Literature DB >> 25013465

Gene expression analysis of potential genes and pathways involved in the pathogenic mechanisms of parvovirus B19 in human colorectal cancer.

Wei-Ping Zhang1, Hua Yang2, Hong Chen3, Hai-Rong Zhu4, Quan Lei4, Yun-Hong Song2, Zhong-Ming Dai1, Jing-Shan Sun1, Li-Li Jiang1, Zhan-Guo Nie1.   

Abstract

In order to investigate the pathogenic mechanisms of parvovirus B19 in human colorectal cancer, plasmids containing the VP1 or VP2 viral capsid proteins or the NS1 non-structural proteins of parvovirus B19 were constructed and transfected into primary human colorectal epithelial cells and LoVo cells. Differential gene expression was detected using a human genome expression array. Functional gene annotation analyses were performed using Database for Annotation, Visualization and Integrated Discovery v6.7 software. Gene ontology (GO) analyses revealed that VP1-related functions included the immune response, immune system process, defense response and the response to stimulus, while NS1-associated functions were found to include organelle fission, nuclear division, mitosis, the M-phase of the mitotic cell cycle, the mitotic cell cycle, M-phase, cell cycle phase, cell cycle process and cell division. Pathway expression analysis revealed that VP1-associated pathways included cell adhesion molecules, antigen processing and presentation, cytokines and the inflammatory response. Moreover, NS1-associated pathways included the cell cycle, pathways in cancer, colorectal cancer, the wnt signaling pathway and focal adhesion. Among the differential genes detected in the present study, 12 genes were found to participate in general cancer pathways and six genes were observed to participate in colorectal cancer pathways. NS1 is a key molecule in the pathogenic mechanism of parvovirus B19 in colorectal cancer. Several GO categories, pathways and genes were selected and may be the key targets through which parvovirus B19 participates in colorectal cancer pathogenesis.

Entities:  

Keywords:  colorectal cancer; human; microarray; parvovirus B19; pathogenesis

Year:  2014        PMID: 25013465      PMCID: PMC4081382          DOI: 10.3892/ol.2014.2151

Source DB:  PubMed          Journal:  Oncol Lett        ISSN: 1792-1074            Impact factor:   2.967


Introduction

Colorectal cancer is the third most common type of cancer and the second most frequent cause of cancer mortality in numerous industrialized countries (1). The majority of tumors arise sporadically with no clear cause or genetic predisposition. Several risk factors have been considered as causes of colorectal cancer, but little has been confirmed. Viruses are among the few known causes of cancer and contribute to various malignancies worldwide (2). Previous studies on viral etiology in colon cancer have reported contradictory findings (3,4). Parvovirus B19 (B19) is a non-enveloped virus with a linear, single-stranded DNA genome. The B19 viral genome encodes three proteins: The non-structural protein, NS1, and two viral capsid proteins, VP1 and VP2 (5). In our previous study, significantly higher levels of B19 nucleic acids and proteins were found in neoplastic colon tissues (6). This finding indicates that an association may exist between B19 infection and the development of colon neoplasia. Infection with parvovirus B19 is a global concern. The infection rate is similar in the United States, Europe and Asia, with ~50% of 15-year-old adolescents and >60% of adults being seropositive (5). A previous study has shown that B19 infection may contribute to the pathogenesis of acute lymphoblastic and myeloblastic leukemia (7). However, few studies have investigated B19 in solid tumors or the mechanisms or regulatory proteins that could be involved. Therefore, it is important to establish whether B19 contributes to the pathogenesis of colorectal cancer and its underlying mechanism. The present study aimed to investigate the pathogenic mechanisms underlying B19 in colon carcinoma by analyzing differential gene expression and biological functions, through assessing the changes in primary human colorectal epithelial cells (HCECs) and LoVo cells following transfection with plasmids containing VP1, VP2 and NS1.

