Comparative Analysis of Nkx2-5/GATA4/TBX5 Expression in Chicken, Quail and Chicken-quail Hybrids during the Early Stage of Cardiac Development in Embryos.

The present study makes an investigation into expression of genes related to cardiac development in chicken, quail and chicken-quail hybrids during the early stage of embryogenesis. Real-time PCR was used to detect mRNA expressions of Nkx2-5, GATA4 and TBX5 in the heart of chicken, quail and chicken-quail hybrids embryos during the 3rd to 7th days of incubation. Results showed that NKX2-5 mRNA displayed a similar expression trend in chicken, quail and chicken-quail hybrids. The initial and highest expression of Nkx2-5 was focused on the 3rd day of incubation, then it declined till 5th day of incubation, thereafter, it fluctuated. Expression of Nkx2-5 gene in quail was significantly higher than in chicken and chicken-quail hybrids, and no significant difference was observed between the two latter species. GATA4 mRNA showed a similar expression trend between chicken and quail, which displayed a steady increase from 3rd to 6th d, then, the expression level decreased. However, GATA4 mRNA expression in chicken-quail hybrids was significantly higher than that in chicken and quail from 3rd to 5th d (p<0.01), but significantly lower than that in chicken and quail during the later stage of the experiment (p<0.05), due to the dramatic drop from 5th d onwards (p<0.01). TBX5 mRNA expression in chicken and quail showed the same trend as GATA4 expressed in the two species. Furthermore, TBX5 expression in chicken-quail hybrids was significantly higher than that in chicken and quail during the whole course of experiment, although relatively lower TBX5 expression was detected in the early stage. In conclusion, Nkx2-5, GATA4 and TBX5 genes showed dynamic changes during the process of cardiac development in chicken, quail and their hybrids embryos. In addition, the expression trend in chicken was similar to that in quail, and there was no significant difference for gene expression level, except NKX2-5. However, expression of these genes in chicken-quail hybrids was significantly different from their parents, the difference mechanism needs to be further explored.

INTRODUCTION

The heart is the first organ to be formed and function during the embryogenesis in vertebrate animals (Olson, 2006). Its development includes: cardiac crescent formation, linear heart tube formation, looping heart and initiation of chamber morphogenesis, followed by chamber maturation and separation, and finally, conduction (Bruneau, 2002). Additionally, the molecular events play an important role underlying these processes (Srivastava and Olson 2000; Bruneau, 2002; Wagner and Siddiqui 2007). It has been demonstrated that a battery of transcription factors involved or suspected of involvement in these processes, such as GATA family, including GATA4 (Grepin et al., 1997; Gillio-Meina et al., 2003) and GATA6 (Gove et al., 1997; Davis et al., 2001); Nkx2-5 (Searcy et al., 1998; Schwartz et al., 1999), TBX5 (Liberatore et al., 2000; Plageman and Yutze, 2004), regulate different aspects of cardiac morphogenesis. Among these genes, Nkx2-5, GATA4 and TBX5 have become hot topic recently, due to their important function in the cardiac development process. Nkx2-5 is a key regulator in heart development and has been demonstrated to be associated with the initial stage of cardiac development in vertebrate animals (Warkman et al., 2008). GATA4 has been identified as being expressed early in the cardiogenic area and persisted later in the developing heart (Bisping et al., 2006). It plays an essential role in promoting cardiac development and differentiation of the myocardium (Pu et al., 2004; Bisping et al., 2006). TBX5 has been demonstrated to participate in the occurrence of the heart, formation of tubular heart ring, and the formation of the initial differentiation of the cardiac chambers and interval (Plageman and Yutze, 2004). Owing to the increased knowledge of the function of these genes research on cardiac development has recently become a topic of vigorous investigation in a variety of model animals, ranging from mammalian animals like mice (Arceci et al., 1993; Gong et al., 2006) to avian such as chicken (Brand et al., 1997; MacNeill et al., 1997; Krause et al., 2004).

