Mutation analysis of key genes in RAS/RAF and PI3K/PTEN pathways in Chinese patients with hepatocellular carcinoma.

The RAS/RAF and PI3K/PTEN signaling pathways play central roles in hepatocarcinogenesis. KRAS, NRAS, HRAS, BRAF, PIK3CA, PIK3R1 and PTEN are key cancer-related genes in the RAS/RAF and PI3K/PTEN signaling pathways. Genetic alterations in these genes often lead to the dysregulation of the two cascades. Little is known regarding the frequency of hotspot mutations in these critical components among Chinese patients with hepatocellular carcinoma (HCC). In the current study, 57 somatic hotspot mutations in 36 HCCs samples collected from Chinese patients using direct DNA sequencing method were examined. Two cases of KRAS somatic mutations (KRAS codon 61; Gln to His) were identified among 36 HCCs (5.6%). However, no mutations were found in the NRAS, HRAS, BRAF, PIK3CA, PIK3R1 and PTEN genes. These findings indicated that point mutations in the KRAS gene, but not mutations in NRAS, HRAS, BRAF, PIK3CA, PIK3R1 and PTEN genes, at a somatic level contribute to the abnormal activation of the RAS/RAF and PI3K/PTEN pathways in HCC.

Introduction

Hepatocellular carcinoma (HCC) is one of the most common malignancies worldwide, accounting for >740,000 new cases and 690,000 mortalities per year (1). Half of these new cases and mortalities were estimated to occur in China. The high rates of HCC in China are largely due to the prevalence of chronic hepatitis B virus (HBV) infection (2). The RAS/RAF and PI3K/PTEN signaling pathways play central roles in hepatocarcinogenesis (3). The aberrant activation of the RAS/RAF and PI3K/PTEN signaling pathways is associated with poor prognosis in cancer patients (4,5). HBV also utilizes the pathways for the control of hepatocyte survival and viral replication (6,7). Mutations of key components (such as RAS, RAF, PIK3CA, PIK3R1 and PTEN) in the RAS/RAF and PI3K/PTEN pathways lead to the dysregulation of the two cascades (8). The RAS family comprises three members: KRAS, NRAS and HRAS. Somatic mutations in the RAS family are common in numerous human cancer types, including pancreatic, thyroid, colorectal, liver, kidney and lung (9). BRAF is the most frequently mutated gene in the RAF family, and the BRAF mutation has been reported in 61% of melanoma, 53% of papillary thyroid cancer and 11.5% of colorectal cancer patients (10–12). The PI3K gene comprises PIK3CA, which encodes the catalytically active p110α subunit, and PIK3R1, encoding the p85α regulatory subunit (13). PIK3CA is mutated in numerous tumor types, with the frequency ranging from 4 to 32% in breast, colorectal, endometrial, brain, gastric and lung cancer (14–17). PIK3R1 mutations were identified in 43% of endometrial cancer, 4% of ovarian cancer and 2% of colon cancer (18–19). PTEN acts as a negative regulator of the PI3K pathway and PTEN mutations lead to a reduction of its phosphatase activity (20). Mutations of the PTEN gene are associated with a wide variety of human tumors (21).

Inhibitors targeting the RAS/RAF and PI3K/PTEN pathways have been developed and the clinical responses of patients were observed to differ according to the genetic alterations of the critical components of the two cascades (22). However, few data are available regarding the prevalence of KRAS, NRAS, HRAS, BRAF, PIK3CA, PIK3R1 and PTEN mutations in Chinese patients with HCC. In the present study, we conducted mutational analysis of 57 somatic hotspot mutations in KRAS, NRAS, HRAS, BRAF, PIK3CA, PIK3R1 and PTEN in 36 Chinese patients with HCC.

Materials and methods

Patients and tissue samples

Thirty-six patients with HCC undergoing surgery at Nantong Tumor Hospital (Nantong, China) between 2009 and 2011 were enrolled in this study. Tumor samples and adjacent normal liver tissues from the corresponding patients were fixed with 10% formalin, embedded in paraffin and stained with hematoxylin and eosin (H&E). Tumor staging was performed according to the Barcelona Clinic Liver Cancer (BCLC) staging classification (23). This study was approved by the Ethics Committee of Nantong Tumor Hospital. Written informed consent was obtained from each patient prior to sample collection.