Materials and methods

Plasmid construction

The recombinant eukaryotic cell inducible expression vectors, pReceiver-M03-VP1, pReceiver-M33-VP2 and pReceiver-M16-NS1, were constructed by inserting B19 full-length VP1, VP2 and NS1 complementary DNA into pReceiver-M03, pReceiver-M33 or pReceiver-M16 (GeneCopoeia, Inc., Rockville, MD, USA), respectively. The VP1, VP2 and NS1 sequences were amplified by polymerase chain reaction (PCR) analysis using the pGEM/1-B19 plasmid provided by Professor J.P. Clewley at the Central Public Health Laboratory (London, UK) as the template, which contained the B19 full-length open reading frame. The presence of the recombinant plasmid was confirmed using DNA sequencing.

Cell culture and transfection

Samples of normal human colon tissue >10 cm distant to the tumors was obtained from patients with colorectal adenocarcinoma. HCECs were isolated from the normal human colorectal tissue and were washed several times using phosphate-buffered saline (PBS) containing penicillin, streptomycin and amphotericin B using thermolysin and collagenase type I (Sigma-Aldrich, St. Louis, MO, USA), as described previously (8). The cells were then cultured in Epithelial Cell Growth Medium-2 (ScienCell Research Laboratories, Carlsbad, CA, UDA) containing amphotericin B. LoVo carcinoma cells were obtained from the American Type Culture Collection (Rockville, MD, USA) and were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum. All cells were cultured at 37°C in an atmosphere containing 5% CO2. All procedures were performed in accordance with standard guidelines for the study of humans and were approved by the Research Ethics Committee of Urumqi Military General Hospital (Urumqi, China). All patients provided written informed consent. The cells were transfected with pReceiver-M03-VP1, pReceiver-M33-VP2 and pReceiver-M16-NS1, using pReceiver-M03, pReceiver-M33 and pReceiver-M16 as controls. Transfection was performed using Lipofectamine® LTX and PLUS™ Reagents (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions, with untransfected cells used as blank controls.

Fluorescence microscopy

The expression of enhanced green fluorescent protein (eGFP), enhanced cyan fluorescent protein (eCFP) and enhanced yellow fluorescent protein (eYFP) in the transfected HCECs and LoVo cells was observed using a fluorescence microscope (TE2000-U, Nikon Corporation, Tokyo, Japan) equipped with a fluorescence filter. Digital images of the cells were captured using a spot camera system (Nikon Corporation).

Flow cytometric analysis

The cells (1×106) were fixed in 75% alcohol for 12–16 h at 4°C, followed by ethidium bromide (50 μg/ml) and RNase (100 μg/ml) treatment at 25°C for 30 min. Analysis was performed using a flow cytometer (FACScan; Becton Dickinson, Bedford, MA, USA).

Reverse transcription PCR (RT-PCR) analysis

RNA was extracted 24 h and 48 h subsequent to transfection, and RT-PCR was performed. The following primer pairs were used: Vp1 forward, ttctgcatgactgctactgga and reverse, atc ccctagaaaacccatcct; Vp2 forward, tatttgaggaggtggctgatg and reverse, ccaataaaggaacccagcaat; Ns1 forward, ggtggtctggga tgaaggtat and reverse, gtgttcccgcttacaacaaaa; and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). forward, tcggagtcaacggatttggtcgta and reverse, tggcatggactgtggtcatgagtc.

Western blot analysis

Protein extraction was performed by washing the cells twice with ice-cold PBS, followed by homogenization in lysis buffer [50 mM HEPES (pH 7.5), 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EDTA, 10 mM Na4(PO4)2, 25 μg/ml aprotinin and 25 μg/ml leupeptin] at 24 h, 48 h and 72 h post-transfection. The insoluble fraction was removed using centrifugation at 1,000 × g for 15 min at 4°C. Proteins were analyzed using electrophoresis (50 μg per lane) on 10% polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) membranes. Mouse monoclonal antibodies against the B19 proteins VP1 and VP2 (clone, R92F6; Chemicon, Billerica, MA, USA) and anti-NS1 antibodies [a gift from Professor Susanne Modrow (9) and Dr Simon Bredl, Institute of Medical Microbiology, University of Regensburg, Germany] were used to identify the proteins on the PVDF membranes. Horseradish peroxidase-conjugated goat antimouse secondary antibodies (Sigma-Aldrich) were detected using enhanced chemiluminescence western blot analysis reagents (Pierce Biotechnology, Inc., Rockford, IL, USA).

