Literature DB >> 25075521

The transaldolase, a novel allergen of Fusarium proliferatum, demonstrates IgE cross-reactivity with its human analogue.

Hong Chou1, Keh-Gong Wu2, Chang-Ching Yeh3, Hsiao-Yun Tai1, Ming F Tam4, Yu-Sen Chen1, Horng-Der Shen1.   

Abstract

Fusarium species are among airborne fungi and recognized as causative agents of human atopic disorders. However, Fusarium allergens have not been well characterized and the lack of information limits clinical diagnosis and treatment of fungal allergy. The purpose of this study is to identify and characterize important allergens of F. proliferatum. IgE-reacting F. proliferatum components were identified by immunoblot using serum samples from patients of respiratory atopic diseases. Characterization of allergens and determination of IgE cross-reactivity were performed by cDNA cloning, then homologous expression and immunoblot inhibition studies. We identified nine different F. proliferatum components that can be recognized by IgE antibodies in 17 (28%) of the 60 atopic sera tested. Components with molecular masses of about 43, 37.5 and 36.5 kDa with IgE-binding frequencies of about 88, 47 and 53%, respectively, were considered as important allergens of F. proliferatum. The 37.5 kDa IgE-binding component was putatively considered as a transaldolase protein of F. proliferatum. The full-length cDNA of F. proliferatum transaldolase was subsequently cloned. It encodes an open reading frame of 312 amino acids and has sequence identifies of 73 and 61%, respectively, with Cladosporium and human transaldolases. The purified recombinant F. proliferatum transaldolase can inhibit the IgE-binding against the 37.5 kDa component of F. proliferatum and the transaldolase allergen from Cladosporium cladosporioides. More importantly, the recombinant F. proliferatum transaldolase can inhibit IgE-binding against human transaldolase in a concentration-dependent manner. Thus, a novel and important F. proliferatum transaldolase allergen was identified. In addition to IgE cross-reactivity between the Fusarium and the Cladosporium transaldolase allergens, IgE cross-reactivity between the Fusarium and the human transaldolases also exists and might contribute to atopic manifestations in the absence of exogenous allergen exposure.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25075521      PMCID: PMC4116196          DOI: 10.1371/journal.pone.0103488

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The prevalence of human atopic diseases including allergic rhinitis and asthma is increasing during recent decades [1]. Sensitization to molds which are ubiquitous in our environment has been reported to be close to 80% of asthmatic patients [2]. Hence, it is important to characterize fungal allergens and subsequently provide a basis for better diagnosis and treatment of fungal allergy [2]–[4]. However, fungal allergens are difficult to be defined since multitudinous factors contribute to the results obtained [3], [5]. Due to these inherent difficulties, the manufacturing of standardized and high quality fungal allergen extracts is not available in the United States [4]. It highlights the necessity of characterizing important fungal allergens [2]–[4]. Cladosporium species are the dominant airborne spores worldwide [3]. In addition, Alternaria, Aspergillus, Penicillium and Fusarium species are also airborne fungi in many areas including Taipei [6]–[8]. Cladosporium and Alternaria are clinically important causative allergenic agents for patients sensitive to fungi [2]. Fusarium fungus can emit large amount of spores in rainy or humid enrivonment [9]. Thus, it is of interest to study the relevance of Fusarium fungus to allergic sensitization. Chang et al. [10] tested a list of 54 air-borne allergens in 66 bronchial asthma patients in the Taipei area, and 20 (30%) of the patients showed positive skin reaction to Fusarium extracts. O’Neil et al. [11] found that among 69 atopic individuals tested in United States, 17 (24%) of the patients had positive skin reactions to an extract of F. solani. Stroud et al. [12] reported that reactivity to fungi was found in 65% of chronic rhinitis patients and reactions to Fusarium (58%), Alternaria (39%) and Pullularia (38%) were particularly common. Using in-house extracts for EAST and immunoblot experiments, Hoff et al. [13] detected F. culmorum specific IgE antibodies in 23 (44%) of 52 subjects with suspected mould allergy in Europe. In India, skin prick tests with 60 allergens were performed on 48 patients with naso-bronchial allergy and results indicated that Aspergillus fumigatus, A. flavus, Alternaria teneis and F. solani were common fungal allergens [14]. In Greece, Gonianakis et al. [15] found that among 571 patients, 42% showed dermal positivity to allergens derived from Alternaria, Cladosporium, Fusarium, Aspergillus, and Mucor. Thus, there is a worldwide indication that Fusarium fungus may play a role in clinical allergy. However, our knowledge about allergens of this airborne Fusarium fungus is still quite limited [13], [16] and standardized Fusarium extracts for clinical diagnostics are lacking. IgE cross-reactivity is an important component of fungal sensitization and could contribute significantly to allergy manifestation [17]. Thus, in addition to the identification and characterization of fungal allergens, it is important to delineate IgE cross-reactivity between allergens from different fungal species and even more importantly, between fungal allergens and their human analogues. Previously, we have identified important IgE cross-reactive pan-serine protease fungal allergens from prevalent Penicillium and Aspergillus species [18]. Recently, in addition to serine proteases, the transaldolase has also been identified as a significant and IgE cross-reactive allergen family of Cladosporium and Penicillium species [19]. The purpose of this study is to identify and characterize allergens of Fusarium species. Our results show that the 37.5 kDa transaldolase is a novel and important allergen of F. proliferatum (Fus p 4.0101). In addition, Fus p 4.0101 demonstrated IgE cross-reactivity with the transaldolase allergen from C. cladosporioides (Cla c 14.0101) and, interestingly, with the human transaldolase.