In avian species, cardiac development in chicken has received much more attention in recent years, from morphology to molecular research (Brand et al., 1997; MacNeill et al., 1997; Krause et al., 2004). Quail belongs to the same order (Galliformes) and the same family (Phasianidae) as chicken. It has also been used as a model animal for a wide range of research, varying from embryology (Huss et al., 2008; Poynter et al., 2009) to space-related science (Minvielle et al., 2007). To our knowledge, little is known on the molecular mechanism of cardiac development in quail embryos, although there are a few publications on the morphology of cardiac development and even a comparison was made with chicken (Virágh et al., 1993; Saber et al., 2008). Chicken-quail hybrids were produced as early as the 1980s by artificial insemination of chicken sperm to quail (Taksashima et al., 1982; Greenfield et al., 1986). As an interspecies hybrid, it has a significant heterosis for growth rate, body size, meat quality and other production performances (Lucottehttp://www.sciencedirect.com/science/article/pii/0305049177900347 - AFF1#AFF1 et al., 1977; Liao et al., 2012). Chicken-quail hybrids could be used as a good model for avian studies (Liao et al., 2012), although some problems and challenges still exist. Recently, more studies have focused on its embryo development, however, the molecular mechanism of cardiac development has not been explored.

The present study, therefore, investigates the expression of genes related to cardiac development in chicken, quail and chicken-quail hybrids during the early stage of embryogenesis. Real-time PCR was used to detect mRNA expression of Nkx2-5, GATA4 and TBX5 in the heart of chicken, quail and chicken-quail hybrids embryos during 3rd to 7th days of incubation.

MATERIAL AND METHODS

Sampling

Females from 200 Korean quails (Coturnix coturnix) were artificially inseminated with semen from 5 Anak chickens (Gallus gallus), provided by the animal experiment station, Shihezi University, Xinjiang, China. Eggs from quails which had received chicken semen (200 eggs of chicken-quail hybrids) were collected. Fertilized eggs of 200 chicken and 200 quail were also obtained. All of the fertilized eggs, including fertilized eggs of chicken, quail and chicken-quail hybrid, were incubated in humidified atmosphere (55% to 60%) at 37.8±0.5°C (control incubation conditions). Thirty embryos were used from chicken, quail, and chicken-quail hybrids, respectively. Embryos were removed from eggs at 3rd, 4th, 5th, 6th and 7th d of incubation (n = 6 per d), during which, the heart were isolated, frozen immediately in liquid nitrogen, and then stored at −80°C for RNA extraction.

RNA extraction and reverse transcription-PCR (RT-PCR)

Total RNA from embryonic hearts was extracted using TRIzol reagent according to the manufacture’s instruction (Invitrogen, USA). The quantity of total RNA was examined by ethidium bromide-stained denaturing agarose gel electrophoresis, and RNA concentration was determined by spectrophotometry at 260 nm. RNA samples were stored at −80°C prior to use.

To obtain cDNA, total RNA of each sample (500 ng) was reversely transcribed by the PrimeScript RT Master Mix (Perfect Real Time) (TaKaRa Biotechnology Co., Ltd. Dalian, China), according to the manufacturer’s instructions.

Primers (Table 1) were designed for amplifying target genes, according to the mRNA sequence of chicken in the GenBank, by Primer premier 5.0 and synthesized by Beijing BGI Company, China. The PCR reaction volume for each gene was 25 μl, which contained 1 μl cDNA templates, 1 μl each primer (10 μmol/L), 0.5 μl Taq DNA polymerase (2.5 U/μl) cDNA, 2.5 μl 10×Taq Buffer, 1.3 μl MgCl2 (25 mmol/L), 2.0 μl dNTP mixture (2.5 mM) and 11.8 μl ddH2O. After 5 min of denaturation at 94°C, the PCR reaction was performed at 94°C for 30 s, annealing for 30 s, 72°C for 30 s for 35 cycles, with an extension at 72°C for 10 min.

