Literature DB >> 25127126

Smad4 regulates ureteral smooth muscle cell differentiation during mouse embryogenesis.

Jianyun Yan1, Lu Zhang2, Jinshu Xu3, Nishat Sultana2, Jun Hu2, Xiaoqiang Cai2, Jun Li3, Pin-Xian Xu3, Chen-Leng Cai2.   

Abstract

Proper formation of ureteral smooth muscle cells (SMCs) during embryogenesis is essential for ureter peristalsis that propels urine from the kidney to the bladder in mammals. Currently the molecular factors that regulate differentiation of ureteral mesenchymal cells into SMCs are incompletely understood. A recent study has reported that Smad4 deficiency reduces the number of ureteral SMCs. However, its precise role in the ureteral smooth muscle development remains largely unknown. Here, we used Tbx18:Cre knock-in mouse line to delete Smad4 to examine its requirement in the development of ureteral mesenchyme and SMC differentiation. We found that mice with specific deletion of Smad4 in Tbx18-expressing ureteral mesenchyme exhibited hydroureter and hydronephrosis at embryonic day (E) 16.5, and the mutant mesenchymal cells failed to differentiate into SMCs with increased apoptosis and decreased proliferation. Molecular markers for SMCs including alpha smooth muscle actin (α-SMA) and smooth muscle myosin heavy chain (SM-MHC) were absent in the mutant ureters. Moreover, disruption of Smad4 significantly reduced the expression of genes, including Sox9, Tbx18 and Myocardin associated with SMC differentiation. These findings suggest that Smad4 is essential for initiating the SMC differentiation program during ureter development.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25127126      PMCID: PMC4134214          DOI: 10.1371/journal.pone.0104503

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Congenital malformations of the urinary tract resulted from embryonic ureter obstruction lead to hydroureter and/or hydronephrosis with dilated ureter and/or renal pelvis, and are one of the main causations of renal failure among children and young adults [1]–[3]. Currently the molecular mechanisms underlying these congenital defects are poorly understood. The urinary tract is composed of three important cell types: the inner epithelial cells (urothelium), the outer smooth muscle cells (SMCs) that provide contractility to evacuate urine from kidney to bladder [4], and fibroblasts. During ureter development (from E14.5 in mice), the SMCs start to differentiate from mesenchymal cells surrounding ureter pelvis [5], [6]. Failure in differentiation of ureteral mesenchymal cells into SMCs results in obstruction and hydronephrosis with atrophy of kidney parenchyma [2], [7], [8]. Therefore, it is important to understand molecular factors regulating ureteral SMC differentiation during embryonic development. Molecular regulation of ureteral SMC differentiation is extremely complex. Previous studies revealed several genes, including Tbx18, Six1, Sox9, Tszh3 and β-catenin, are essential for SMC differentiation during ureter development [2], [7]–[11]. TGF-β super family signals play vital roles in ureter development [10], [12], [13]. In mice, Bmp4 promotes ureter growth and elongation [10], [12]. Decreased Bmp4 signaling results in loss of ureteral smooth muscle formation [14]. As a central mediator in TGF-β signaling [15], Smad4 has been found crucial for vascular SMC differentiation and proliferation [16]. Deletion of Smad4 in the ureteral mesenchyme leads to a reduced number of SMCs [17]. However, whether Smad4 is essential for ureteral SMC differentiation remains unclear. In particular, the downstream genes through which Smad4 regulates ureter development are largely unknown. In this study, we generated Tbx18:Cre knock-in mice to ablate Smad4 in the ureteral mesenchyme. Our data revealed that Smad4 acts as upstream of several key genes associated with ureteral SMC differentiation, and plays critical roles for ureter development during mouse embryogenesis.

Materials and Methods

Animals

Smad4:floxed (denoted as Smad4), Rosa26:tdTomato (denoted as Rosa26), and Tbx18:nlacZ (denoted as Tbx18) mice were described previously [18]–[20]. A new Tbx18:Cre (denoted as Tbx18) mouse model was generated by inserting a Cre-polyA- FRT-Neo-FRT cassette into the start codon of Tbx18 locus, with disruption of endogenous ATG. Long range PCR was applied to screen targeted ES cells with 5′ primer P1: 5′-GTGTCCCTGAGTTCAGCTGACTGC-3′ and 3′ primer P2: 5′-CCGGTTATTCAACTTGCACCATGC-3′ (Fig. S1 A). Fragment amplified from the positive ES cells was further confirmed by DNA sequencing. Tbx18 mice generated from positive ES cells were crossed to Flippase mice [21] to produce Tbx18 animals (Neo cassette is removed) (Fig. S1). Smad4 mice were bred with Tbx18 mice to generate Tbx18; Smad4 doubly heterozygous mice. Mutant Tbx18; Smad4 mice were obtained by mating Tbx18; Smad4 with Smad4 mice. Genomic DNA was prepared from yolk sacs or tail biopsies for genotyping. Cervical dislocation and carbon dioxide inhalation were applied to euthanize mice. Mouse husbandry was carried out according to an approved IACUC protocol at the Icahn School of Medicine at Mount Sinai (Permit LA09-00494), and is in compliance with institutional and governmental regulation (PHS Animal Welfare Assurance A3111-01).