Materials and Methods

Serum samples

The sixty serum samples used in this study were obtained from the Biobank at the Taipei Veterans General Hospital. All these serum samples were obtained from respiratory atopic patients (allergic rhinitis and/or atopic asthma) who attended the allergy clinics of the Taipei Veterans General Hospital and were stored in aliquots at −80°C. This study has been approved by the Institutional Review Board of the Taipei Veterans General Hospital.

Crude extracts of F. proliferatum

F. proliferatum strain BCRC 30972 was used in this study. It was isolated from the air of Taiwan and provided by the Food Industry Research and Development Institute, Hsinchu, Taiwan. It was cultured in a CYB medium without agitation at 26°C for five days. The CYB medium contains yeast carbon base (Difco Laboratories, Detroit MI, USA; 11.7 g/L), glucose (Mallinckrodt Baker, Inc., Phillipsburg, NJ, USA; 10 g/L) and casein enzymatic hydrolysate (Sigma Chemical Co., St. Louis, MO, USA; 10 g/L). Crude extracts of F. proliferatum were prepared essentially as described [19], [20]. The protein content of crude fungal extracts was determined with a dye-binding assay according to the manufacturer’s instructions (Bio-Rad, Richmond, CA, USA).

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting

Proteins in the crude fungal extractions or purified recombinant proteins were separated by SDS-PAGE [19], [20] then transferred electrophoretically onto polyvinylidene difluoride (PVDF) membranes (0.45 µm, Millipore, Bedford, MS, USA). Protein components reacting against human IgE antibodies were determined as described [19], [20]. The membranes were blocked with 1% skimmed milk and incubated with serum samples for 16 h at 4°C. The membranes were washed, incubated with alkaline phosphatase-conjugated monoclonal anti-human IgE antibodies (Pharmingen, San Diego, CA, USA) then developed with enzyme substrates essentially as described [19], [20]. Serum samples from a non-atopic healthy individual and two house dust mite (Dermatophagoides pteronyssinus)-sensitized atopic individuals were used as controls.

cDNA Cloning

The cDNA encoding the F. proliferatum transaldolase was isolated with polymerase chain reactions (PCR) using an AffinityScript Multiple Temperature cDNA Synthesis kit (Stratagene, La Jolla, Calif., USA) as previously described [19], [20]. Primers TAase (5'-119aag/tac/aag/cc(a/c)/ca(a/g)/ga(t/c)/gc138-3') and AP (5'-ggccacgcgtcgactagtact-(dt)16-3') were used in the first set of PCR. The product obtained was used as a template in a subsequent PCR with primers TAase and AUAP (5'-ggccacgcgtcgactagtac-3'). The product from the nest PCR reaction was gel purified and inserted into the pGEM-T vector (Promega, Madison, WI, USA) for sequencing analysis. The full-length cDNA of the F. proliferatum transaldolase was obtained by 5' rapid amplification of cDNA end (RACE) reaction. The template cDNA for the reaction was synthesized with reverse transcriptase (RT, Stratagene) and primer GSP-r1 (5'-529aagagagaacatgagggtgaggtt506-3'). An oligo-(dC) was added to the end of the purified cDNA with terminal deoxynucleotidyl transferase (Promega). Primers GSP-r2 (5'-336tcgacctcagttgagacctt317-3') and 5R AAP (5'-ggccacgcgtcgactagtacgggiigggiigggiig-3') were then used in the 5'-RACE reaction. The product was purified, subcloned, transformed and subsequently sequenced.

