Literature DB >> 25049921

Genetic Diversity of mtDNA D-loop Polymorphisms in Laotian Native Fowl Populations.

K Kawabe1, R Worawut1, S Taura1, T Shimogiri1, T Nishida1, S Okamoto1.   

Abstract

Here, we studied the genetic diversity of native fowls in Laos by analyzing a mitochondrial DNA (mtDNA) sequence polymorphism. A 546-bp fragment of the mtDNA D-loop region was sequenced in 129 chickens from the areas of Vientiane, Luang Prabang and Pakse. In total, 29 haplotypes were identified and formed five clades. Haplotype diversity and nucleotide diversity of the native fowls in Laos were 0.85536±0.0172 and 0.010158±0.005555, respectively. Although the Laotian native fowls were distributed across five clades, most of them were clustered in two main clades (A and B), which were originated in China. The other haplotypes were contained in clades D, F, and I, which originated from continental southeast Asia. These results suggest that multiple maternal lineages were involved in the origin of domestic chicken in Laos. Moreover, there appear to be at least two maternal lineages, one from China and the other from the southeast Asian continent.

Entities:  

Keywords:  Genetic Variability; Maternal Origin; Native Fowl; mtDNA

Year:  2014        PMID: 25049921      PMCID: PMC4093284          DOI: 10.5713/ajas.2013.13443

Source DB:  PubMed          Journal:  Asian-Australas J Anim Sci        ISSN: 1011-2367            Impact factor:   2.509


INTRODUCTION

Laos is a tropical landlocked country that shares borders with Thailand, Cambodia, Vietnam, China, and Myanmar, and is located between latitudes 14 and 23 and longitudes 100 and 108. The country’s borders with Thailand and Myanmar are formed by the Mekong River, whose source is in Quinghai Province, China. The terrain in over 70% of the country is composed of mountains and plateaus. There are many kinds of native fowls in Asia. Most of them have not been improved and have lower productive performance than the improved western breeds. In Laos, there are many kinds of native fowls, and farmers rear small flocks of native chickens as an important protein source. There are also many improved breeds that have been introduced from foreign countries, mainly Thailand. Pure native fowl in Laos are gradually decreasing. Because the native chicken populations possess genes that modern breeds have lost, it is very important to retain these genes for the future. Thus, we need to survey the genetic characteristics of native fowls and evaluate their genetic resources. However, there has been little research on Laotian native fowls. One of the few studies was done by Okamoto et al. (1996), who reported the gene constitution of Laotian native fowl by analyzing blood protein polymorphisms. Many researchers have reported mitochondrial DNA (mtDNA) polymorphisms in various animal populations to clarify the ancestral lineage or to compare populations. A number of studies have been carried out to investigate the ancestors of modern chickens by examing mtDNA polymorphisms. Akishinonomiya et al. (1996) suggested a monophyletic origin of domestic chickens from one of the red jungle fowl subspecies Gallus gallus gallus, and proposed that a single domestication event occurred in Thailand and adjacent countries. In contrast, Kanginakudru et al. (2008) reported that two other subspecies, G. g. spadiceus and G. g. murghi, also contributed to the lineage that gave rise to domestic chickens. Other reports described multiple and independent domestication events in south China, southeast Asia and the Indian subcontinent (Liu et al., 2006; Oka et al., 2007). Liu et al. (2006) revealed nine divergent clades related to the geographical distribution of a wide range of domestic chickens in Eurasian regions. Oka et al. (2007) also identified seven clades in Japanese native chickens, of which four clades are identical to four clades described by Liu et al. (2006). Muchadeyi et al. (2008) arranged these clade classification approaches by Liu et al. (2006) and Oka et al. (2007) to apply Zimbabwean native chickens analysis, and suggested that a third maternal lineage excluded Zimbabwean and other African chickens and clustered with haplotypes presumably originating from China. Cuc et al. (2011) also applied this strategy to Vietnamese native breeds and suggested that they have originated from multiple maternal lineages from several regions of China and surrounding regions. The present study was conducted to clarify the genetic diversity of Laotian native fowl populations. We also tried to determine the degree of shared maternal mtDNA haplotypes among populations of Laotian native fowls and, hence, reveal maternal lineages of origin.