X-gal staining

Ureters from Tbx18 mouse were checked for β-galactosidase activity by X-gal staining. Mouse ureters were treated with fixation solution (4% paraformaldehyde in PBS) for 30 min at 4°C. The fixed ureters were washed twice with PBS and then stained with X-gal solution (5 mM Potassium Ferricyanide, 5 mM Potassium Ferrocyanide, 2 mM MgCl2, 1 mg/ml X-gal) for 12 hours at room temperature. Tissues were visualized with a Leica steromicroscope.

Histology

Mouse ureters were washed in PBS and fixed with 4% paraformaldehyde overnight at 4°C, dehydrated in an ascending ethanol series (25%, 50%, 75%, 100%) followed by two changes of 100% xylene. The tissues were then immersed in liquid paraffin for 2 hours and left on a cold plate until wax was solidified. Paraffin blocks were cut into 6 µm in thickness on a microtome. The sections were stained with Hematoxylin and Eosin (H&E) using standard procedures.

Immunofluorescence and RNA in situ hybridization

Mouse ureters were fixed in 4% paraformaldehyde for 30 min and embedded in Optimal Cutting Temperature compound (Tissue-Tek). Frozen samples for immunohistochemistry were cut into 6 µm in thickness. Primary antibodies used in this study were as follows: rabbit anti-Smad4 (1∶100, Millipore), rabbit anti-Sox9 (1∶300, Millipore), mouse anti-αSMA (1∶100, Sigma), rabbit anti-SM-MHC (1∶100, Biomedical Technologies), rabbit anti-Uroplakin (1∶100, a generous gift from Dr. Tung-Tien Sun, NYU) [22]. Alexa Flour 488 or 594 conjugated secondary antibodies (1∶500; Invitrogen) were applied to detect the corresponding primary antibodies. Section RNA in situ hybridization was carried out on 12-µm cryosections with methods described previously [23], [24].

Proliferation and apoptosis analysis

For cell proliferation assay, pregnant mice were intraperitoneally injected with 10 mM EdU (Invitrogen) in PBS (5 mg per 100 g body weight). Embryos were harvested 4 hours later and fixed in 4% paraformaldehyde for 30 min at 4°C, and were embedded in OCT compound. Cell proliferation was assessed on 6 µm frozen sections using Click-iT EdU Cell Proliferation Assay Kit (Invitrogen). To quantify cell proliferation, 8 ureter sections were prepared from each embryo, and sections are from comparable locations in the control and mutant. Two embryos of each genotype were analyzed. Proliferation index was calculated as the percentage of EdU positive cells relative to ureteral mesenchymal cells and ureteric epithelial cells, respectively. Apoptosis assay was performed on 6 µm frozen sections using in situ Cell Death Detection Kit (Roche) according to the manufacturer's instructions. Nine representative ureter sections from each of three embryos with control or mutant genotype at comparable locations were used for apoptosis assay. Apoptosis index was calculated as percentage of TUNEL positive cells relative to ureteral mesenchymal cells.

Quantitative real-time PCR

Total RNA was isolated from ureters with Trizol reagent (Invitrogen) according to the manufacturer's instructions. QuantiTect Reverse Transcription Kit (Qiagen) was used to synthesize First-strand cDNA from total RNA. Quantitative PCR was performed using StepOnePlus PCR system and SYBR green detector (Qiagen). All transcripts were normalized to β-actin. The relative amounts of mRNA were calculated using the comparative Ct (threshold cycle) method. Primers used in this study are listed in Table 1. Data are presented as mean ± SD. Statistical analysis was performed by t-test and a value of p<0.05 was considered significant.
Table 1

Primer sequences for quantitative PCR.