Preparation of recombinant fungal transaldolases

The F. proliferatum transaldolase was expressed with an N-terminal His6-tag. Appropriate primers (Fu-TAase-f, 5'-cgggatcc44tcttcctctctcgaacagctc64-3' and Fu-TAase-r, 5'-aactgcag1012ttaggcgagcttctccttgaggatgc987-3') were used in the PCR amplification with the full-length cDNA encoding the F. proliferatum transaldolase prepared above as template. The PCR products were restricted then ligated into the pQE-80 vector (Qiagen Inc., Valencia, CA, USA) for protein expression in E. coli JM109 cells. The recombinant proteins were affinity-purified with Ni-NTA resin columns (Qiagen Inc.) according to the manufacturer’s instructions. The His6-tagged recombinant C. cladosporioides transaldolase (Cla c 14.0101) used in this study was prepared as described previously [19]. Immuno-reactivity of the recombinant fungal and the recombinant human transaldolases (Novus Biologicals, Littleton, CO, USA; 0.5 µg/strip) against IgE antibodies was analyzed by SDS-PAGE-immunoblot.

Immunoblot inhibition

For immunoblot inhibition studies, anti-transaldolase IgE-containing serum samples were firstly reacted with purified recombinant F. proliferatum transaldolase before incubating with PVDF blots containing F. proliferatum extracts, purified rCla c 14.0101, or purified recombinant human transaldolase at 4°C for 16 h. As controls, the blots were incubated with similar serum samples that have been pre-incubated with equivalent amounts of bovine serum albumin (BSA, Pierce, Rockford, IL, USA) or purified recombinant house dust mite allergen Der p 7 [21]. The blots were then washed and incubated with alkaline phosphatase-conjugated monoclonal anti-human IgE antibodies (Pharmingen) and developed with enzyme substrates as described [19], [20]. In addition, two house dust mite-sensitized serum samples were firstly reacted with purified recombinant Der p 7, F. proliferatum transaldolase or BSA before incubating with PVDF blots containing Der p 7 at 4°C for 16 h. The blots were then incubated with alkaline phosphatase-conjugated monoclonal anti-human IgE antibodies (Pharmingen) and developed with enzyme substrates as above.

Results

Immunoblot reactivity against components of F. proliferatum

F. proliferatum crude extracts were separated by SDS-PAGE. The Coomassie blue-stained protein profile of the fungal extracts was shown in panel A of Fig. 1. The separated proteins were blotted onto PVDF membrane then reacted with patient sera. Among the 60 serum samples from respiratory atopic patients examined, 17 (28%) demonstrated IgE-binding against components of F. proliferatum (Fig. 1, strip nos. 1–17 of panel B). Human IgE antibodies reacted with at least nine different F. proliferatum components ranging in molecular mass from 92 to 30 kDa as shown in Fig. 1 and Table 1. Components of 43 and 36.5 kDa with IgE-binding frequencies of 88% (15/17) and 53% (9/17), respectively, may be considered as major allergens of F. proliferatum. In Fig. 1, the 36.5 kDa allergen has a relatively higher intensity of IgE-immunoblot reactivity than others. The 37.5 kDa component (indicated with an arrow, Fig. 1B) with IgE-binding frequency of 47% (8/17) was considered an important allergen of F. proliferatum. The 92, 83 and 48 kDa components with IgE-binding frequencies of about 35–41% were considered as significant allergens of F. proliferatum. The 40, 32 and 30 kDa components with IgE-binding frequencies of less than 20% were minor allergens of F. proliferatum. A serum sample from a non-atopic individual (serum no. 18) and two serum samples from house dust mite (D. pteronyssinus)-sensitized atopic individuals (serum nos. 19 and 20) were included as negative controls and shown in Fig. 1, panel B.
Figure 1

Immunoblot reactivity against components in F. proliferatum extracts.

(A) Coomassie blue-stained protein profile of F. proliferatum extracts. (B) IgE immunoblot profiles obtained with serum samples from respiratory atopic patients (serum nos. 1–17), a non-atopic individual (serum no. 18) and two house dust mite (D. pteronyssinus)-sensitized atopic individuals (serum nos. 19, 20). The arrow indicates the position of the 37.5 kDa component of F. proliferatum.

Table 1

Reactivity of IgE antibodies against components of F. proliferatum analyzed by SDS-PAGE-immunoblot.

F. proliferatumcomponentStrips of IgE-immunoblot
No.kDaFrequency of IgE-binding (%)123456789101112131415161718
19241 (7/17)+* ++++++
28335 (6/17)++++++
34835 (6/17)++++++
44388 (15/17)+++++++++++++++
54018 (3/17)+++
637.547 (8/17)++++++++
736.553 (9/17)+++++++++
83212 (2/17)++
93012 (2/17)++

*indicates positive IgE-binding as shown in Fig. 1, panel B.

Immunoblot reactivity against components in F. proliferatum extracts.