Microarray hybridization and data analysis

Microarray hybridization was performed by Shanghai Biochip Co., Ltd., (Shanghai, China) using an Agilent SurePrint G3 Human GE 8×60k microarray (Agilent Technologies, Santa Clara, CA, USA) that targeted 27,958 Entrez Gene RNAs and 7,419 long non-coding RNAs (reference). In brief, total RNAs from the transfected cells were extracted and purified using the Qiagen RNeasy® Mini kit (Qiagen, Hilden, Germany). Total RNA was amplified using the Low Input Quick Amp Labeling kit, One-Color (Agilent Technologies). For hybridization, each slide was hybridized with 1.65 μg Cy-3 labeled complementary RNA using the Gene Expression Hybridization kit (Agilent Technologies) in a Hybridization Oven (Agilent Technologies) according to the manufacturer’s instructions. Subsequent to 17 h of hybridization, the slides were washed in staining dishes (Thermo Fisher Scientific, Waltham, MA, USA) with Gene Expression Wash Buffer (Agilent Technologies) according to the manufacturer’s instructions. The slides were scanned at a 3-μm resolution using the green dye channel in an Agilent Microarray Scanner (Agilent Technologies). The data were read using Feature Extraction Software 10.7 (Agilent Technologies), and were normalized using Quantile Algorithm, Gene Spring 11.0 software (Agilent Technologies). The data from three replicates were averaged. Genes were defined as differentially expressed if the intensity ratio (Cy5) was found to increase or decrease >2-fold and if the intensity ratio (Cy5) showed the same direction of change (upregulated or downregulated) in all three experimental repeats. Gene ontology (GO) and pathway analyses were performed using Database for Annotation, Visualization and Integrated Discovery v6.7 software (10,11).

Quantitative (q)PCR analysis

qPCR analysis using SYBR® Green (Invitrogen Life Technologies) was performed in order to verify the results of the microarray analysis. Total RNA was extracted from the transfected cells. The RNA was reverse transcribed using Murine Leukemia Virus reverse transcriptase (Promega Corp., Madison, WI, USA). The expression of the 12 genes that were identified as being associated with apoptosis in the microarray analysis was determined using qPCR analysis with SYBR-Green I (Invitrogen Life Technologies). GAPDH was used as an internal control and distilled water was used as a negative control. The amplification reaction consisted of 10X PCR buffer, 1.25 units of JumpStart™ Taq (Sigma-Aldrich), 10 pmol forward and reverse primers, 0.2 μmol dNTP, 100 ng template and 0.2X SYBR-Green I (Amresco Inc., Solon, OH, USA) in a final volume of 50 μl. The reactions were performed using the StepOneTM Real-Time PCR System (Applied Biosystems, Inc., Foster City, CA, USA). The mRNA expression of the 12 genes was normalized with GAPDH using the 2−ΔΔCt method (12). The primer sequences used for GAPDH and the 12 genes were retrieved from PrimerBank (http://pga.mgh.harvard.edu/primerbank/).

Results

VP1, VP2 and NS1 expression in HCECs and LoVo cells

Primary normal HCECs were isolated, cultured and transiently transfected with the pReceiver-M03-VP1, pReceiver-M33-VP2 and pReceiver-M16-NS1 constructs. The expression of eGFP-VP1, eCFP-VP2 and eYFP-NS1 in the HCECs and LoVo cells was analyzed and confirmed using fluorescence microscopy, RT-PCR analysis and western blot analysis. Marked green, cyan and yellow fluorescence, indicating the expression of VP1, VP2 and NS1, respectively, was observed at 24 h post-transfection, with the strongest expression observed after 48 h (Fig. 1A–F). The mRNA expression of VP1, VP2 and NS1 was detected using RT-PCR analysis in the transfected cells (Fig. 1G). To further assess the expression of eGFP-VP1, eCFP-VP2 and eYFP-NS1 in the HCECs and LoVo cells, the protein expression of VP1, VP2 and NS1 was confirmed using anti-VP1, -VP2 and -NS1 antibodies in western blot analysis (Fig. 1H).
Figure 1