MATERIALS AND METHODS

Birds

A total of 129 native chicken samples were collected for this study. The native fowls were collected 54 birds from Vientiane, 42 from Luang Prabang, and 33 from Pakse.

mtDNA amplification and sequencing

Total DNAs were extracted from blood samples by using a standard phenol-chloroform extraction. A fragment of 546-bp from the mtDNA D-loop region was amplified using PCR. The primers used were L16750 (5′-AGGACTACGGCTTGAAAAGC-3′; Akishinonomiya et al., 1994) and H522 (5′-ATGTGCCTGACCGAGGAACCAG-3′; Liu et al., 2006). The numbers in the primer names indicate the homologous positions of the 3′ end of the primers on the mtDNA sequence described by Desjardins and Morais (1990). The PCR reaction was performed using the GeneAmp PCR System 9700 (Applied Biosystems, CA, USA) and the following mixture consisted of 100 ng of template DNA, 1×PCR reaction buffer, 4 pmol of each primer, 400 μmol of each dNTPs, and 1 U of exTaq polymerease (TaKaRa, Otsu, Japan). The thermal profile included an initial denaturation at 94°C for 1 min followed by 30 cycles, each of which included denaturation at 94°C for 1 min, annealing at 60°C for 1 min, and extension at 72°C for 1 min, with a final extension step at 72°C for 7 min. The PCR products were isolated from 1% agarose gels and purified with Mag Extractor (TOYOBO, Osaka, Japan). The BigDye terminator cycle sequencing kit v. 3.1 (Applied Biosystems) and ABI Prism 3130xl genetic analyzer sequencer (Applied Biosystems) were used for sequence analysis.

Data analysis

Multiple alignment analysis was carried out using the Clustal X version 2.1 computer software (Larkin et al., 2007). The position and number of polymorphic sites and of corresponding haplotypes were calculated using MEGA v.5.2.1 (Tamura et al., 2011). Nucleotide diversity (Nei and Li, 1979) and haplotype diversity (Nei, 1987) were estimated using ARLEQUIN v.3.5.1.3 (Excoffier et al., 2010). A median joining network (Bandelt et al., 1999) was constructed using NETWORK 4.611 software (Fluxus Technology Ltd.) to classify the haplotypes under the settings described by Cuc et al. (2011) into nine clades, following Liu et al. (2006), and three clades, following Oka et al. (2007). The list of haplotypes used and the corresponding GenBank accession numbers are provided in Table 1.
Table 1

Haplotype names and accession numbers of chicken mtDNA sequences used in this study

HaplotypeGenBank accession No.Reference
A1 – A10This study
B1 – B12This study
D1 – D4This study
F1 – F2This study
IThis study
Liu_A1AB114069Liu et al. (2006) haplotype A1
Liu_B1AB007744Liu et al. (2006) haplotype B1
Liu_C1AB114070Liu et al. (2006) haplotype C1
Liu_D1AY588636Liu et al. (2006) haplotype D1
Liu_E1AB114076Liu et al. (2006) haplotype E1
Liu_F1AF512285Liu et al. (2006) haplotype F1
Liu_G1AF512288Liu et al. (2006) haplotype G1
Liu_H1D82904Liu et al. (2006) haplotype H1
Liu_I1AB009434Liu et al. (2006) haplotype I1
Oka_D6AB268535Oka et al. (2007) haplotype D6
Oka_G1AB268545Oka et al. (2007) haplotype G1
Oka_F1AB268543Oka et al. (2007) haplotype F1