(A) Coomassie blue-stained protein profile of F. proliferatum extracts. (B) IgE immunoblot profiles obtained with serum samples from respiratory atopic patients (serum nos. 1–17), a non-atopic individual (serum no. 18) and two house dust mite (D. pteronyssinus)-sensitized atopic individuals (serum nos. 19, 20). The arrow indicates the position of the 37.5 kDa component of F. proliferatum. *indicates positive IgE-binding as shown in Fig. 1, panel B. Since a 36.5 kDa IgE-binding component was identified as a transaldolase allergen of C. cladosporioides (Cla c 14.0101) [19]. We putatively concluded that the IgE-reacting 37.5 kDa component from F. proliferatum was possibly a transaldolase.

cDNA cloning of the F. proliferatum transaldolase

The full-length cDNA encoding the F. proliferatum transaldolase was obtained through RT-PCR coupled with the 5'-end RACE reaction. The nucleotide (GenBank accession no. KF151224) and the deduced amino acid sequences of the open reading frame are presented in Fig. 2. A potential polyadenylation signal (AATCGA) for mRNAs of higher eukaryotes was found 15–20 bases upstream from the poly-A tail. The mature F. proliferatum transaldolase protein, excluding the initiator methionine [22] has 322 residues and a calculated molecular mass of 35404 daltons, without considering the presence of further post-translational modifications. It has one cysteine (Cys240) and one putative N-glycosylation site (156NLT158) (Fig. 2). Furthermore, amino acid residues conserved among transaldolases (Asp18, Asn36, Glu97, Lys133, Asn156, Thr158, Ser178 and Arg183) can also be found (Fig. 2). These conserved residues are crucial to enzyme catalysis or substrate binding [23]. This transaldolase allergen has been designated as Fus p 4.0101 by the I.U.I.S. Allergen Nomenclature Sub-committee.
Figure 2

The nucleotide and deduced amino acid sequences of Fus p 4.0101 (GenBank accession no. KF151224).

Numbers to the right are the positions of the nucleotides and the deduced residues of the sequences. The stop codon TAA is denoted with an asterisk (*). The potential N-glycosylation site is indicated in bold letters and boxed. Eight conserved amino acid residues that are involved in the catalysis and the substrate binding of transaldolases are shaded and in bold letters. Nucleotide sequences in grey correspond to primer sequences synthesized for PCR experiments in the cDNA cloning of Fus p 4.0101 as described in the Materials and Methods. The sequences corresponding to primers Fu-TAase-f and Fu-TAase-r used in the preparation of rFus p 4.0101 are boxed.

The nucleotide and deduced amino acid sequences of Fus p 4.0101 (GenBank accession no. KF151224).

Numbers to the right are the positions of the nucleotides and the deduced residues of the sequences. The stop codon TAA is denoted with an asterisk (*). The potential N-glycosylation site is indicated in bold letters and boxed. Eight conserved amino acid residues that are involved in the catalysis and the substrate binding of transaldolases are shaded and in bold letters. Nucleotide sequences in grey correspond to primer sequences synthesized for PCR experiments in the cDNA cloning of Fus p 4.0101 as described in the Materials and Methods. The sequences corresponding to primers Fu-TAase-f and Fu-TAase-r used in the preparation of rFus p 4.0101 are boxed. Results from sequence alignment revealed that the F. proliferatum transaldolase has 255 (79%), 236 (73%), 247 (77%), 207 (64%) and 195 (61%) amino acids identical to that of A. fumigatus (accession no. XM748623), C. cladoporioides (accession no. GQ906475), P. chrysogenum (accession no. GQ925430), S. cerevisiae (accession no. AAB67752), and Homo sapiens (accession no. AAF40478) transaldolases, respectively (data not shown). The transaldolase from F. proliferatum has only one cysteine residue. However, three cysteine residues are conserved among A. fumigates, C. cladoporioides and P. chrysogenum transaldolases. In addition, one and two cysteine residues can be found in S. cerevisiae and Homo sapiens transaldolases, respectively (data not shown). The one potential N-glycosylation site of F. proliferatum transaldolase (156NLT158) is boxed in Fig. 2 and it is conserved among all the transaldolases mentioned above.

Immunoreactivity of recombinant transaldolase proteins

In this study, rFus p 4.0101 was expressed as N-terminal His6-tag proteins in E.coli and purified (Fig. 3, panel A). It has an apparent molecular mass of about 38 kDa upon SDS-PAGE analysis (data not shown). The Coomassie blue-stained protein profiles of rFus p 4.0101, rCla c 14.0101 and a recombinant human transaldolase obtained commercially are shown in Fig. 3, panel A. Serum sample nos. 1–3 from Fig. 1, panel B showed positive IgE-binding against rFus p 4.0101. These three serum samples have negative IgE-binding to rCla c 14.0101 and serum no. 2 showed positive IgE-binding against human transaldolase (Fig. 3, panel B). In addition, nine serum samples from asthmatic patients with IgE-binding against rCla c 14.0101 or recombinant human transaldolase [19] were included in this study. The IgE immunoblot reactivities of these sera (serum nos. 21–29) against these three different recombinant transaldolases are shown in Fig. 3, panel B. Among these nine serum samples, eight (serum nos. 21–26, 28 and 29) showed positive IgE-binding against rFus p 4.0101. Eight (serum nos. 21–28) of these nine serum samples showed IgE-binding against rCla c 14.0101. Furthermore, serum nos. 22, 24, 26, 27 and 29 have also IgE reactivity against recombinant human transaldolase. Serum from a non-atopic individual (serum no. 18) and from two house dust mite-sensitized atopic individuals (serum nos. 19 and 20) were used as controls and showed negative IgE immunoblot reactivity against all three recombinant transaldolases (Fig. 3, panel B).
Figure 3

Antigenicity of recombinant F. proliferatum, C. cladosporioides and human transaldolases.