Genomic DNA extraction

Tumor areas and non-tumorous tissue areas were identified on H&E-stained slides. Genomic DNA was extracted from formalin-fixed paraffin-embedded tissues of HCC with the QIAamp DNA FFPE Tissue kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. Briefly, samples were placed into Eppendorf tubes and the paraffin was removed. Next, the tubes were incubated with proteinase K (Qiagen GmbH) at 56°C for 1 h. Following proteinase K digestion, the samples were incubated at 90°C for 1 h and DNA was extracted using QIAamp MinElute columns (Qiagen GmbH).

Mutation analysis

Polymerase chain reaction (PCR) was performed to amplify the gene fragments including the hotspot mutations shown in Table I. The selection of the hotspots was based on the prevalence of mutations in cancers identified in the COSMIC database (24). A 50 μl volume of PCR was prepared using the Taq PCR Master Mix kit (Qiagen GmbH), according to the manufacturer’s instructions. The thermocycling was performed at 94°C for 3 min; 35 cycles of 94°C for 30 sec, 56°C for 30 sec and 72°C for 60 sec; followed by a final 10 min at 72°C. PCR products were run on 1.5% agarose gel electrophoresis and visualized with ultraviolet light to confirm sizes. DNA purification was performed with the QIAprep Gel Extraction kit (Qiagen GmbH) according to the manufacturer’s instructions. Briefly, the DNA fragments were excised from the agarose gel with a scalpel and placed in a colorless tube. DNA cleanup was conducted using QIAquick spin columns (Qiagen GmbH). Direct DNA sequencing was performed using a Big Dye Terminator (v3.1) kit (Applied Biosystems, Foster City, CA, USA). The sequencing products were run on an Applied Biosystems 3130XL Genetic Analyzer (Applied Biosystems). DNA sequencing results were analyzed using Chromas software (Technelysium, Brisbane, Queensland, Australia). The primers used for the PCR are listed in Table I.

Table I

Primers used for polymerase chain reaction in this study.

Gene	Mutation	Forward primer sequence (5′ to 3′)	Reverse primer sequence (5′ to 3′)
KRAS	G12C, G12D, G13S, G13D, L19F, Q22K	CTTAAGCGTCGATGGAGGAG	CCCTGACATACTCCCAAGGA
	A59T, Q61E, Q61R, Q61H	GGTGCTTAGTGGCCATTTGT	CCTAGGTTTCAATCCCAGCA
	A146T	TTGTGGACAGGTTTTGAAAGA	AGAAACCAAAGCCAAAAGCA
NRAS	G12S, G12V, G13R, G13V, A18T	GCCCAAGGACTGTTGAAAAA	CCGACAAGTGAGAGACAGGA
	Q61K, Q61R, Q61H	GGCAGAAATGGGCTTGAATA	AGGTTAATATCCGCAAATGAC
HRAS	G12S, G12V, G13R, G13D	GTGGGTTTGCCCTTCAGAT	TGGTGGATGTCCTCAAAAGA
	Q61K, Q61R, Q61H	TGGCTGTGTGAACTCCCC	GTCAGTGAGTGCTGCTCCC
BRAF	G464V, G466V, G469A, V471F	CACTTGGTAGACGGGACTCG	AGTTTATTGATGCGAACAGTGA
	D594G, L597V, V600E	AACTCTTCATAATGCTTGCTCTGA	AGCCTCAATTCTTACCATCCA
PIK3CA	R38G, Q75E, R108H	GCCTAATCAAGTCAAACTATGGAA	AAGCTTTATGGTTATTTGCATTTT
	G118D	ATGTTTGCTGCCTTTGCTCT	ATAAGCAGTCCCTGCCTTCA
	C378R	TAAGGGGATTGTGGGCCTAT	AATGGGGTCTTGCTTTGTTG
	C420R	CTCATGCTTGCTTTGGTTCA	TTGGCATGCTCTTCAATCAC
	P539R, E542K, E545K, E545G, Q546K	GATTGGTTCTTTCCTGTCTCTG	CCACAAATATCAATTTACAACCATTG
	T1025A, M1043T, M1043I, H1047Y, H1047R, H1047L	CATTTGCTCCAAACTGACCA	CACCCCAAGCATTTTTCTTC
PIK3R1	G376R	CAGACGGGACCTTTTTGGTA	AACAAAATAGCTGACATGGAAACA
	K459E, D464H	GGCTTCTCTGACCCATTAACC	CCCCACCTCATTCGTAAAAA
	L570P	GGAAGAGAAGCCACGCTTTA	CCCAACCACTCGTTCAACTT
PTEN	R130G, R130Q	CCGTATAGCGTAAATTCCCAGA	TCTCAGATCCAGGAAGAGGAA
R233X	TGCTTGAGATCAAGATTGCAG	GCCATAAGGCCTTTTCCTTC