RESULTS AND DISCUSSION

Genetic diversity and haplotype classification

A total number of 37 variable sites were identified (Table 2). No insertions or deletions were detected in our sequences. The calculated number of polymorphic sites and haplotypic diversity of three populations of Laotian natives are shown in Table 3. The haplotypic diversity ranged from 0.5183 (Luang Prabang) to 0.8798 (Vientiane), although the differences between populations were small. Laotian native fowls showed a higher value of haplotypic diversity than did Zimbabwean (0.29 to 0.78: Muchadeyi et al., 2008), Vietnamese (0.62 to 0.94: Cuc et al., 2011) or Korean (0.59 to 0.82: Hoque et al., 2013) fowls. The nucleotide diversity observed in this study ranged from 0.0007706 (Luang Prabang) to 0.014519 (Pakse) and was almost the same value as that of Korean native chickens (Hoque et al., 2013). These results suggest that Laotian native chicken populations have relatively high genetic diversity.
Table 2

The identified haplotypes with the mitochondrial D-loop sequence polymorphisms in Laotian native fowl populations

HaplotypeNucleotide substitution

167177190198199210212217219220225227228229230233234236237239240242243246249254256261265281283295296299302306310313315317322342347352354355363367370391417446447449
A1CATCTCGTCTTCCCTCCTAACGTCATTCCAATCTCTCCCATAACTTCTTCCCTT
A2..C...................................................
A3...................GT.................................
A4...........................T..........................
A5..C..................................................G
A6.....................................................G
A7......A...............................................
A8.................................................T....
A9....C.................................................
A10................................................C.....
B1T.....A...C............T..............T...............
B2T.....A...C............T........T.....T...............
B3T.....A.T.C............T..............T...............
B4T.....A...C...........CT..............T...............
B5T.....A...C.T..........T..............T...............
B6T.....A...C............T.............TT...............
B7T.....A...C............T..............T..............G
B8T.....A...CG...........T..............T...............
B9T.....A...C............T.......CT.....T...............
B10T.....A................T........T.....T..............G
B11T.....A...C............T........T.....T..............G
B12T.....A...C...........CT......C.......T...............
D1T....T....C...........C...CT.G.....CT....G............
D2T.........C...........C...CT.G.....CT..........C......
D3T........CC...........C...CT.G.....CT.................
D4T.....A...C...........C...CT.G.....CT.................
F1T.........C.....TC....C..CCT........T.TC...........T..
F2T.........C.T...TC....CT.CCT........T.TC...........T..
IT.....A...C.T.....G...CT.....G......T........CT..T....

Dot (.) represents the identical nucleotide with the haplotype A1.

Table 3

Polymorphic sites, haplotype and nucleotide diversity of three Laotian native fowl populations

LocalitynNo. of polymorphic sitesNo. of haplotypesHaplotype diversity (±SD)Nucleotide diversity (±SD)
Vientiane5423200.8798±0.02680.008957±0.005033
Luang Prabang421070.8153±0.02960.007706±0.004448
Pakse3326100.8466±0.03500.014519±0.007823
Total12937290.8536±0.01720.010158±0.005555

Network analysis and haplotype distribution

The 29 haplotypes observed in the Laotian native fowls were clustered into five clades (Figure 1). The haplotypes A1, B1, D1, F1, and I in this study were the same as the partial sequence of each haplotype A1, B1, D1, F1, and I1 from the clades described by Liu et al. (2006). We did not detect the five haplotypes C1, D1, E1, F1, and G1 described by Liu et al. (2006) or the three haplotypes D6, F1, and G1 described by Oka et al. (2007) in the study populations. Most individuals were classed in clades A and B whereas clades D, F, and I consisted of only a small number of individuals (Table 4).
Figure 1

Median network profile of the mtDNA Dloop haplotypes observed in the present study. Data are merged with sequences of major haplotypes described from Liu et al. (2006) and Oka et al. (2007). The circle size corresponds to haplotype frequency.