(A) Coomassie blue-stained protein profile of rFus p 4.0101, rCla c 14.0101 and recombinant human transaldolase on PVDF membranes. (B) IgE immunoblot reactivities of these three recombinant proteins analyzed by using serum samples nos. 1–3 from Fig. 1 (serum nos. 1–3) and nine serum samples from asthmatic patients (serum nos. 21–29) who showed previously IgE-binding reactvities against rCla c 14.0101 or recombinant human transaldolase. Sera from a non-atopic healthy individual (serum no. 18) and two house dust mite-sensitized atopic individuals (serum nos. 19 and 20) were included as controls.

Antigenicity of recombinant F. proliferatum, C. cladosporioides and human transaldolases.

(A) Coomassie blue-stained protein profile of rFus p 4.0101, rCla c 14.0101 and recombinant human transaldolase on PVDF membranes. (B) IgE immunoblot reactivities of these three recombinant proteins analyzed by using serum samples nos. 1–3 from Fig. 1 (serum nos. 1–3) and nine serum samples from asthmatic patients (serum nos. 21–29) who showed previously IgE-binding reactvities against rCla c 14.0101 or recombinant human transaldolase. Sera from a non-atopic healthy individual (serum no. 18) and two house dust mite-sensitized atopic individuals (serum nos. 19 and 20) were included as controls. The relationship between rFus p 4.0101 and the IgE-binding 37.5 kDa component of F. proliferatum was further delineated with immunoblot inhibition. Fig. 4 showed that serum sample no. 1 from panel B of Fig. 1 has IgE immunoblot reactivity against the 37.5 kDa component of F. proliferatum (Fig. 4, strip 1 of panel B). This immunoblot reactivity was inhibited when the same serum sample was pre-absorbed with 10 µg of rFus p 4.0101 (Fig. 4, strip 2 of panel B). Pre-absorption of the serum sample with 10 µg of BSA did not inhibit its IgE binding against the 37.5 kDa component of F. proliferatum (Fig. 4, strip 3 of panel B). Results obtained correlate the 37.5 kDa component with the F. proliferatum transaldolase and much of the IgE determinants on the native transaldolase were conserved in the recombinant Fus p 4.0101.
Figure 4

Immunoblot inhibition of IgE-binding against nFus p 4.0101 in crude F. proliferatum extracts with purified rFus p 4.0101 and BSA as inhibitors.

(A) Coomassie blue-stained protein profile of F. proliferatum extracts and protein molecular weight markers. (B) IgE binding against the 37.5 kDa component using serum no. 1 from figure 1B (lane 1); this binding activity was inhibited with 10 µg of rFus p 4.0101 (lane 2) but not BSA (lane 3).

Immunoblot inhibition of IgE-binding against nFus p 4.0101 in crude F. proliferatum extracts with purified rFus p 4.0101 and BSA as inhibitors.

(A) Coomassie blue-stained protein profile of F. proliferatum extracts and protein molecular weight markers. (B) IgE binding against the 37.5 kDa component using serum no. 1 from figure 1B (lane 1); this binding activity was inhibited with 10 µg of rFus p 4.0101 (lane 2) but not BSA (lane 3).

Immunoglobulin E cross-reactivity

The panel A of Fig. 5 showed that serum nos. 26 and 28 from Fig. 3, panel B has IgE-binding activity against rCla c 14.0101. rFus p 4.0101 can inhibit, dose dependently, this reactivity (Fig. 5, panel A). Pre-absorption of serum sample no. 26 with 50 µg of BSA or pre-absorption of serum sample no. 28 with 20 µg of rDer p 7 did not inhibit its IgE binding against rCla c 14.0101 (Fig. 5, panel A). The results suggest IgE cross-reactivity between transaldolases from Fusarium and Cladosporium fungi.
Figure 5

Inhibition of IgE-immunoblot reactivity against (A) rCla c 14.0101, (B) recombinant human transaldolase and (C) Der p 7.

IgE-immunoblot experiments were carried out with serum nos. 19, 20, 26, 28 and 29 from Fig. 3. Serum was pre-absorbed with the amount of rFus p 4.0101, Der p 7 or BSA as indicated. * indicates not done.

