the BCR/ABL DNA detected by PCR that was resolved on precasted 2% agarose gel with ethidium bromide. (b): The lower figure shows the sequence of the PCR product of BCR/ABL DNA in the neutrophils from the NOD/SCID mice; the percentage sequence identity was more than 99.5%. The black arrow indicates the merge point of the BCR DNA and ABL DNA. (B): BCR/ABL mRNA expression in neutrophils from NOD/SCID mice. NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D, via tail-vein every three days for 2 months. (a): The upper figures show the expression of BCR/ABL mRNA in neutrophils detected by RT-PCR on precasted 2% agarose gel with ethidium bromide. (b): The lower figures show the sequence of the RT-PCR product of BCR/ABL mRNA and β-actin mRNA in the neutrophils from the NOD/SCID mice; the percentage sequence identity is more than 99.5%. The black arrow indicates the merge point of the BCR mRNA and ABL mRNA. (C): BCR/ABL protein expression in neutrophils from NOD/SCID mice. NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D, via tail-vein every three days for 2 months. The neutrophils were collected and the expression of BCR/ABL protein was detected by immunoblotting. Lane M, DNA marker; neutrophils from NOD/SCID mice treated with vehicle (PBS) (lane 1), actinomycin D (7 µg/kg) (lane 2), K562 EVs (2×106) and actinomycin D (7 µg/kg) (lane 3), K562 EVs (2×106) (lane 4), and K562 cells (2×106) (lane 5); K562 cells and ddH2O were taken as positive and negative controls, respectively (lane 6 and 7).

BCR/ABL expression in neutrophils from NOD/SCID mice.

(A): BCR/ABL DNA expression in neutrophils from NOD/SCID mice. NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D, via tail-vein every three days for 2 months. (a) The upper figure shows the BCR/ABL DNA detected by PCR that was resolved on precasted 2% agarose gel with ethidium bromide. (b): The lower figure shows the sequence of the PCR product of BCR/ABL DNA in the neutrophils from the NOD/SCID mice; the percentage sequence identity was more than 99.5%. The black arrow indicates the merge point of the BCR DNA and ABL DNA. (B): BCR/ABL mRNA expression in neutrophils from NOD/SCID mice. NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D, via tail-vein every three days for 2 months. (a): The upper figures show the expression of BCR/ABL mRNA in neutrophils detected by RT-PCR on precasted 2% agarose gel with ethidium bromide. (b): The lower figures show the sequence of the RT-PCR product of BCR/ABL mRNA and β-actin mRNA in the neutrophils from the NOD/SCID mice; the percentage sequence identity is more than 99.5%. The black arrow indicates the merge point of the BCR mRNA and ABL mRNA. (C): BCR/ABL protein expression in neutrophils from NOD/SCID mice. NOD/SCID mice were injected with K562 EVs or K562 cells and/or actinomycin D, via tail-vein every three days for 2 months. The neutrophils were collected and the expression of BCR/ABL protein was detected by immunoblotting. Lane M, DNA marker; neutrophils from NOD/SCID mice treated with vehicle (PBS) (lane 1), actinomycin D (7 µg/kg) (lane 2), K562 EVs (2×106) and actinomycin D (7 µg/kg) (lane 3), K562 EVs (2×106) (lane 4), and K562 cells (2×106) (lane 5); K562 cells and ddH2O were taken as positive and negative controls, respectively (lane 6 and 7).

4. Inhibition of imatinib on the de novo BCR/ABL transcription

To validate whether or not the de novo BCR/ABL protein influences tyrosine kinases in the neutrophils transferred by K562 EVs bearing BCR/ABL DNA, we treated these neutrophils with imatinib (0.5 µmol/L), a specific inhibitor of tyrosine kinases. We determined the activity of tyrosine kinases in neutrophils by ELISA. Although imatinib, by itself, had no significant effect, it blocked the activity of tyrosine kinases in the neutrophils transferred by K562 EVs ( ). As Crkl is a prominent substrate of BCR/ABL oncoprotein in CML and binds to BCR/ABL, we detected the expression of phospho-Crkl in the neutrophils by immunofluorescence. After imatinib treatment, the higher levels of phospho-Crkl in the neutrophils transferred by K562 EVs were no longer observed ( ), indicating the de novo BCR/ABL protein was functional with tyrosine kinase activity.
Figure 5

Inhibition of imatinib on the de novo BCR/ABL protein.