Expression of VP1, VP2 and NS1 in HCEC and LoVo cells. (A–C) HCECs and (D–F) LoVo cells marked with green, cyan and yellow fluorescence (magnification, ×400). (G) Reverse transcription polymerase chain reaction (RT-PCR) analysis revealing VP1, VP2 and NS1 mRNA expression in the HCECs and LoVo cells. (H) Western blot analysis showing VP1, VP2 and NS1 protein expression in the HCECs and LoVo cells. HCECs, human colorectal epithelial cells.

No significant changes in the cell cycle or apoptosis were identified in the HCECs transfected with pReceiver-M03-VP1, pReceiver-M33-VP2 or pReceiver-M16-NS1 and pReceiver-M03, pReceiver-M33 or pReceiver-M16. Similarly, no significant changes in cell cycle or apoptosis were identified in the LoVo cells transfected with pReceiver-M03-VP1, pReceiver-M33-VP2 or pReceiver-M16-NS1 and pReceiver-M03, pReceiver-M33 or pReceiver-M16.

Differential gene analysis

Using the human genome expression microarray, differential gene expression was detected in the HCECs and LoVo cells transfected with pReceiver-M03-VP1, pReceiver-M33-VP2 or pReceiver-M16-NS1 compared with those transfected with pReceiver-M03, pReceiver-M33 or pReceiver-M16, respectively. The number of upregulated and downregulated genes (P<0.05; false discovery rate <0.05; fold-change >2.0) are shown in Table I. The top five differential genes in the six groups are shown in Table II. The fold change of the differentially-expressed genes associated with colorectal cancer are shown in Table III.
Table I

Number of differentially-expressed genes in HCECs and LoVo cells transfected with plasmids.

VP1VP2NS1



CellUpregulated, nDownregulated, nUpregulated, nDownregulated, nUpregulated, nDownregulated, n
HCEC740361131124447690
LoVo613328546562508652

HCECs, human colorectal epithelial cells.

Table II

Top five differentially-expressed genes in HCECs and LoVo cells.