Inhibition of IgE-immunoblot reactivity against (A) rCla c 14.0101, (B) recombinant human transaldolase and (C) Der p 7.

IgE-immunoblot experiments were carried out with serum nos. 19, 20, 26, 28 and 29 from Fig. 3. Serum was pre-absorbed with the amount of rFus p 4.0101, Der p 7 or BSA as indicated. * indicates not done. Serum sample no. 26 has also IgE-binding activity against recombinant human transaldolase (Fig. 3, panel B and Fig. 5, panel B). This activity can be inhibited dose dependently by pre-absorbing the serum with 2 or 20 µg of rFus p 4.0101. Inhibition of IgE binding was not detected when the same serum was pre-absorbed with 20 µg of BSA (Fig. 5, panel B). In addition, the IgE-binding activity against recombinant human transaldolase of serum no. 29 can also be inhibited dose dependently by pre-absorbing the serum with 5 or 20 µg of rFus p 4.0101 (Fig. 5, panel B). Inhibition of IgE binding was not detected when the same serum was pre-absorbed with 20 µg of Der p 7 (Fig. 5, panel B). Results in Fig. 5, panel C demonstrated that IgE-binding against recombinant Der p 7 in two house dust mite-sensitized atopic serum samples (serum nos. 19 and 20 in Fig. 1 and Fig. 3) can be inhibited by pre-absorbing both serum samples with 5 or 20 µg of rDer p 7. But similar amounts of Fus p 4.0101 or BSA cannot inhibit this binding activity.