GenePrimer sequence (5′-3′)
Myocd CATTCGCCTTTGAGGATGAC
CTGAGCCAGGAGTGAGATCC
Acta2 GAGGCACCACTGAACCCTAA
CATCTCCAGAGTCCAGCACA
Myh11 AACACAGACCAGGCATCCAT
CTTTGGTCTGAGCCTTCTGC
Mycn AGCACCTCCGGAGAGGATAC
CGCACAGTGATCGTGAAAGT
Sox9 TGCAGCACAAGAAAGACCAC
CCCTCTCGCTTCAGATCAAC
Tbx18 TGGGGAGACTTGGATGAGAC
GGACAGATCATCTCCGCAAT
Tshz3 AAGCATCATGCCGAGGAG
CTCCATCTGCCGCTTGTT
Ptch1 TACGTGGAGGTGGTTCATCA
AGGCATAGGCAAGCATCAGT
β-actin TGTTACCAACTGGGACGACA
GGGGTGTTGAAGGTCTCAAA

Results

Tbx18 mice mediate specific recombination in the ureteral mesenchyme and SMCs

Previous studies showed that nuclear lacZ (nlacZ) expression in the Tbx18 mice, and H2B-GFP expression in the Tbx18 mice faithfully recapitulated endogenous Tbx18 expression in various organs, including the heart, limb, somite and hair follicle during embryogenesis in mice [19], [25], [26]. We utilized Tbx18 and Tbx18 mice to examine Tbx18 expression in the developing ureter during mouse embryogenesis. X-gal staining revealed that Tbx18 is highly expressed in the ureter tube at E14.5-18.5 (Fig. 1A-C). Immunostaining indicated Tbx18 is confined to the developing ureteral mesenchyme and SMCs (Fig. 1D). Given the specific expression of Tbx18 during embryogenesis, we generated Tbx18 knock-in mice by inserting a Cre-polyA-FRT-Neo-FRT cassette into the start codon of Tbx18 locus (Fig. S1). Tbx18 mice were obtained by removing the Neo cassette through crossing Tbx18 mice to Flippase mice [21] (Fig. S1). Subsequently, we determined Tbx18 cell fates by crossing Tbx18 mice to Rosa26 reporter line [20]. Lineage analysis of Tbx18; Rosa26 doubly heterozygous animals revealed that Tbx18 progeny encompass ureteral mesenchyme and its corresponding smooth muscles, but not epithelial cells (urothelium) (Fig. 1E,F).
Figure 1

Expression and lineage analysis of Tbx18 in the developing ureters.

(A-C) Tbx18 expression in the developing ureters. A and B are whole-mount X-gal staining of Tbx18 urinary system at E14.5 and E18.5, respectively. C is a transverse section of the ureter tube at E18.5. (D) Immunostaining of α-SMA (red) on Tbx18 ureter (transverse section) at E18.5. (E,F) Immunofluorescence analysis of Smad4 with Tbx18 lineage on Tbx18 ureter at E16.5 and E18.5. Arrowheads indicate urothelium and arrows indicate ureter tube (A and B) or ureteral SMCs (C-F).

Expression and lineage analysis of Tbx18 in the developing ureters.

(A-C) Tbx18 expression in the developing ureters. A and B are whole-mount X-gal staining of Tbx18 urinary system at E14.5 and E18.5, respectively. C is a transverse section of the ureter tube at E18.5. (D) Immunostaining of α-SMA (red) on Tbx18 ureter (transverse section) at E18.5. (E,F) Immunofluorescence analysis of Smad4 with Tbx18 lineage on Tbx18 ureter at E16.5 and E18.5. Arrowheads indicate urothelium and arrows indicate ureter tube (A and B) or ureteral SMCs (C-F).

Disruption of Smad4 in the ureteral mesenchyme causes hydroureter and hydronephrosis

To investigate the potential role of Smad4 in ureter development, we first performed immunostaining and found that Smad4 is universally expressed in both ureteral mesenchyme and epithelial cells, and is co-expressed with Tbx18 lineages in the mesenchyme and SMCs (Fig. 1E,F, and data not shown for E13.5-E15.5). We examined Tbx18 ureters found they developed normally without defects at birth (P0) when compared to their wild type littermates (Fig. S2A,B). Further examination of Tbx18 mRNA expression in the ureters by quantitative RT-PCR (qRT-PCR) showed no significant difference between the wild type and Tbx18 mice at this stage (Fig. S2C). We crossed Tbx18 double heterozygous mice to Smad4 mice and Tbx18; Smad4 mutant animals (denoted as Smad4) were collected for analysis. Littermates with Tbx18 genotype were utilized as controls. To determine if Tbx18 mediates efficient recombination in the ureteral mesenchyme and SMCs, we performed immunostaining in the mutant tissues. It showed that Smad4 expression was absent in the ureteral mesenchyme and smooth muscles (notched arrows in Fig. 2, data not shown for E14.5), but was unaffected in ureteric epithelium (arrowheads in Fig. 2A-D), suggesting that Smad4 was specifically disrupted in ureteral mesenchyme and SMCs on Smad4 embryos. At E16.5, Smad4 embryos displayed a prominent bilateral hydroureter and hydronephrosis (Fig. 3A, B), and the defects became more severe at E18.5 (Fig. 3C,D). Histological analysis of these embryos showed dilated and thin-walled ureters with renal parenchymal atrophy and dilation of the renal pelvis (Fig. 3E-H). The mutant mice cannot survive beyond 24 hours after birth, whereas control mice with Tbx18; Smad4 genotype develop normally and can survive to adulthood without any apparent morphogenetic defects.
Figure 2

Inactivation of Smad4 in Smad4 ureter.