UpregulatedDownregulated


GroupGene symbolGene nameGene IDLog2 ratioGene symbolGene nameGene IDLog2 ratio
HCEC
 VP1
NME4Non-metastatic cells 4, protein expressed inNM_00500910.9RWDD4ARWD domain containing 4ANM_152682−7.7
TMCO1Transmembrane and coiled-coil domains 1NM_0190265.9POU3F3POU class 3 homeobox 3NM_006236−4.0
IL6Interleukin 6NM_0006005.1ABCC6P1ATP-binding cassette, sub-family C, member 6 pseudogene 1NR_003569−3.8
CCL20Chemokine (C-C motif) ligand 20NM_0045915.1LOC100131599Hypothetical protein LOC100131599AK126221−3.6
CCL5Chemokine (C-C motif) ligand 5NM_0029855.1MYBPC2Myosin-binding protein C, fast typeNM_004533−3.2
 VP2
TSPAN32Tetraspanin 32NM_1390224.9NME4Non-metastatic cells 4, protein expressed inNM_005009−11.2
LOC100294501Hypothetical protein LOC100294501XM_0023440544.1TMCO1Transmembrane and coiled-coil domains 1NM_019026−6.1
BTBD19BTB (POZ) domain containing 19NM_0011365373.7BTN1A1Butyrophilin, subfamily 1, member A1NM_001732−5.0
TTC29Tetratricopeptide repeat domain 29NM_0319563.7LOC221122Hypothetical LOC221122NR_026681−4.5
CCDC114Coiled-coil domain containing 114NM_1445773.6HIBCH3-hydroxyisobutyryl-Coenzyme A hydrolaseNM_014362−4.2
 NS1
ATG9AATG9 autophagy related 9 homolog A (S. cerevisiae)NM_00107719811.4SAE1SUMO1-activating enzyme subunit 1NM_005500−6.1
MTUS1Microtubule associated tumor suppressor 1NM_0010019255.9RFESDRieske (Fe-S) domain containingNM_173362−5.9
UBE2CBPUbiquitin-conjugating enzyme E2C binding proteinNM_1989205.9GLYATL2Glycine-N-acyltransferase-like 2NM_145016−5.7
DNAJC8DnaJ (Hsp40) homolog, subfamily C, member 8NM_0142805.4C6ORF225Chromosome 6 open reading frame 225NM_001033564−5.6
C7ORF62Chromosome 7 open reading frame 62NM_1527065.2MRPS18AMitochondrial ribosomal protein S18ANM_018135−5.4
LoVo
 VP1
IFI6Interferon, α-inducible protein 6NM_0228734.8WDD4ARWD domain containing 4ANM_152682−7.3
CCL5Chemokine (C-C motif) ligand 5NM_0029854.7HIBCH3-hydroxyisobutyryl-Coenzyme A hydrolaseNM_014362−4.4
IL6Interleukin 6 (interferon, β2)NM_0006004.7POU3F3POU class 3 homeobox 3NM_006236−4.1
CCL20Chemokine (C-C motif) ligand 20NM_0045914.7ABCC6P1ATP-binding cassette, sub-family C, member 6 pseudogene 1NR_003569−3.8
TSPAN32Tetraspanin 32NM_1390224.6LOC100131599Hypothetical protein LOC100131599AK126221−3.6
 VP2
LOC283482Hypothetical LOC283482AK0925136.3KRTAP21-1Keratin-associated protein 21-1NM_181619−6.8
RRP15Ribosomal RNA processing 15 homolog (S. cerevisiae)NM_0160526.2MDM1Mdm1 nuclear protein homolog (mouse)NM_020128−6.1
TRIM71Tripartite motif-containing 71NM_0010391115.9C2ORF76Chromosome 2 open reading frame 76NM_001017927−5.8
ADPRHL1ADP-ribosylhydrolase like 1NM_1384305.7OR4K17Olfactory receptor, family 4, subfamily K, member 17NM_001004715−5.8
GOLGA6L6Golgi autoantigen, golgin subfamily a, 6-like 6NM_0011450045.3PAQR5Progestin and adipoQ receptor family member VNM_001104554−5.6
 NS1
TMEM50ATransmembrane protein 50ANM_01431311.7SAE1SUMO1 activating enzyme subunit 1NM_005500−6.1
TBCATubulin folding cofactor ANM_0046079.0RFESDRieske (Fe-S) domain containingNM_173362−5.9
LOC723809Hypothetical LOC723809NR_0273748.8LOC100129954Hypothetical LOC100129954XM_001714109−5.9
PDZD8PDZ domain containing 8NM_1737916.8C9ORF38Chromosome 9 open reading frame 38AF090921−5.4
FEM1CFem-1 homolog c (C. elegans)NM_0201776.3GORABGolgin, RAB6-interactingNM_152281−5.4

HCEC, human colorectal epithelial cell.

Table III

Fold-change of differentially-expressed genes associated with colorectal cancer.

HCECsLoVo cells


Gene symbolGenbank accessionVP1VP2NS1VP1VP2NS1
RAC3NM_005052--1.44--1.59
MYCL1NM_005376--1.29--1.06
APCDD1NM_153000-2.94-2.91--
APCNM_001127511--1.41--−2.38
TCF7L2NM_030756----1.383.43
VTI1ANM_145206--−1.17--−1.23
TP53INP2NM_0212021.47-----
TP53I11NM_001076787--−3.42--−1.34
TP53INP1NM_033285---1.08--
CRCX7NM_0203111.77--1.63--
BAXNM_004324--1.23--1.05
TMBIM1NM_022152---1.61--
LRP11NM_032832----3.04-
VEGFANM_001025370--1.19---
CCND1NM_053056--2.59---
FOSNM_005252--−1.82--−1.83
FOSBNM_0067321.66--1.27--
FOSL1NM_0054382.21--1.98-2.27
ID1NM_0021651.24-----
FZD4NM_0121933.40--2.85--
FZD1NM_003505--−1.14--−1.11
FZD10NM_0071971.15-----

-, no significant difference (log2ratio >1 or <−1); HCECs, human colorectal epithelial cells.