Table 4

Distribution of mtDNA D-loop haplotypes in three populations of Laotian native fowls

HaplotypeVientianeLuang PrabangPakseTotal
A1148830
A23519
A344
A422
A511
A611
A711
A811
A911
A1011
B1913931
B299523
B344
B411
B511
B611
B711
B811
B911
B1011
B1111
B1211
D144
D214
D311
D411
F111
F211
I22
Total544233129
The formation of the network profile of Laotian native fowl populations was similar to that of Vietnamese native chicken breeds reported by Cuc et al. (2011). However, clades C, E, and G, which are major haplotypes in Vietnamese chickens, were not observed in the Laotian populations. Within clades A and B, the major haplotypes were A1 and B1, composing 59% and 46% of each clade, respectively. Using the skeleton of supposed regions of domestication, this finding suggests that two maternal lineages dominate in the Laotian native fowls, which presumably originated from Yunnan and the surrounding area in China (Liu et al., 2006). A total of 80% of the Pakse population belonged to clades D, F, and I. Liu et al. (2006) and Oka et al. (2007) suggested that clade D has its roots in southeast, south and southwest China and/or the surrounding area (i.e., Vietnam, Thailand, Myanmar and India). A small number of chickens in the Pakse population were also distributed in clade I, originating from continental southeast Asia (Liu et al., 2006). Both Vientiane and Luang Prabang are northern areas in Laos, and they are close to China. However, Pakse area is located in the southern part of Laos is close to Vietnam. Therefore, our results are consistent with the geographical relationship of these populations.
  12 in total

1.  Median-joining networks for inferring intraspecific phylogenies.

Authors:  H J Bandelt; P Forster; A Röhl
Journal:  Mol Biol Evol       Date:  1999-01       Impact factor: 16.240

2.  Monophyletic origin and unique dispersal patterns of domestic fowls.

Authors:  A Fumihito; T Miyake; M Takada; R Shingu; T Endo; T Gojobori; N Kondo; S Ohno
Journal:  Proc Natl Acad Sci U S A       Date:  1996-06-25       Impact factor: 11.205

3.  MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.

Authors:  Koichiro Tamura; Daniel Peterson; Nicholas Peterson; Glen Stecher; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2011-05-04       Impact factor: 16.240

4.  Sequence and gene organization of the chicken mitochondrial genome. A novel gene order in higher vertebrates.

Authors:  P Desjardins; R Morais
Journal:  J Mol Biol       Date:  1990-04-20       Impact factor: 5.469

5.  Multiple maternal origins of chickens: out of the Asian jungles.

Authors:  Yi-Ping Liu; Gui-Sheng Wu; Yong-Gang Yao; Yong-Wang Miao; Gordon Luikart; Mumtaz Baig; Albano Beja-Pereira; Zhao-Li Ding; Malliya Gounder Palanichamy; Ya-Ping Zhang
Journal:  Mol Phylogenet Evol       Date:  2005-11-07       Impact factor: 4.286

6.  One subspecies of the red junglefowl (Gallus gallus gallus) suffices as the matriarchic ancestor of all domestic breeds.

Authors:  A Fumihito; T Miyake; S Sumi; M Takada; S Ohno; N Kondo
Journal:  Proc Natl Acad Sci U S A       Date:  1994-12-20       Impact factor: 11.205

7.  Mitochondrial DNA D-loop sequences suggest a Southeast Asian and Indian origin of Zimbabwean village chickens.

Authors:  F C Muchadeyi; H Eding; H Simianer; C B A Wollny; E Groeneveld; S Weigend
Journal:  Anim Genet       Date:  2008-12       Impact factor: 3.169

8.  Analysis of mtDNA sequences shows Japanese native chickens have multiple origins.

Authors:  T Oka; Y Ino; K Nomura; S Kawashima; T Kuwayama; H Hanada; T Amano; M Takada; N Takahata; Y Hayashi; F Akishinonomiya
Journal:  Anim Genet       Date:  2007-06       Impact factor: 3.169