Results

Clinicopathological characteristics

Of 36 patients with HCC, the median age was 54 years (range, 40–77 years), including 33 males and three females. The majority of the cases had HCC associated with HBV infection (34/36; 94.4%). All patients were negative in hepatitis C virus infection. The concentrations of serum AFP of 16 patients (16/36; 44.4%) were higher than 400 ng/ml. The BCLC staging classification was used to classify the cancer staging (23). There were 2, 25, 8, 1 and 0 cases of stages 0 to D, respectively (Table II).

Table II

Clinical characteristics of hepatocellular carcinoma patients.

Characteristic	Value
Age, years
Median (range)	54 (40–77)
Gender, n (%)
Male	33 (91.7)
Female	3 (8.3)
Etiology, n (%)
HBV(+)	34 (94.4)
HBV(−)	2 (5.6)
AFP, n (%)
>400 ng/ml	16 (44.4)
≤400 ng/ml	20 (55.6)
Stage, n (%)
0	2 (5.6)
A	25 (69.4)
B	8 (22.2)
C	1 (2.8)
D	0 (0.0)

Mutation analysis of key genes in the RAS/RAF and PI3K/PTEN pathways

We analyzed hotspot-containing gene fragments of key genes in RAS/RAF and PI3K/PTEN pathways using PCR amplification followed by direct sequencing. The hotspots were listed in Table I. In all, two samples (Sample #13 and #35) had point mutations in codon 61 (Q61H) of the KRAS gene and the mutation rate was 5.6% (Fig. 1). In the two cases, codon 61 was altered from CAA, coding for Gln, to CAC, coding for His. To confirm the two mutations occurred at the somatic level, we tested codon 61 mutation status in non-tumorous tissues from the two patients. The results showed that codon 61 was wild-type in normal tissues from Sample #13 and #35 (Fig. 1). The two patients harboring KRAS mutation were male. Patient no. 13 was 49 years old, had HBV infection and stage A HCC, and an AFP level of 3.4 ng/ml. Patient no. 35 was 69 years old, had stage B HCC and was negative for HBV infection, with an AFP level of 1.95 ng/ml. No other mutations in the HRAS, NRAS, BRAF, PIK3CA, PIK3R1 and PTEN genes were identified.

Figure 1

Sequence analysis of KRAS gene mutation in codon 61 in two hepatocellular carcinoma cases. Sequence chromatograms of codon 61 in tumor and normal tissues from (A) Sample #13 and (B) Sample #35.

Discussion

Targeting the RAS/RAF and PI3K/PTEN pathways are novel therapeutic strategies that may be exploited for the treatment of HCC (8). As the RAF-kinase inhibitor sorafenib has been demonstrated to be effective in the treatment of HCC, BRAF mutations have become a favored target in HCC treatment recently (25). However, the somatic mutation prevalence and distribution of the key genes in the two pathways remain largely unknown in Chinese patients with HCC. Therefore, the present study set out to examine the frequency of hotspot mutations of the KRAS, NRAS, HRAS, BRAF, PIK3CA, PIK3R1 and PTEN genes in 36 human HCC tissues from Chinese patients. Only KRAS somatic mutations were identified, with a mutation rate of 5.6%.

The incidence of KRAS mutations has been found in 80% of advanced pancreatic cancer (26), 45% of cholangiocarcinoma (27) and 32% of colorectal cancer (28) patients. COSMIC database has shown that mutations in codons 12, 13 and 61 of the KRAS gene are known hotspots in various types of cancer. The frequency and distribution of KRAS mutation in HCC from several previous studies are summarized in Table III. The majority of these studies have shown that KRAS gene mutations occur infrequently (<10%) in HCC. The codon 12 accounts for the majority of KRAS mutations detected (~70%), whereas mutations affecting codon 13 and codon 61 account for the remaining 30%. One third of the twelve studies did not evaluate the KRAS codon 61 mutation status, which may cause bias in the distribution of the KRAS mutation. Three whole exome sequencing studies conducted mutational screening in all KRAS exons and found that the mutations were clustered in the hotspots (29–31). In the current study, mutations were detected in codons 12, 13 and 61 of the KRAS gene, and two out of 36 (5.6%) HCCs harbored KRAS mutations in codon 61. Therefore, KRAS gene mutations may participate in hepatocellular carcinogenesis.