GO analysis

The differentially-expressed genes were classified into different functional categories based on GO analysis for biological process, molecular function and cellular components. The primary GO categories for the upregulated genes in the HCECs and LoVo cells transfected with pReceiver-M03-VP1 included immune response, immune system process, defense response and response to stimulus, and for the downregulated genes was primarily cellular amino acid metabolic process. The predominant GO categories for the upregulated genes in the HCECs and LoVo cells transfected with pReceiver-M16-NS1 included organelle fission, nuclear division, mitosis, the M-phase of the mitotic cell cycle, the mitotic cell cycle, M-phase, cell cycle phase, cell cycle process and cell division (Table IV).
Table IV

GO terms for the differentially-expressed genes.

GroupGO termGenes, nGenes, %Fold enrichmentP-valueFDR
Upregulation
 VP1 in HCECGO:0006955~immune response8711.853.489.34E-250.000
GO:0002376~immune system process10514.312.901.06E-230.000
GO:0006952~defense response648.722.875.31E-140.000
GO:0050896~response to stimulus19726.841.553.60E-120.000
 VP2 in HCECNo significant enrichment-----
 NS1 in HCECGO:0048285~organelle fission204.494.331.90E-070.000
GO:0000280~nuclear division194.274.284.96E-070.000
GO:0007067~mitosis194.274.284.96E-070.000
GO:0000087~M-phase of mitotic cell cycle194.274.206.43E-070.001
GO:0000278~mitotic cell cycle245.393.211.72E-060.002
GO:0000279~M-phase224.943.313.23E-060.005
GO:0022403~cell cycle phase245.392.871.11E-050.019
GO:0022402~cell cycle process286.292.452.87E-050.049
GO:0051301~cell division184.043.021.02E-040.175
 VP1 in LoVoGO:0006955~immune response599.672.821.16E-120.000
GO:0002376~immune system process7211.802.388.37E-120.000
GO:0050896~response to stimulus14924.431.402.42E-060.004
 VP2 in LoVoNo significant enrichment-----
 NS1 in LoVoGO:0048285~organelle fission224.354.363.38E-080.000
GO:0007067~mitosis214.154.338.32E-080.000
GO:0000280~nuclear division214.154.338.32E-080.000
GO:0000087~M-phase of mitotic cell cycle214.154.261.12E-070.000
GO:0000279~M-phase254.943.452.75E-070.000
GO:0000278~mitotic cell cycle254.943.072.26E-060.004
GO:0022403~cell cycle phase265.142.854.98E-060.009
GO:0022402~cell cycle process305.932.411.99E-050.034
GO:0051301~cell division183.562.772.89E-040.492
Downregulation
 VP1 in HCECGO:0006520~cellular amino acid metabolic process164.434.781.28E-060.002
GO:0048037~cofactor binding174.714.421.57E-060.002
GO:0044106~cellular amine metabolic process184.993.992.78E-060.004
GO:0009308~amine metabolic process205.543.387.38E-060.012
GO:0019752~carboxylic acid metabolic process246.652.927.81E-060.013
GO:0043436~oxoacid metabolic process246.652.927.81E-060.013
 VP2 in HCECNo significant enrichment-----
 NS1 in HCECGO:0043167~ion binding17525.361.321.35E-050.020
GO:0046872~metal ion binding17124.781.321.75E-050.026
GO:0043169~cation binding17124.781.313.08E-050.046
 VP1 in LoVoGO:0006520~cellular amino acid metabolic process144.274.581.17E-050.019
GO:0009069~serine family amino acid metabolic process61.8317.062.19E-050.036
GO:0046394~carboxylic acid biosynthetic process113.355.244.67E-050.078
GO:0016053~organic acid biosynthetic process113.355.244.67E-050.077
GO:0008652~cellular amino acid biosynthetic process72.1310.145.98E-050.099
 VP2 in LoVoNo significant enrichment-----
 NS1 in LoVoNo significant enrichment-----

HCEC, human colorectal epithelial cell; FDR, false discovery rate.