Table 1.

Primer sequences, PCR product size, annealing temperature, and GenBank accession number for the target genes in chicken, quail and their hybrids

Gene	Primer sequence 5′-3′	Product size/bp	Annealing temp. (°C)	Acc. No.
GATA4	F:GTGTCACCTCGCTTCTCCTT	360	59	XM_420041a
	R:GTGCCCTGTGCCATCTCT
TBX5	F:CAAGAGAAAAGATGAGGAATG	105	56	NC_006102a
	R:GGGTAACTGGACCTGTAGAAA
Nkx2-5	F:TAGCCCTGTGACGACGACTC	357	58	NM_205164a
	R:GGTTTCCTCCTCTTCCTCTGT
β-actin	F:CTGTGCCCATCTATGAAGGCTA	139	55	NM_205518.1a
	R:ATTTCTCTCTCGGCTGTGGTG

F: forward primer; R: reverse primer; Acc. No: GenBank accession number.

Chicken sequence.

cDNA cloning for target genes

PCR products were separated by electrophoresis on 2% agarose gel and purified by a gel extraction kit (Tiangen Biotech, CO., LTD, Beijing, China). The purified PCR products were ligated into pGEM-T vector (Tiangen Biotech, CO., LTD, Beijing, China), and then the vector was transformed into DH5α cells. After culture in LB medium containing IPTG, X-gal and Ampicillin for 12 to 16 h at 37°C, the positive clones were selected and send to BGI Company (Beijing, China) for sequencing.

Real-time PCR

Real-time PCR was performed under the following condition: an initial denaturing step at 94°C for 4 min, followed by 35 cycles of 94°C for 15 s, annealing at 55°C for 20 s, and extension at 72°C for 20 s, and a final extension step of 10 min at 72°C. Each reaction was carried out in a total volume of 20 μl, consisting of 12.5 μl SYBR@ Premix Ex, 0.5 μl each primer (10 μmol/L), 2 μl cDNA and 4.5 μl ddH2O. Amplification reactions in triplicate for each sample were performed. β-actin was used as an internal control.

Statistical analysis

The relative mRNA expression level of genes was calculated by “normalized relative quantification” method, and statistical analysis was carried out using SPSS version 17.0. One-way ANOVA test and repeated measure of ANOVA were used for statistical analysis of normalized gene copy number, with a p-value of 0.05 considered indicative of a statistically significant difference.

RESULTS

In the present study, expression of the three genes: Nkx2-5, GATA4 and TBX5, were determined in the heart of chicken, quail and chicken-quail hybrids embryos during the 3rd, 4th, 5th, 6th and 7th days of incubation. Results showed that these genes underwent dynamic changes during the process of cardiac development in chicken, quail and their hybrids.

For Nkx2-5 gene, although there was a similar expression trend between chicken and quail during the whole course of experiment: the initial and highest expression of Nkx2-5 were focused on 3rd day of incubation, then it declined till 5th day of incubation, and fluctuated thereafter. Expression of Nkx2-5 gene in chicken was significantly lower than that in quail at the same point of time (p<0.01 on incubation d 3, 4 and 5; p<0.05 on incubation d 6 and 7) (Table 2 and Figure 1). In addition, the current study revealed that Nkx2-5 expression in chicken-quail hybrids is similar to chicken and no significant difference was observed between the two species (p>0.05) (Table 2 and Figure 1). Thirdly and generally, expression of Nkx2-5 gene in quail was significantly higher than that both in chicken and chicken-quail hybrids (Figure 1).

Table 2.