(A-D) Immunostaining of Smad4 in the control (A and C, Tbx18) and mutant ureters (B and D, Smad4) in the proximal and distal positions at E15.5. Arrowheads indicate urothelium and arrows indicate ureteral mesenchyme and SMCs.

Figure 3

Disruption of Smad4 leads to hydroureter and hydronephrosis.

(A-D) Morphology of urinary system in the control and mutant mice at E16.5 (A and B) and E18.5 (C and D). (E-H) Hematoxylin and Eosin staining of kidney sagittal sections (E1/F1/G1/H1), and transverse sections of ureter tube in the proximal (E2/F2/G2/H2) and distal positions (E3/F3/G3/H3) at E16.5 and E18.5. Arrows in B/D and E1/F1/G1/H1 indicate ureter tube, and in E2/F2/G2/H2 and E3/F3/G3/H3 indicate ureteral SMCs. Arrowheads indicate urothelium.

Inactivation of Smad4 in Smad4 ureter.

(A-D) Immunostaining of Smad4 in the control (A and C, Tbx18) and mutant ureters (B and D, Smad4) in the proximal and distal positions at E15.5. Arrowheads indicate urothelium and arrows indicate ureteral mesenchyme and SMCs.

Disruption of Smad4 leads to hydroureter and hydronephrosis.

(A-D) Morphology of urinary system in the control and mutant mice at E16.5 (A and B) and E18.5 (C and D). (E-H) Hematoxylin and Eosin staining of kidney sagittal sections (E1/F1/G1/H1), and transverse sections of ureter tube in the proximal (E2/F2/G2/H2) and distal positions (E3/F3/G3/H3) at E16.5 and E18.5. Arrows in B/D and E1/F1/G1/H1 indicate ureter tube, and in E2/F2/G2/H2 and E3/F3/G3/H3 indicate ureteral SMCs. Arrowheads indicate urothelium.

Smad4 is essential for ureteral mesenchymal cell differentiation

SMCs are essential for ureter peristalsis that propels urine towards bladder. Previous studies suggested that hydronephrosis and hydroureter could primarily result from malformed SMCs [2], [7], [8]. To determine whether the hydronephrosis and hydroureter defects in Smad4 embryos were due to insufficient differentiation of the ureteral SMCs, we examined mutant ureters with SMC markers. During embryonic development, ureteral SMC differentiation is characterized by increased expression of contractile SMC markers, such as α-SMA and SM-MHC [27], from E14.5 to E16.5. While we found α-SMA and SM-MHC were highly expressed in the ureteral SMCs at E15.5 and E16.5 in the controls, they could be barely detected in the mutant embryos (notched arrows in Fig. 4A-P). Similar observations were made for Myocardin (Myocd), a key regulator and marker of SMC differentiation, on E14.5 mutant ureters (notched arrows in Fig. 4Q,R). Further qRT-PCR showed that Myocd, Acta2 and Myh11 were down-regulated in the Smad4 ureters by 75%, 72% and 65% at E14.5, and by 78%, 81% and 81% at E15.5, respectively (Fig. 4S, p<0.01). Moreover, we investigated whether Smad4 deficiency in the ureteral mesenchyme also affects urothelium formation. Uroplakin, a marker for urothelium, was still expressed in the mutant embryos, suggesting that urothelial development was unaffected in Smad4 mice (arrowheads in Fig. 4A-H).
Figure 4

SMC differentiation is perturbed in Smad4 ureters.

(A-H) Immunostaining of α-SMA and Uroplakin in the control (A/C/E/G) and mutant ureters (B/D/F/H) at E15.5 and E16.5. Arrowheads indicate Uroplakin (urothelium) and arrows indicate α-SMA staining (SMCs). (I-P) Immunostaining of SM-MHC in the control (I/K/M/O) and mutant embryos (J/L/N/P) at E15.5 and E16.5. Arrowheads indicate urothelium and arrows indicate SMCs. (Q,R) RNA in situ hybridization revealed Myocd expression is downregulated in the mutants (arrows) at E14.5. (S) Relative expression of Myocd, Acta2 and Myh11 was determined by qRT-PCR in the mutant and control littermate ureters at E14.5 and E15.5.

SMC differentiation is perturbed in Smad4 ureters.