Pathway analysis

Significant pathways for the upregulated and downregulated differentially-expressed genes are shown in Table V. No pathways or specified pathways were found among the upregulated genes in the HCECs following transfection with pReceiver-M33-VP2 or in the LoVo cells following transfection with pReceiver-M33-VP2 or pReceiver-M16-NS1 (Table V). Similarly, no pathways were found among the downregulated genes in the HCECs following transfection with pReceiver-M03-VP1, pReceiver-M33-VP2 or pReceiver-M16-NS1, or in the LoVo cells following transfection with pReceiver-M03-VP1 or pReceiver-M33-VP2 compared with the cells transfected with the control plasmids.
Table V

Significant pathways for differentially-expressed genes.

GroupPathway nameGenes, nGenesFold changeP-valueFDR
Upregulation
 VP1 in HCECCell adhesion molecules14CD274, CD86, F11R, CDH1, ITGB8, ICAM1, HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, HLA-DRB5, PTPRC, SDC42.40.0055.9
Antigen processing and presentation12B2M, CTSS, HSP70B, HSP70B′, HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, HLA-DRB5, TAP12.70.0101.1
Cytokines and inflammatory response7CSF-2, CSF-3, IL1A, IL11, IL-6, IL-8, TNF4.60.0023.2
 VP2 in HCECNone
 NS1 in HCECCell cycle21NDC80, SPC25, BUB1, CDC20, CENPM, CCNA2, CCND1, KIF20A, KIF23, MCM5, PTTG1, PTTG2, PSMB8, TUBA1A, TUBA4A, TUBB2C, TUBB, TUBB5, TUBBP2, TUBBP1, UBE2E17.00.0011.3
Pathways in cancer9BAX, APC, CCND1, FGF10, FGF17, LAMA4, RAC3, VEGFA, WNT10B1.20.52100
Colorectal cancer4BAX, APC, RAC3, CCND12.00.3299
Focal adhesion6MYLPF, CAV1, CCND1, LAMA4, RAC3, VEGFA1.50.3499
 VP1 in LoVoCell adhesion molecules15CD274, CD86, F11R, ITGB8, ICAM1, HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, HLA-DRB5, SDC4, PVRL2, PVRL33.20.0000.2
Antigen processing and presentation10B2M, CTSS, HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, HLA-DRB5, TAP130.00910
Cytokines and inflammatory response4CSF-3, IL1A, IL-8, TNF2.90.01584
 VP2 in LoVoNone
 NS1 in LoVoNot significant
Downregulation
 VP1 in HCECNot significant
 VP2 in HCECNone
 NS1 in HCECNot significant
 VP1 in LoVoNot significant
 VP2 in LoVoNot significant
 NS1 in LoVoCytoskeletal regulation by Rho GTPase16ASPM, ENAH, IGFN1, MYLK, MYH13, MYH6, PAK3, PAK2, RAC3, TTN, TUBB2A, TUBB3, TUBB, TUBB5, TUBBP2, TUBBP1,2.20.01313
Wnt signaling pathway22ARID1A, EP300, INO80, SMARCB1, APC, ARRB2, DCHS1, FZD1, GNG3, MYH13, MYH6, NFATC3, PPP3CB, PCDH18, PCDH7, PCDHA5, PCDHGA5, PCDHGB7, SVEP1, TTBK1, TCF7L2, MTCL11.20.2596
Pathways in cancer12BAX, EP300, BMP4, FZD1, IGF1, PPARG, PIAS4, RAC3, RUNX1T1, TCEB2, TCF7L2, FOS0.780.91100
Colorectal cancer6BAX, APC, RAC3, FZD1, TCF7L2, FOS1.40.42100

P-value, enrichment of differentially-expressed genes; FDR, false discovery rate; HCEC, human colorectal epithelial cell.