Nkx2-5 mRNA expression during the cardiac development of chicken, quail and chicken-quail hybrids embryos

Gene	Species	Days of embryogenesis
		3	4	5	6	7
Nkx2-5	Chicken	0.152±0.013a	0.053±0.006a	0.028±0.0067a	0.082±0.0088a	0.052±0.006a
	Quail	20.557±3.261A	12.133±1.110A	5.337±0.773A	11.707±1.096b	5.847±1.367b
	Chicken-quail hybrids	2.913±0.303b	1.188±0.420a	0.607±0.084a	1.600±0.342a	0.935±0.048ab

Each mRNA of the gene in the heart from chicken, quail and chicken-quail hybrids embryos detected by Real-time PCR is displayed as a relative to β-actin. The letter in the up right corner of the value represents significant differences between any other two data. If the letter between the two values is the same, it means that there is no significant difference (p>0.05). Whereas, if the letter is different between the two data, it means there was significant difference. A different lowercase letter means p<0.05, while a capital letter means p<0.01. Each value is the mean±SE of six embryos. The same below.

Figure 1.

Nkx2-5 mRNA expression during the cardiac development of chicken, quail and chicken-quail hybrids embryos.

Table 3 and Figure 2 illustrate the mRNA expression of GATA4 gene in the heart from the embryos of chicken, quail and their hybrids during the early stage of embryogenesis. From this table, it can be clearly observed that GATA4 mRNA showed a similar expression trend between chicken and quail, which displayed a steady increase from 3rd to 6th d, and from d 6 onwards the expression level decreased. There was no significant difference between the two species during the whole course of experiment (p>0.05), although expression in quail was a little higher than that in chicken. However, GATA4 mRNA in chicken-quail hybrids showed a significantly different expression trend from their parents. The highest expression level of GATA4 mRNA, in chicken-quail hybrids, occurred on d 3 of incubation, then, it declined till the end of the experiment. GATA4 mRNA in chicken-quail hybrids was significantly higher than that in chicken and quail from d 3 to d 5 (p<0.01), however, due to the significant drop from d 5 onwards (p<0.01), it was significantly lower than that in chicken and quail during the later stage of the experiment (p<0.05). During the period of experiment, GATA4 expression in chicken-quail hybrids fluctuated largely, and differed significantly from chicken and quail.

Table 3.

mRNA expression of GATA4 gene during the cardiac development of chicken, quail and chicken-quail hybrids embryos

Gene	Species	Days of embryogenesis
		3	4	5	6	7
GATA4	Chicken	1.130±0.170a	1.900±0.320a	3.967±0.531a	10.733±1.081ab	5.667±0.890b
	Quail	1.967±1.942a	3.300±0.866a	6.733±1.608a	18.600±3.335b	9.400±1.195Ab
	Chicken-quail hybrids	41.600±4.100A	25.330±3.745A	21.600±1.943A	1.900±0.235a	0.533±0.108a

Figure 2.

mRNA expression of GATA4 gene during the cardiac development of chicken, quail and chicken-quail hybrids embryos.

In this study, we detected the expression of TBX5 in chicken, quail and their hybrids. As shown in Table 4 and Figure 3, low expression of TBX5 mRNA was observed in the early stages (d 3 and 4) in both chicken and quail, but the level showed an upward trend till 6th d, from then onwards it decreased. During the whole course of experiment period the TBX5 mRNA expression level was similar for both chicken and quail. On the other hand, in chicken-quail hybrids expression of TBX5 was also low in the early stages (d 3 and 4) but increased sharply over the experiment period, with the significantly higher expression level occurred on d 5 (p<0.01), 6 (p<0.01) and 7 (p<0.05), respectively, compared with chicken and quail. In general terms, although TBX5 mRNA in chicken-quail hybrids showed similar expression trend as their parents, its expression level was significantly higher.

Table 4.

mRNA expression of TBX5 gene during the cardiac development of chicken, quail and chicken-quail hybrids embryos

Gene	Species	Days of embryogenesis
		3	4	5	6	7
TBX5	Chicken	0.700±0.1718a	0.367±0.092a	3.667±0.907a	7.933±1.726a	2.800±0.480a
	Quail	1.600±0.500a	0.800±0.244a	9.200±1.215a	21.033±3.1143b	6.900±0.740a
	Chicken-quail hybrids	8.770±2.678b	4.700±0.8198a	39.567±6.276A	84.167±10.527A	28.900±4.616b

Figure 3.

mRNA expression of TBX5 gene during the cardiac development of chicken, quail and chicken-quail hybrids embryos.