(A): The activity of tyrosine kinases in the neutrophils. Neutrophils were incubated with K562 EVs (105/mL) and/or imatinib (0.5 µmol/L) for 24 h. The activity of tyrosine kinases in neutrophils were determined by ELISA (* P<0.01 vs. control, n = 6). (B): Phospho-Crkl protein expression in the neutrophils. Neutrophils were incubated with K562 EVs (105/mL) and/or imatinib (0.5 µmol/L) for 24 h. The representive images (a) and protein expression (b) of phospho-Crkl in the neutrophils were detected by immunofluorescence (* P<0.01 vs. other group, n = 4). Green and blue fluorescences indicate phospho-Crkl protein and Nuclei, respectively. Normal neutrophils (1), K562 EVs (2×106) (2), imatinib (0.5 µmol/L) (3), K562 EVs (2×106) and imatinib (0.5 µmol/L) (4).

Inhibition of imatinib on the de novo BCR/ABL protein.

(A): The activity of tyrosine kinases in the neutrophils. Neutrophils were incubated with K562 EVs (105/mL) and/or imatinib (0.5 µmol/L) for 24 h. The activity of tyrosine kinases in neutrophils were determined by ELISA (* P<0.01 vs. control, n = 6). (B): Phospho-Crkl protein expression in the neutrophils. Neutrophils were incubated with K562 EVs (105/mL) and/or imatinib (0.5 µmol/L) for 24 h. The representive images (a) and protein expression (b) of phospho-Crkl in the neutrophils were detected by immunofluorescence (* P<0.01 vs. other group, n = 4). Green and blue fluorescences indicate phospho-Crkl protein and Nuclei, respectively. Normal neutrophils (1), K562 EVs (2×106) (2), imatinib (0.5 µmol/L) (3), K562 EVs (2×106) and imatinib (0.5 µmol/L) (4).

Discussion

Cell to cell communication is involved in tissue morphogenesis, wound healing, and tumor metastases. Direct communication between mammalian cells occurs either by the transfer of information through EVs or physical connection through nanotubes [7], [17], [18]. Several signals via EVs can contribute to diverse cancer phenomena, such as field effect and priming of the metastatic niche [8]. For example, CML cell-derived exosomes induced angiogenic activity in endothelial cells, revealing a key role for EVs in both the pathogenesis of leukemia and its metastasis [19]. Our previous study found that the transferred BCR/ABL hybrid gene in EVs could increase the BCR/ABL mRNA and protein levels in neutrophils in vitro [4]. The present study showed that the BCR/ABL hybrid gene, the unique pathogenic gene causing CML, could be transferred from EVs in vivo, resulting in CML. These results are consistent with the view that Plasmodium falciparum-infected red blood cells directly communicate between parasites within a population using exosome-like vesicles that are capable of delivering genes [7]. In the present study, the initial experiment involving the injection of K562 EVs into SD rats has a limitation: a xenogeneic immunological incompatibility. Therefore, one cannot rule out that the immune response of SD rats to human antigens present in K562 leukemic cells and their EVs could have caused the CML-like symptoms, such as being feeble, febrile, thin, and with splenomegaly and neutrophilia. To overcome this limitation, we re-performed the experiment in immunodeficient NOD/SCID mice. To further confirm the transcription of EV DNAs in the recipient animal, actinomycin D, an inhibitor of de novo DNA transcription, was used in the in vivo experiment. Actinomycin D blocked the development of the characteristics of CML caused by the injection of K562 EVs in NOD/SCID mice. Therefore, the injection of K562 EVs in NOD/SCID mice caused, in vivo, de-novo BCR/ABL mRNA, and protein synthesis. However, actinomycin D is non-specific inhibitor for BCR/ABL transcription, thus we used another specific inhibitor of tyrosine kinases, which is activated by BCR/ABL protein in CML. Moreover, we also detected Crkl, which is a prominent substrate of the BCR/ABL oncoprotein in CML. As described above, imatinib blocked the activity of tyrosine kinases and the expression of phospho-Crkl, induced by the de novo BCR/ABL protein caused by K562 EVs bearing BCR/ABL DNA, indicated that the de novo BCR/ABL protein is taken in the pathogenesis of CML. The chimeric BCR-ABL protein is involved in the pathophysiology of CML [12]. Previous study suggest that CML EVs can freely and invasively deliver BCR/ABL gene from CML cells into normal neutrophils and then influence their function in the bone marrow. Although normal EVs may instruct the bone marrow to prevent metastatic leukemia [9], the leukemic EVs can promote the mobilization of neutrophils that may play an important role in leukemic invasion and metastasis. This may explain why most hematological malignancies, especially leukemia, progress rapidly. Unfortunately, the molecular mechanisms of EV biogenesis and secretion are still not well described, but the present results suggest that genetic changes could be involved in these phenomena. It is well known that tumor EVs contribute to the horizontal propagation of oncoproteins and genetic material [8], [20]–[23]. However, our study shows that the transfer of the BCR/ABL gene from tumor-derived EVs to neutrophils may promote the invasive and metastatic process in vivo. In conclusion, we have demonstrated that cell to cell communication occurs between leukemia cells and normal neutrophils and that this provides a mechanism for increasing tumorigenesis. This is a key advantage for tumor cells in maintaining invasion for survival. This process is potentially an excellent target for therapeutic approaches to block tumor progression and prevent the spread of tumor drug resistance.
  22 in total