Discussion

Fungi are prominent sources of allergens. However, they are still largely neglected in clinical practice and basic research [24]. Allergens of the frequent mold genera including Cladosporium, Alternaria, Aspergillus and Penicillium have been characterized and reported [2], [3], [18]–[20], [24]. Fusarium is among airborne fungi that contribute to human respiratory atopic disorders worldwide. It is important to well characterize IgE-recognizing Fusarium components. In this study, among 60 respiratory atopic sera tested, 17 (28%) demonstrated IgE-binding against nine different components from F. proliferatum. The nature of the 43 and 36.5 kDa major F. proliferatum allergens is currently under investigation and will be published separately (Shen et al., manuscript in preparation). The 37.5 kDa component of F. proliferatum has an IgE-binding frequency of 47% (8/17). IgE-binding against this 37.5 kDa component can be inhibited by a recombinant F. proliferatum transaldolase (Fig. 4). Our results indicate that this important 37.5 kDa IgE-binding component is a F. proliferatum transaldolase. Allergens of the Fusarium species have been reported by three different groups. Verma et al. [16] reported from India that the culture filtrates from F. solani contained 18 allergenic proteins as determined by immunoblotting. A 65-kDa protein component reacted with IgE antibodies in all 15 patient sera tested and was considered as a major allergen [16]. The 45 and 14 kDa components reacted against IgE in 12 patients’ sera. The 41, 38, 35 and 30 kDa F. solani components reacted with IgE antibodies in 9 of the 15 patients’ sera tested [16]. In studies of allergens of F. equiseti, a 65 kDa protein was also found as a major allergen of this common Fusarium species [25]. The nature of the 65 kDa major allergen needs further study. The 45 kDa F. solani allergen has an N-terminal sequence of Lys-Gly-Arg-Thr-Glu-Phe-Ala, which does not show homology to any known fungal proteins [26]. Through cDNA cloning, Hoff et al. in Europe identified three F. culmorum allergens (Fus c 1, Fus c 2 and Fus c 3) [13]. The 11 kDa Fus c 1 (60S acidic ribosomal protein P2), 13 kDa Fus c 2 (thioredoxin-like protein) and 49 kDa Fus c 3 (not related to known proteins) have IgE-binding frequencies of 35, 50, and 15%, respectively, with sera from 26 individuals sensitized to F. culmorum [13]. Recently, Khosravi et al. in Iran showed with immunoblotting that F. solani has six major allergens with molecular masses of 24, 58.5, 64.5, 69, 72 and 97 kDa [27]. In this study, we did not detect a major IgE-binding F. proliferatum protein with molecular mass of about 65 kDa. Whether our 37.5 and 43 kDa IgE-reacting F. proliferatum components correspond to the 38 and 45 kDa F. solani allergens reported need further clarification. Furthermore, we did not detect low molecular mass IgE-binding F. proliferatum proteins correlate to the 11 and 13 kDa F. culmorum allergens. Whether our 48 kDa IgE-reacting F. proliferatum protein resembles the 49 kDa F. culmorum allergen also needs further elucidation. The utilization of different fungal strains, the variations in the culturing conditions, the variance of the methods used in preparing the fungal extracts, and the divergences in exposure and genetic background of individuals examined all contribute to discrepancies in results obtained from various studies and research groups [4]. Thus, studies of fungal allergens at molecular level to provide a basis for standardized fungal extracts is of major importance in clinical allergy. Fungal-atopic subjects often demonstrated a parallel and independent multiple sensitization to many different fungal species [13], [17]. Patients may be sensitized by allergens from individual fungal species. Their multiple sensitizations could be caused by IgE cross-reactivity of a particular protein common among various fungal species. We have observed IgE cross-reactivity among the vacuolar serine protease major pan-fungal allergens [18], [20]. Our results here indicate that the 37.5 kDa transaldolase is an important allergen of F. proliferatum. Transaldolases have been identified as important allergens of prevalent airborne Cladosporium (Cla c 14.0101) and Penicillium (Pen c 35) species [19]. IgE cross-reactivity between Cla c 14.0101 and Pen c 35 has been demonstrated [19]. Transaldolase allergens from Cladosporium, Penicillium and Fusarium species share 67% (217/323 residues) amino acid sequence identity. Our results in Fig. 3 showed that seven sera have IgE reactivity against both Fus p 4.0101 and Cla c 14.0101 and suggested IgE cross-reactivity exists between the Fusarium and Cladosporium transaldolase allergens. Results from IgE-immunoblot inhibition (Fig. 5, panel A) with serum nos. 26 and 28 in Fig. 3 confirmed the presence of IgE cross-reactivity between Fus p 4.0101 and Cla c 14.0101. Combining with previous results [19], it is suggestive that IgE cross-reactivity prevails among the transaldolase allergens from Fusarium, Penicillium and Cladosporium species. Similarly, Verma et al. detected allergenic cross-reactivity among the 14 kDa protein component of three different Fusarium species [28]. In addition, the 45 kDa F. solani major allergen has allergenic cross-reactivity with fungal extracts prepared from Alternaria, Cladosporium, Curvularia and Epicocum species [26]. Furthermore, Hoff et al. also demonstrated IgE cross-reactivity between F. culmorum and A. alternata allergens [13]. All these results provide important information in clinical fungal allergy. Transaldolase from F. proliferatum, C. cladosporioides and homo sapiens share 54% (173/322 residues) amino acid sequence identity. Interestingly, five of the eleven rFus p 4.0101 IgE-positive sera (serum nos. 2, 22, 24, 26 and 29) and one of the rCla c 14.0101 IgE-positive serum (serum no. 27) showed IgE-binding to recombinant human transaldolase (Fig. 3, panel B). Similarly, among another eight fungal (Cla c 14.0101) transaldolase-positive sera tested previously, three of them showed IgE-binding against the recombinant human transaldolase [19]. In this study, IgE cross-reactivity between Fusarium and human transaldolase was further demonstrated (Fig. 5, panel B). In literature, evolutionarily conserved IgE-reactive human antigens corresponding to fungal and pollen allergens such as profilin, ribosomal P2 protein, and manganese superoxide dismutase proteins have been reported [29]–[31]. Recognition of these human counterparts by IgE antibodies might contribute to the stimulation of type I hypersensitive reactions in the absence of exogenous allergen exposure [30]. It might also play a role in certain chronic and severe allergic disorders [29], [31]. Results obtained from this study provide further evidence in IgE cross-reactivity between an environmental fungal allergen and its human analogue which might contribute to disease manifestations. In conclusion, we identified an important novel transaldolase allergen of F. proliferatum. In addition, IgE cross-reactivities between Fusarium and Cladosporium transaldolase allergens as well as between Fusarium and human transaldolases were demonstrated. Our results provide important information in clinical fungal allergy.
  28 in total

1.  Mold allergy in the Mediterranean Island of Crete, Greece: a 10-year volumetric, aerobiological study with dermal sensitization correlations.

Authors:  Michael I Gonianakis; Ioannis K Neonakis; Ioannis M Gonianakis; Maria A Baritaki; Demosthenis Bouros; George Potamias; Kalliopi S Kontou-Fili
Journal:  Allergy Asthma Proc       Date:  2006 Sep-Oct       Impact factor: 2.587

2.  Indoor fungal composition is geographically patterned and more diverse in temperate zones than in the tropics.

Authors:  Anthony S Amend; Keith A Seifert; Robert Samson; Thomas D Bruns
Journal:  Proc Natl Acad Sci U S A       Date:  2010-06-28       Impact factor: 11.205

3.  Allergens from Fusarium solani identified by immunoblotting in asthma patients In Iran.

Authors:  Ali Reza Khosravi; Mahnaz Fatahinia; Hojjatollah Shokri; Mohammad Hossein Yadegari
Journal:  Arh Hig Rada Toksikol       Date:  2012-03       Impact factor: 1.948

4.  Isolation and immunobiochemical characterization of a major allergen (65 kDa) from Fusarium equiseti.

Authors:  J Verma; S Sridhara; D Rai; S V Gangal
Journal:  Allergy       Date:  1998-03       Impact factor: 13.146

5.  Purification and characterization of a cross-reactive 45-kD major allergen of Fusarium solani.

Authors:  Jyotsna Verma; B P Singh; Susheela Sridhara; S N Gaur; Naveen Arora
Journal:  Int Arch Allergy Immunol       Date:  2003-03       Impact factor: 2.749

Review 6.  Fungi: the neglected allergenic sources.