DISCUSSION

In the present study, we found that there was a similar expression trend of Nkx2-5 gene between chicken and quail during the whole course of experiment, but expression of Nkx2-5 gene in chicken was significantly lower than that in quail at the same point of time. This difference may be due to the different incubation period of the embryos in chicken and quail: the former lasts 21 d while the latter only needs 16 to 17 d. On the other hand, it may be explained by the fact that the cardiac development in chicken lagged behind that in quail (Saber et al., 2008). Thirdly, there are different cardiac developmental stages in chicken and quail that require different expression of genes to regulate development, although Nkx2-5 is a key regulator in heart development, it has been demonstrated to be associated with the initial stage of cardiac development in vertebrate animals (Warkman et al., 2008). In addition, the current study revealed that Nkx2-5 expression in chicken-quail hybrids is similar to chicken, but significantly different from quail, the probable explanation may be due to the fact that chicken-quail hybrids arise from different species.

GATA4 is a member of the GATA family, which has been identified as being expressed early in the cardiogenic area and persisting in the developing heart (Bisping et al., 2006). It plays an essential role in promoting cardiac development and differentiation of the myocardium (Pu et al., 2004; Bisping et al., 2006). In addition to that, research on GATA4 expression in mouse cardiac development revealed GATA4 might be closely related to the septal and ventricular development (Yang et al., 2010). In the present study, we detected the mRNA expression of GATA4 gene in the heart from the embryos of chicken, quail and their hybrids during the early stage of embryogenesis. Results showed that GATA4 mRNA displayed a similar expression trend between chicken and quail, which displayed a steady increase from 3rd to 6th d, and from d 6 onwards, the expression level decreased. Previous research showed that incubation period of 3 to 6 d was the rapid development phase of ventricles and myocardium in chicken, during which, GATA4 expression showed an upward trend. Our result was in agreement with the opinion of Yang et al. (2010), who found that GATA4 might be closely related to the septal and ventricular development in the mouse embryo. In this study, there was no significant difference between the two species during the whole course of experiment, although expression in quail is a little higher than that in chicken. This finding indicated that GATA4 might be highly conserved between chicken and quail. However, GATA4 mRNA in chicken-quail hybrids showed a significantly different expression trend from their parents, chicken and quail, which may be due to the fact that chicken-quail hybrids are interspecies hybrids, which could cause genetic disorder (Cao et al., 2010).

TBX5 expression and its relation to cardiac development have been well studied. It has been demonstrated that TBX5 could be detected in early embryonic heart development, furthermore, it participates in the occurrence of the heart, formation of the tubular heart ring, and the formation of the initial differentiation of the cardiac chambers and interval (Plageman and Yutze, 2004). In this study, we detected the expression of TBX5 in chicken, quail and their hybrids. We found that low expression of TBX5 mRNA was observed in the early stages (d 3 and 4) in both chicken and quail, but the level showed an upward trend till 6th d, from which onwards, it decreased. During the whole course of experiment period, TBX5 mRNA expression level was similar for both chicken and quail. The expression of TBX5 both in chicken and quail suggested that it might be related to the rapid development of atrium, ventricles and atrial septum. On the other hand, in chicken-quail hybrids, expression of TBX5 was also low in the early stages (d 3 and 4) but increased sharply over the experimental period, with the significantly higher expression level occurring on d 5, 6 and 7, respectively, compared with chicken and quail. In general terms, although TBX5 mRNA in chicken-quail hybrids showed similar expression trend as their parents, its expression level was significantly higher than that in chicken and quail.

In conclusion, expression of these genes in chicken and quail showed similar expression trend, while chicken-quail hybrids showed a significantly different expression trend from their parents, the abnormal expression of genes in chicken-quail hybrids need to be further explored.