1.  Amphiregulin exosomes increase cancer cell invasion.

Authors:  James N Higginbotham; Michelle Demory Beckler; Jonathan D Gephart; Jeffrey L Franklin; Galina Bogatcheva; Gert-Jan Kremers; David W Piston; Gregory D Ayers; Russell E McConnell; Matthew J Tyska; Robert J Coffey
Journal:  Curr Biol       Date:  2011-04-21       Impact factor: 10.834

2.  Oxidized low-density lipoprotein-dependent platelet-derived microvesicles trigger procoagulant effects and amplify oxidative stress.

Authors:  Hua Wang; Zhi-Hao Wang; Jing Kong; Meng-Yun Yang; Gui-Hua Jiang; Xu-Ping Wang; Ming Zhong; Yun Zhang; Jing-Ti Deng; Wei Zhang
Journal:  Mol Med       Date:  2012-03-27       Impact factor: 6.354

Review 3.  Highlights of a new type of intercellular communication: microvesicle-based information transfer.

Authors:  E Pap; E Pállinger; M Pásztói; A Falus
Journal:  Inflamm Res       Date:  2009-01       Impact factor: 4.575

4.  Cell-cell communication between malaria-infected red blood cells via exosome-like vesicles.

Authors:  Neta Regev-Rudzki; Danny W Wilson; Teresa G Carvalho; Xavier Sisquella; Bradley M Coleman; Melanie Rug; Dejan Bursac; Fiona Angrisano; Michelle Gee; Andrew F Hill; Jake Baum; Alan F Cowman
Journal:  Cell       Date:  2013-05-15       Impact factor: 41.582

Review 5.  Circulating microRNAs: a novel class of biomarkers to diagnose and monitor human cancers.

Authors:  Ke Zen; Chen-Yu Zhang
Journal:  Med Res Rev       Date:  2010-11-09       Impact factor: 12.944

6.  Imatinib triggers mesenchymal-like conversion of CML cells associated with increased aggressiveness.

Authors:  Alexandre Puissant; Maeva Dufies; Nina Fenouille; Issam Ben Sahra; Arnaud Jacquel; Guillaume Robert; Thomas Cluzeau; Marcel Deckert; Mélanie Tichet; Yann Chéli; Jill-Patrice Cassuto; Sophie Raynaud; Laurence Legros; Jean-Max Pasquet; François-Xavier Mahon; Frédéric Luciano; Patrick Auberger
Journal:  J Mol Cell Biol       Date:  2012-03-31       Impact factor: 6.216

7.  Melanoma exosomes educate bone marrow progenitor cells toward a pro-metastatic phenotype through MET.

Authors:  Héctor Peinado; Maša Alečković; Simon Lavotshkin; Irina Matei; Bruno Costa-Silva; Gema Moreno-Bueno; Marta Hergueta-Redondo; Caitlin Williams; Guillermo García-Santos; Cyrus Ghajar; Ayuko Nitadori-Hoshino; Caitlin Hoffman; Karen Badal; Benjamin A Garcia; Margaret K Callahan; Jianda Yuan; Vilma R Martins; Johan Skog; Rosandra N Kaplan; Mary S Brady; Jedd D Wolchok; Paul B Chapman; Yibin Kang; Jacqueline Bromberg; David Lyden
Journal:  Nat Med       Date:  2012-06       Impact factor: 53.440

8.  Secreted monocytic miR-150 enhances targeted endothelial cell migration.

Authors:  Yujing Zhang; Danqing Liu; Xi Chen; Jing Li; Limin Li; Zhen Bian; Fei Sun; Jiuwei Lu; Yuan Yin; Xing Cai; Qi Sun; Kehui Wang; Yi Ba; Qiang Wang; Dongjin Wang; Junwei Yang; Pingsheng Liu; Tao Xu; Qiao Yan; Junfeng Zhang; Ke Zen; Chen-Yu Zhang
Journal:  Mol Cell       Date:  2010-07-09       Impact factor: 17.970

9.  Extracellular vesicle-mediated transfer of donor genomic DNA to recipient cells is a novel mechanism for genetic influence between cells.