9.  Phylogenetic Analysis of a Privately-owned Korean Native Chicken Population Using mtDNA D-loop Variations.

Authors:  M R Hoque; N R Choi; H Sultana; B S Kang; K N Heo; S K Hong; C Jo; J H Lee
Journal:  Asian-Australas J Anim Sci       Date:  2013-02       Impact factor: 2.509

10.  Genetic evidence from Indian red jungle fowl corroborates multiple domestication of modern day chicken.

Authors:  Sriramana Kanginakudru; Muralidhar Metta; R D Jakati; J Nagaraju
Journal:  BMC Evol Biol       Date:  2008-06-10       Impact factor: 3.260

View more
  8 in total

1.  Genetic diversity, phylogeographic structure and effect of selection at the mitochondrial hypervariable region of Nigerian chicken populations.

Authors:  Abdulhakeem B Ajibike; Oluwagbemiga O Adeleye; Babatunde M Ilori; Damilola A Osinbowale; Omolola A Adeniyi; Samuel O Durosaro; Adeyinka J Sanda; Oluwafunmilayo A Adebambo; Ayotunde O Adebambo
Journal:  J Genet       Date:  2017-12       Impact factor: 1.166

2.  Genetic diversity of Guangxi chicken breeds assessed with microsatellites and the mitochondrial DNA D-loop region.

Authors:  Yuying Liao; Guodong Mo; Junli Sun; Fengying Wei; Dezhong Joshua Liao
Journal:  Mol Biol Rep       Date:  2016-04-01       Impact factor: 2.316

3.  Genetic diversity and population genetic structure of Cambodian indigenous chickens.

Authors:  Theary Ren; Mitsuo Nunome; Takayuki Suzuki; Yoichi Matsuda
Journal:  Anim Biosci       Date:  2022-01-05

4.  Genetic diversity and population structure in native chicken populations from myanmar, Thailand and laos by using 102 indels markers.

Authors:  A A Maw; K Kawabe; T Shimogiri; W Rerkamnuaychoke; Y Kawamoto; S Masuda; S Okamoto
Journal:  Asian-Australas J Anim Sci       Date:  2015-01       Impact factor: 2.509

5.  The genetic diversity of chicken breeds from Jiangxi, assessed with BCDO2 and the complete mitochondrial DNA D-loop region.

Authors:  Yu-Shi Gao; Xiao-Xu Jia; Xiu-Jun Tang; Yan-Feng Fan; Jun-Xian Lu; Sheng-Hai Huang; Meng-Jun Tang
Journal:  PLoS One       Date:  2017-03-03       Impact factor: 3.240

6.  Phylogenetic Studies on Red Junglefowl (Gallus gallus) and Native Chicken (Gallus gallus domesticus) in Samar Island, Philippines using the Mitochondrial DNA D-Loop Region.

Authors:  Cyrill John P Godinez; Masahide Nishibori; Megumi Matsunaga; Dinah M Espina
Journal:  J Poult Sci       Date:  2019-10-25       Impact factor: 1.425

7.  Geographic Origin and Genetic Characteristics of Japanese Indigenous Chickens Inferred from Mitochondrial D-Loop Region and Microsatellite DNA Markers.

Authors:  Ayano Hata; Atsushi Takenouchi; Keiji Kinoshita; Momomi Hirokawa; Takeshi Igawa; Mitsuo Nunome; Takayuki Suzuki; Masaoki Tsudzuki
Journal:  Animals (Basel)       Date:  2020-11-09       Impact factor: 2.752

8.  Genetic diversity analysis of Thai indigenous chickens based on complete sequences of mitochondrial DNA D-loop region.

Authors:  Piyanat Teinlek; Kannika Siripattarapravat; Chanin Tirawattanawanich
Journal:  Asian-Australas J Anim Sci       Date:  2018-01-26       Impact factor: 2.509

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.