(A-H) Immunostaining of α-SMA and Uroplakin in the control (A/C/E/G) and mutant ureters (B/D/F/H) at E15.5 and E16.5. Arrowheads indicate Uroplakin (urothelium) and arrows indicate α-SMA staining (SMCs). (I-P) Immunostaining of SM-MHC in the control (I/K/M/O) and mutant embryos (J/L/N/P) at E15.5 and E16.5. Arrowheads indicate urothelium and arrows indicate SMCs. (Q,R) RNA in situ hybridization revealed Myocd expression is downregulated in the mutants (arrows) at E14.5. (S) Relative expression of Myocd, Acta2 and Myh11 was determined by qRT-PCR in the mutant and control littermate ureters at E14.5 and E15.5.

Increased apoptosis and decreased proliferation in Smad4 ureteral mesenchyme

Cell apoptosis and proliferation are highly associated with hydroureter during ureter development [2], [5], [28], [29]. We examined the effect of Smad4 deletion on cell apoptosis and proliferation in the ureteral mesenchyme. TUNEL analysis revealed no change of apoptosis in ureteric epithelium between control and mutant at E14.5. In contrast, we found a increased number of apoptotic cells in the mutant ureteral mesenchyme (Fig. 5A,B,E, control: 1.88±0.38%; mutant: 10.1±0.58%; p<0.01). Moreover, we assessed mesenchymal cell proliferation by EdU incorporation. The ureteral mesenchymal cell proliferation rate was ∼15% less in the Smad4 mutants at E14.5 (control: 16.93±1.44%; mutant: 14.32±1.22%; p<0.05), yet cell proliferation rate in the epithelium was unaffected (Fig. 5C,D,F, p>0.05). Consistent with these observations, expression of Mycn, a pro-proliferative factor, was significantly reduced in Smad4 ureters at E14.5 and E15.5 (Fig. 5G, p<0.05).
Figure 5

Apoptosis and cell proliferation in Smad4 ureters.

(A, B) Apoptosis was assessed by TUNEL. Arrows indicate TUNEL positive cells. (C, D) Cell proliferation was analyzed by EdU labeling. Arrows indicate proliferating cells. (E) Statistical analysis of TUNEL positive cells. (F) EdU positive cells were quantified. (G) Relative Mycn mRNA expression was measured by qRT-PCR.

Apoptosis and cell proliferation in Smad4 ureters.

(A, B) Apoptosis was assessed by TUNEL. Arrows indicate TUNEL positive cells. (C, D) Cell proliferation was analyzed by EdU labeling. Arrows indicate proliferating cells. (E) Statistical analysis of TUNEL positive cells. (F) EdU positive cells were quantified. (G) Relative Mycn mRNA expression was measured by qRT-PCR.

Sox9 and Tbx18 expression is down-regulated in Smad4 ureter

We next performed qRT-PCR to identify genes as potential downstream of Smad4 signaling for ureteral SMC differentiation. Given that Sox9, Tbx18, Tszh3 and Shh have been shown important in regulating ureteral SMC differentiation [2], [5], [7], [8], we assessed the effect of Smad4 deficiency on these genes during mouse embryonic development. qRT-PCR revealed ∼38% reduction in Sox9 and ∼53% reduction in Tbx18 on the mutant ureters at E14.5, and ∼31% reduction in Sox9 and ∼50% reduction in Tbx18 at E15.5 (p<0.05), yet Tszh3 and Ptch1 (receptor of Shh) expression was not significantly changed (Fig. 6A, p>0.05). Further immunostaining and RNA in situ hybridization showed that Sox9 was down-regulated in the mutant ureteral mesenchyme as early as E13.5 (Fig. 6B,C), and Tbx18 mRNA was significantly decreased in the mutant mesenchyme at E13.0 (Fig. 6D,E). These data suggest that Sox9 and Tbx18 may act as downstream of Smad4 to govern ureteral smooth muscle differentiation during mouse embryogenesis.
Figure 6

Reduced Sox9 and Tbx18 expression in Smad4 ureters.

(A) qRT-PCR was performed to determine expression of Sox9, Tbx18, Tshz3 and Ptch1. (B,C) Immunostaining of Sox9 in control (B) and mutant embryos (C) at E13.5. (D,E) RNA in situ hybridization of Tbx18 in the control (D) and mutant embryos (E) at E13.0, respectively. Arrows indicate positive staining of cells in the controls with corresponding regions in the mutants.

Reduced Sox9 and Tbx18 expression in Smad4 ureters.

(A) qRT-PCR was performed to determine expression of Sox9, Tbx18, Tshz3 and Ptch1. (B,C) Immunostaining of Sox9 in control (B) and mutant embryos (C) at E13.5. (D,E) RNA in situ hybridization of Tbx18 in the control (D) and mutant embryos (E) at E13.0, respectively. Arrows indicate positive staining of cells in the controls with corresponding regions in the mutants.