Authors:  Jin Cai; Yu Han; Hongmei Ren; Caiyu Chen; Duofen He; Lin Zhou; Gilbert M Eisner; Laureano D Asico; Pedro A Jose; Chunyu Zeng
Journal:  J Mol Cell Biol       Date:  2013-04-11       Impact factor: 6.216

10.  Toxicity studies of retroviral-mediated gene transfer for the treatment of brain tumors.

Authors:  Z Ram; K W Culver; S Walbridge; J A Frank; R M Blaese; E H Oldfield
Journal:  J Neurosurg       Date:  1993-09       Impact factor: 5.115

View more
  31 in total

Review 1.  Endothelial progenitor cells in hematologic malignancies.

Authors:  Ugo Testa; Ernestina Saulle; Germana Castelli; Elvira Pelosi
Journal:  Stem Cell Investig       Date:  2016-07-01

2.  BCR-ABL1-positive microvesicles malignantly transform human bone marrow mesenchymal stem cells in vitro.

Authors:  Fen-Fen Fu; Xiao-Jian Zhu; Hong-Xiang Wang; Li-Ming Zhang; Guo-Lin Yuan; Zhi-Chao Chen; Qiu-Bai Li
Journal:  Acta Pharmacol Sin       Date:  2017-08-24       Impact factor: 6.150

3.  MicroRNA-130a regulates cell malignancy by targeting RECK in chronic myeloid leukemia.

Authors:  Quan Li; Yaohui Wu; Jian Zhang; Tienan Yi; Weiming Li
Journal:  Am J Transl Res       Date:  2016-02-15       Impact factor: 4.060

Review 4.  Secretome of Stem Cells: Roles of Extracellular Vesicles in Diseases, Stemness, Differentiation, and Reprogramming.

Authors:  Hyo Jin Kim; Gyeongmin Kim; Jihun Lee; Youngseok Lee; Jong-Hoon Kim
Journal:  Tissue Eng Regen Med       Date:  2021-11-24       Impact factor: 4.169

Review 5.  Contribution of Tumor-Derived Extracellular Vesicles to Malignant Transformation of Normal Cells.

Authors:  Daria S Chulpanova; Tamara V Pukhalskaia; Albert A Rizvanov; Valeriya V Solovyeva
Journal:  Bioengineering (Basel)       Date:  2022-06-04

Review 6.  Extracellular Vesicles in Brain Tumor Progression.

Authors:  Esterina D'Asti; Shilpa Chennakrishnaiah; Tae Hoon Lee; Janusz Rak
Journal:  Cell Mol Neurobiol       Date:  2016-03-18       Impact factor: 5.046

7.  Functional studies of miR-130a on the inhibitory pathways of apoptosis in patients with chronic myeloid leukemia.

Authors:  X Zhu; H Zhao; Z Lin; G Zhang
Journal:  Cancer Gene Ther       Date:  2015-10-23       Impact factor: 5.987

8.  Extracellular vesicles in hematological disorders.

Authors:  Anat Aharon; Annie Rebibo-Sabbah; Inna Tzoran; Carina Levin
Journal:  Rambam Maimonides Med J       Date:  2014-10-29

9.  Pro-Inflammatory Microenvironment Modulates the Transfer of Mutated TP53 Mediated by Tumor Exosomes.

Authors:  Rossana Domenis; Adriana Cifù; Catia Mio; Martina Fabris; Francesco Curcio
Journal:  Int J Mol Sci       Date:  2021-06-10       Impact factor: 5.923

10.  MicroRNA-320a acts as a tumor suppressor by targeting BCR/ABL oncogene in chronic myeloid leukemia.

Authors:  Zhu Xishan; Lin Ziying; Du Jing; Liu Gang
Journal:  Sci Rep       Date:  2015-07-31       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.