Table III

Reported point mutations in codons 12, 13, and 61 of KRAS in hepatocellular carcinomas.

Author (ref)	Population	No. of patients	Codon 12	Codon 13	Codon 61	Frequency (%)
Zuo et al (36)	Chinese	64	2	1	NA	4.7
Huang et al (31)	Chinese	10	0	0	0	0.0
Taketomi et al (33)	Japanese	61	0	1	0	1.6
Tsuda et al (43)	Japanese	30	1	0	0	3.3
Taniguchi et al (44)	Japanese	15	0	0	NA	0.0
Fujimoto et al (29)	Japanese	27	0	0	0	0.0
Tada et al (45)	Japanese	12	0	0	0	0.0
Bose et al (46)	Indian	30	2	0	0	6.7
Tannapfel et al (27)	German	25	0	0	NA	0.0
Weihrauch et al (47)	German	20	3	0	NA	15.0
Challen et al (32)	British	19	0	NA	1	5.3
Guichard et al (30)	French	149	1	0	1	1.3
Colombino et al (37)	Italian	65	1	0	0	1.5

NA, not available.

The present study also investigated the hotspot mutations in NRAS and HRAS, but found no mutation in the two genes. Few studies have focused on the mutation incidence of these two RAS family members in Chinese patients with HCC. A whole exome sequencing study identified no mutation in these two genes in a Chinese population (31). Challen et al found that the frequency of NRAS mutations was 15.8%, but did not identify HRAS mutations, in British patients with HCC (32). Taketomi et al reported neither NRAS nor HRAS mutations were detected in Japanese HCC cases (33). Thus, the mutational activation of NRAS and HRAS genes is an uncommon event in the pathogenesis of HCCs.

BRAF mutations can abnormally activate downstream signaling pathways in HCC and act as indicator of cetuximab resistance in patients with colon cancer (34,35). BRAF mutations are believed to be rare in HCCs. Previously, no BRAF mutations were identified in German and Chinese populations (27,36). However, Colombino et al detected that the BRAF gene was highly mutated in ~23% of Italian HCC cases (37). In the current series, no BRAF mutations were observed, indicating that BRAF mutation does not play a major role in abnormal activation of RAS/RAF signaling pathway.

PIK3CA, PIK3R1 and PTEN are key genes in the PI3K/PTEN pathway (8). In the current study, it was found that mutations were absent in the three genes. Previously, PIK3CA was observed to be frequently mutated in Korean and Italian patients with HCC, with mutation rates of 35.6 and 28%, respectively (15,37). However, Tanaka et al did not identify PIK3CA mutations in Japanese patients with HCC, and Riener et al reported that the PIK3CA mutation incidence was 2% in Swiss patients with HCC (38,39). In two studies in Chinese patients with HCC, the mutation rates were 1.6 and 1.1% (36,40), which were similar to those of the present study. The conflicting data may be due to the different genetic backgrounds of the populations, HBV infection status and smaller sample size in the current study. PIK3R1 mutation has been found to occur infrequently in numerous cancer types, including ovarian and colon cancer (19), and the present study showed a low frequency of alteration of PIK3R1 in HCC. Inactivation of PTEN in HCC may be largely due to frequent loss of heterozygosity of the PTEN allele; the frequency was identified to be ≤44.4% (41). Wang et al investigated PTEN mutations in exons 5 and 8, but failed to detect any (42), which was in agreement with the results of the present study. Mutations in the PIK3CA, PIK3R1 and PTEN genes rarely occur in HCC, suggesting that somatic point mutations of these three genes may not play an important role in HCC in the Chinese population. However, further research is necessary to confirm these results in larger sample size.

In summary, the present study investigated the prevalence of KRAS, NRAS, HRAS, BRAF, PIK3CA, PIK3R1 and PTEN mutations in 57 hotspot mutations. Two cases of KRAS mutation were identified among 36 HCC cases. The findings indicated that point mutations in the KRAS gene, but not mutations in the NRAS, HRAS, BRAF, PIK3CA, PIK3R1 and PTEN genes, at the somatic level contribute to the abnormal activation of the RAS/RAF and PI3K/PTEN pathways in HCC. Considering the low frequency of key genes in the RAS/RAF and PI3K/PTEN signaling pathways, other mechanisms to activate the RAS/RAF and PI3K/PTEN pathways, such as gene amplification, deletion, and aberrant methylation, may be involved in the development and progression of HCC.