Discussion

Although a few genes (e.g., Tbx18, Sox9, Tszh3 and β-catenin) have been identified crucial for ureter development [2], [7]–[9], the interaction network of these genes with other factors in regulating ureteral SMC development remains to be determined. In this study, we found loss of Smad4 in the ureteral mesenchyme led to failure of SMC differentiation, resulting in severe hydroureter and hydronephrosis during mouse embryogenesis. Smad4 acts as upstream of Sox9, Tbx18 and Myocardin, and is required for their normal expressions in ureter development [2], [8].

Tbx18 mouse model as a robust genetic tool to study ureteral mesenchyme and SMC development

The expression analysis of Tbx18 with Tbx18 and Tbx18 mice revealed that Tbx18 was specifically expressed in the ureteral mesenchyme and SMCs (Fig.1A-D), consistent with the RNA in situ hybridization[2]. Lineage tracing experiments with Tbx18; Rosa26 animals revealed Tbx18 progeny include undifferentiated ureteral mesenchyme and its SMC derivatives, but not ureteric epithelium. Therefore, the Tbx18 animal could be utilized as an excellent genetic tool to dissect functions of genes in the developing ureteral mesenchyme and/or SMCs during mouse embryogenesis with Cre-loxP technology. Comparing to Tbx18 knock-in mice, Pax3-Cre transgenic line introduces recombination in ureteral mesenchyme (including SM layers and the adventitia) and metanephric mesenchyme (including the glomeruli and the proximal and distal tubules) [28]. The BAC transgenic Tbx18-Cre line was also generated [30]. However, it may not fully recapitulate endogenous Tbx18 expression thus it is not clear whether it introduces effective recombination in all the ureteral mesenchymal cells. Evidence in supporting this argument is thatTbx18-Cre mouse seems not able to mediate effective recombination in the somites of mouse embryos [30].

Smad4 is required for ureteral SMC differentiation from mesenchyme

Previous studies demonstrated that Bmp4 plays an important role in ureter development [10], [12], [31]. Smad4 is a central mediator of TGF-β/Bmp signaling pathway [32], [33] and it regulates morphogenesis of various organs during embryonic development [34]–[36]. Our study showed that Smad4 is expressed in both ureteral mesenchyme and epithelium during ureter development. Mice with genetic deletion of Smad4 in ureteral mesenchyme displayed hydroureter and hydronephrosis as early as E16.5, and the mutant mesenchymal cells failed to differentiate into SMCs at E15.5. Myocd, a critical transcription factor required for expression of SMC contractile proteins (αSMA, SM22α and SM-MHC) [37], is dramatically down-regulated in the mutant ureters. Ureter SMC developmental defects are highly associated with defective cell proliferation and survival [9], [10], [28]. In Smad4 embryos, we also detected less proliferative ureteral mesenchymal cells with apoptosis at E14.5. The increased mesenchymal cell death in Smad4 mice may be attributed to the reduced Myocd expression, given that Myocd is required for cell survival [38]. Furthermore, loss of Smad4 resulted in down-regulation of Mycn in the ureter. Mycn (Nmyc) is a Myc transcription factor and it plays critical roles in cell proliferation [16], [39], [40]. In the developing hearts, Mycn is a direct downstream target of Smad4 and inactivation of Smad4 down-regulates Mycn expression [39]. Mycn may play a key role in Smad4-mediated signaling cascades for the ureteral mesenchymal cell proliferation. Collectively, these observations suggested that Smad4 signals are crucial for SMC differentiation, proliferation and survival during ureter development. A recent study has attempted to disrupt Smad4 with Tbx18-Cre transgenic line, and the mutant embryos displayed hydronephrosis at E17.5 [17]. The defects in these animals were not as severe as our Smad4 mice: although the ureteral SMC number was reduced, SMC differentiation still occurred and thickness of smooth muscle layer was not affected. Moreover, no significant difference was found in cell survival and proliferation in the mesenchyme or SMCs. The discrepancies may be due to Cre excision efficiency: Tbx18-Cre transgenic line may not able to mediate efficient excision in the ureteral mesenchymal cells [17]. Some of the mesenchymal cells in the mutant ureters may still maintain Smad4 expression and thus develop normally into SMCs. Tbx18 knock-in mouse line used in our study can mediate efficient ablation in almost all the ureteral mesenchymal cells (Fig. 2A-D), and therefore SMC differentiation does not occur in Smad4 ureters.