Authors:  R Crameri; M Garbani; C Rhyner; C Huitema
Journal:  Allergy       Date:  2013-11-29       Impact factor: 13.146

7.  Transaldolase B of Escherichia coli K-12: cloning of its gene, talB, and characterization of the enzyme from recombinant strains.

Authors:  G A Sprenger; U Schörken; G Sprenger; H Sahm
Journal:  J Bacteriol       Date:  1995-10       Impact factor: 3.490

8.  Studies on Fusarium solani. Cross-reactivity among Fusarium species.

Authors:  J Verma; S V Gangal
Journal:  Allergy       Date:  1994-05       Impact factor: 13.146

Review 9.  Manufacturing and standardizing fungal allergen products.

Authors:  Robert E Esch
Journal:  J Allergy Clin Immunol       Date:  2004-02       Impact factor: 10.793

10.  Vacuolar serine protease is a major allergen of Cladosporium cladosporioides.

Authors:  Hong Chou; Ming F Tam; Lin-Hau Lee; Chi-Huei Chiang; Hsiao-Yun Tai; Raphael C Panzani; Horng-Der Shen
Journal:  Int Arch Allergy Immunol       Date:  2008-03-21       Impact factor: 2.749

View more
  7 in total

1.  Cryptococcus strains with different pathogenic potentials have diverse protein secretomes.

Authors:  Leona T Campbell; Anna R Simonin; Cuilan Chen; Jannatul Ferdous; Matthew P Padula; Elizabeth Harry; Markus Hofer; Iain L Campbell; Dee A Carter
Journal:  Eukaryot Cell       Date:  2015-04-03

Review 2.  Mold allergens in respiratory allergy: from structure to therapy.

Authors:  Teresa E Twaroch; Mirela Curin; Rudolf Valenta; Ines Swoboda
Journal:  Allergy Asthma Immunol Res       Date:  2015-03-11       Impact factor: 5.764

3.  IFN-stimulated Gene Expression, Type 2 Inflammation, and Endoplasmic Reticulum Stress in Asthma.

Authors:  Nirav R Bhakta; Stephanie A Christenson; Srilaxmi Nerella; Owen D Solberg; Christine P Nguyen; David F Choy; Kyle L Jung; Suresh Garudadri; Luke R Bonser; Joshua L Pollack; Lorna T Zlock; David J Erle; Charles Langelier; Joseph L Derisi; Joseph R Arron; John V Fahy; Prescott G Woodruff
Journal:  Am J Respir Crit Care Med       Date:  2018-02-01       Impact factor: 21.405

4.  The emerging pathogen Paecilomyces variotii - a novel and important fungal allergen source.

Authors:  Sandra Pfeiffer; Marianne Raith; Mariona Pascal; Rosa Maria Munoz-Cano; Clara San Bartolome; Katharina Nöbauer; Santiago Quirce; Ebrahim Razzazi-Fazeli; Margarete Focke-Tejkl; Katja Sterflinger; Ines Swoboda
Journal:  Allergy       Date:  2021-11-23       Impact factor: 14.710

5.  Dectin-1-Mediated Pathway Contributes to Fusarium proliferatum-Induced CXCL-8 Release from Human Respiratory Epithelial Cells.

Authors:  Chang-Ching Yeh; Huann-Cheng Horng; Hong Chou; Hsiao-Yun Tai; Horng-Der Shen; Shie-Liang Hsieh; Peng-Hui Wang
Journal:  Int J Mol Sci       Date:  2017-03-13       Impact factor: 5.923

6.  Identification of T helper (Th)1- and Th2-associated antigens of Cryptococcus neoformans in a murine model of pulmonary infection.

Authors:  Carolina Firacative; A Elisabeth Gressler; Kristin Schubert; Bianca Schulze; Uwe Müller; Frank Brombacher; Martin von Bergen; Gottfried Alber
Journal:  Sci Rep       Date:  2018-02-08       Impact factor: 4.379

7.  Vacuolar Serine Protease Is a Major Allergen of Fusarium proliferatum and an IgE-Cross Reactive Pan-Fungal Allergen.

Authors:  Chang Ching Yeh; Hsiao Yun Tai; Hong Chou; Keh Gong Wu; Horng Der Shen
Journal:  Allergy Asthma Immunol Res       Date:  2016-09       Impact factor: 5.764

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.