Sox9 and Tbx18 act as downstream of Smad4 during ureteral mesenchymal cell development

Genetic regulation of ureteral SMC differentiation is a complex process. Pathways underlying this process are still largely to be determined. To date, a few genes, including Sox9 and Tbx18, were identified as key regulators for ureteral SMC differentiation [2], [8]. Sox9 is a transcription factor highly expressed in ureteral mesenchyme at E12.5 and E13.5 [41]–[43]. Deletion of Sox9 in ureteral mesenchyme results in hydroureter and hydronephrosis [8], mimicking defects in Smad4 embryos (Fig. 3A-D). Mesenchymal cells in Sox9 ureters do not differentiate into SMCs [8]. Sox9 and Tshz3 regulate smooth muscle differentiation program by controlling the activity of Myocd [44], a key regulator for SMC differentiation [45]–[47]. Previous studies also showed that Smad4 regulates Sox9 expression in limb and heart development [48], [49]. In Smad4 embryos, we also found Sox9 expression was down-regulated (Fig. 6A-C). Tbx18 is a transcription factor highly expressed in ureteral mesenchyme and is essential for SMC differentiation [2], [50]. Loss of Tbx18 in mice results in defective mesenchymal cell proliferation and SMC differentiation [2], similar to Smad4 embryos. Disruption of Smad4 down-regulates Tbx18 expression (Fig. 6A,D,E). Based on these observations, we speculate that Smad4 may act as upstream of both Sox9 and Tbx18, and that Smad4-Sox9/Tbx18 signaling cascades may regulate ureteral mesenchymal cell development through Myocd. In addition, microRNA-21 (miR-21) has been shown to promote vascular SMC differentiation by inducing expression of SMC contractile proteins including αSMA, calponin and SM22a [51]. MiR-21 also regulates vascular SMC growth and survival by silencing expression of PTEN and increasing expression of BCL2 [52]. TGF-β and Bmps (Bmp4) signaling elevates the expression of mature miR-21 [51], [53]. It is not certain whether miR-21 mediates ureteral SMC differentiation as downstream of Smad4, although miR-21 biogenesis in the vascular SMCs is only regulated by ligand-specific Smad proteins [51]. In the future, it will be of interest to determine whether Smad4 directly activates the expression of Sox9/Tbx18/Myocd by binding their regulatory elements, and whether miR-21 is affected by Smad4 during ureteral development. Furthermore, given the critical roles of Smad4 in ureter development, it will be also of interest to perform genetic studies to determine whether Smad4 and its associated downstream genes Sox9, Tbx18, and Myocd are mutated in human patients with congenital urinary tract malformations. Generation of knock-in mouse. (A) Schematic representation of targeting strategy. A Cre-polyA-FRT-Neo-FRT cassette was introduced into the Tbx18 genomic locus (6 bp upstream of the ATG). The Neo cassette is flanked by two FRT sites. Tbx18 mice were generated from the positive ES cells. Flippase deleter mice were crossed to Tbx18 mice to remove Neo cassette. (B) Long range PCR analysis of genomic DNA from targeted ES cells. A 4.2-kb fragment was amplified with 5′ primer external to the 5′ arm (P1) and 3′ primer within Neo cassette (P2). (TIF) Click here for additional data file. Normal ureter development in mice. (A,B) Comparisons of the urinary system from Tbx18 knock-in mice and their wild type littermates at birth (P0). (C) Tbx18 mRNA expression in ureters measured by qRT-PCR does not show significant difference between Tbx18 and wild type mice. β-actin was used as an internal reference gene. (JPG) Click here for additional data file. ARRIVE Checklist. (DOC) Click here for additional data file.
  52 in total

1.  Cloning and expression analysis of the mouse T-box gene Tbx18.

Authors:  F Kraus; B Haenig; A Kispert
Journal:  Mech Dev       Date:  2001-01       Impact factor: 1.882

2.  Cerebellar deficits and hyperactivity in mice lacking Smad4.

Authors:  Yong-Xing Zhou; Mingrui Zhao; Dan Li; Kazuhiro Shimazu; Kazuko Sakata; Chu-Xia Deng; Bai Lu
Journal:  J Biol Chem       Date:  2003-08-01       Impact factor: 5.157

3.  The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6.

Authors:  Haruhiko Akiyama; Marie-Christine Chaboissier; James F Martin; Andreas Schedl; Benoit de Crombrugghe
Journal:  Genes Dev       Date:  2002-11-01       Impact factor: 11.361

4.  Bone morphogenetic protein 4 regulates the budding site and elongation of the mouse ureter.

Authors:  Y Miyazaki; K Oshima; A Fogo; B L Hogan; I Ichikawa
Journal:  J Clin Invest       Date:  2000-04       Impact factor: 14.808

5.  Widespread recombinase expression using FLPeR (flipper) mice.

Authors:  F W Farley; P Soriano; L S Steffen; S M Dymecki
Journal:  Genesis       Date:  2000 Nov-Dec       Impact factor: 2.487

6.  Urothelial function reconsidered: a role in urinary protein secretion.

Authors:  F M Deng; M Ding; R M Lavker; T T Sun
Journal:  Proc Natl Acad Sci U S A       Date:  2001-01-02       Impact factor: 11.205

7.  Generation of Smad4/Dpc4 conditional knockout mice.

Authors:  Xiao Yang; Cuiling Li; Pedro-Luis Herrera; Chu-Xia Deng
Journal:  Genesis       Date:  2002-02       Impact factor: 2.487

8.  Myocardin is a master regulator of smooth muscle gene expression.

Authors:  Zhigao Wang; Da-Zhi Wang; G C Teg Pipes; Eric N Olson
Journal:  Proc Natl Acad Sci U S A       Date:  2003-05-19       Impact factor: 11.205

9.  Evidence that bone morphogenetic protein 4 has multiple biological functions during kidney and urinary tract development.

Authors:  Yoichi Miyazaki; Keisuke Oshima; Agnes Fogo; Iekuni Ichikawa
Journal:  Kidney Int       Date:  2003-03       Impact factor: 10.612

10.  Sonic hedgehog regulates proliferation and differentiation of mesenchymal cells in the mouse metanephric kidney.

Authors:  Jing Yu; Thomas J Carroll; Andrew P McMahon
Journal:  Development       Date:  2002-11       Impact factor: 6.868

View more
  7 in total

1.  Smad4 deficiency impairs chondrocyte hypertrophy via the Runx2 transcription factor in mouse skeletal development.

Authors:  Jianyun Yan; Jun Li; Jun Hu; Lu Zhang; Chengguo Wei; Nishat Sultana; Xiaoqiang Cai; Weijia Zhang; Chen-Leng Cai
Journal:  J Biol Chem       Date:  2018-05-07       Impact factor: 5.157

Review 2.  Smooth muscle: a stiff sculptor of epithelial shapes.

Authors:  Jacob M Jaslove; Celeste M Nelson
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2018-09-24       Impact factor: 6.237

3.  Fluid mechanics as a driver of tissue-scale mechanical signaling in organogenesis.

Authors:  Rachel M Gilbert; Joshua T Morgan; Elizabeth S Marcin; Jason P Gleghorn
Journal:  Curr Pathobiol Rep       Date:  2016-09-29

4.  Activated Hedgehog-GLI Signaling Causes Congenital Ureteropelvic Junction Obstruction.

Authors:  Sepideh Sheybani-Deloui; Lijun Chi; Marian V Staite; Jason E Cain; Brian J Nieman; R Mark Henkelman; Brandon J Wainwright; S Steven Potter; Darius J Bagli; Armando J Lorenzo; Norman D Rosenblum
Journal:  J Am Soc Nephrol       Date:  2017-11-06       Impact factor: 10.121

5.  A Murine Myh6MerCreMer Knock-In Allele Specifically Mediates Temporal Genetic Deletion in Cardiomyocytes after Tamoxifen Induction.

Authors:  Jianyun Yan; Lu Zhang; Nishat Sultana; David S Park; Akshay Shekhar; Lei Bu; Jun Hu; Shegufta Razzaque; Chen-Leng Cai
Journal:  PLoS One       Date:  2015-07-23       Impact factor: 3.240

6.  ISL1 is a major susceptibility gene for classic bladder exstrophy and a regulator of urinary tract development.

Authors:  Rong Zhang; Michael Knapp; Kentaro Suzuki; Daiki Kajioka; Johanna M Schmidt; Jonas Winkler; Öznur Yilmaz; Michael Pleschka; Jia Cao; Christina Clementson Kockum; Gillian Barker; Gundela Holmdahl; Glenda Beaman; David Keene; Adrian S Woolf; Raimondo M Cervellione; Wei Cheng; Simon Wilkins; John P Gearhart; Fabio Sirchia; Massimo Di Grazia; Anne-Karolin Ebert; Wolfgang Rösch; Jörg Ellinger; Ekkehart Jenetzky; Nadine Zwink; Wout F Feitz; Carlo Marcelis; Johannes Schumacher; Federico Martinón-Torres; Martin Lloyd Hibberd; Chiea Chuen Khor; Stefanie Heilmann-Heimbach; Sandra Barth; Simeon A Boyadjiev; Alfredo Brusco; Michael Ludwig; William Newman; Agneta Nordenskjöld; Gen Yamada; Benjamin Odermatt; Heiko Reutter
Journal:  Sci Rep       Date:  2017-02-08       Impact factor: 4.379

7.  Involvement of the bone morphogenic protein/SMAD signaling pathway in the etiology of congenital anomalies of the kidney and urinary tract accompanied by cryptorchidism.

Authors:  Kentaro Mizuno; Akihiro Nakane; Hidenori Nishio; Yoshinobu Moritoki; Hideyuki Kamisawa; Satoshi Kurokawa; Taiki Kato; Ryosuke Ando; Tetsuji Maruyama; Takahiro Yasui; Yutaro Hayashi
Journal:  BMC Urol       Date:  2017-12-02       Impact factor: 2.264

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.