Confirmation of microarray results using qPCR analysis

To verify the microarray analysis data, the expression of the 12 differentially-expressed genes selected using microarray analysis was confirmed by qPCR analysis in the different groups. Consistent results were observed with regard to the nine genes in the microarray and qPCR analysis data (Table VI).
Table VI

Expression of 12 differentially-expressed genes detected using microarray analysis compared with qPCR analysis.

Gene symbolGroupsqPCRMicroarray
FOSBVP1/HCEC1.61.7
MYBPC2VP1/HCEC−3.5−3.2
APCDD1VP2/HCEC3.12.9
NME4VP2/HCEC−10.6−11.2
RAC3NS1/HCEC1.71.4
TP53I11NS1/HCEC−4.0−3.4
CRCX7VP1/LoVo1.51.6
ABCC6P1VP1/LoVo−3.7−3.8
LRP11VP2/LoVo2.93.0
KRTAP21-1VP2/LoVo−6.9−6.8
TCF7L2NS1/LoVo3.23.4
FOSNS1/LoVo−1.6−1.8

Data are presented as the log2 ratio. HCECs, human colorectal epithelial cells; qPCR, quantitative polymerase chain reaction.

Discussion

Despite our current understanding of the genetic alterations associated with the progression of colon cancer, the specific etiology of colorectal cancer has yet to be elucidated. Epidemiological studies have indicated that environmental factors and host immunological characteristics may contribute to the initiation and progression of colon cancer. Infectious agents, primarily viral infection, are acquired through the environment and have the potential to alter numerous regulatory processes, which may result in the development of colorectal cancer. Our previous study showed that B19 infection may cause colon carcinoma (6). However, little is known regarding the pathogenic mechanisms responsible for B19-induced tumorigenesis. B19 was discovered in 1974 and is the only Parvoviridae family member that is known to be pathogenic in humans. The genome of B19 has two large open reading frames encoding a single non-structural protein, NS1, and two capsid proteins, VP1 and VP2, which form an icosahedral capsid (5). The contribution of these viral proteins to B19 infectivity have yet to be experimentally demonstrated due to problems with in vitro culture and the lack of an infectious clone. Due to the difficulty in culturing B19 in vitro, little experimental evidence exists regarding the known and putative roles of B19 viral proteins in infectivity. In the present study, plasmids containing VP1, VP2 and NS1 were constructed and transfected into cultured HCECs and LoVo cells. Through the analysis of differentially-expressed genes and their functional enrichment, the present study aimed to identify potential targets to enable further investigation of the function of B19 in colon carcinoma, rather than to identify specific signaling pathways or molecules leading to colon carcinoma in which B19 participated. Current understanding of the B19 viral proteins is primarily based on studies of other parvoviruses. The B19 NS protein is a multifunctional protein, for which sequence analysis has revealed that, in addition to transregulation of the p6 promoter (13,14), NS contains motifs for nucleoside triphosphate (NTP) binding and hydrolysis (15) associated with helicase activity, thus indicating a role for the protein in B19 DNA replication. A previous study has also indicated that the NTP-binding motifs of NS play roles in the induction erythroid lineage cell apoptosis during B19 infection (16). VP2 is the major capsid protein, comprising 95% of the capsid and 58-kDa in size (17). Previous studies in insect cells have reported that VP2 can self-assemble into virus-like particles (17) and that it is capable of binding directly to blood group P antigen, which is the cellular receptor of B19 (18). VP1 is the minor capsid protein, which has an identical amino acid sequence to VP2, plus an extra 227 amino acids termed the VP1-unique region (VP1u)) at the amino terminus (19). Previous studies have shown that the VP1u, which is found on the exterior of the capsid, contains the primary neutralizing epitopes of B19 (20–22). Furthermore, a conserved phospholipase A2 motif has been identified in the VP1u of members of the Parvoviridae family, including B19 (23,24). Two small 7.5- and 11-kDa proteins, are encoded by the small abundant mRNA of B19 (25–27) and are unique among those parvoviruses that have so far been characterized. A number of proline-rich motifs are contained within the 11-kDa protein and are conserved to the Src homology 3 binding domain of eukaryotic proteins (28); however, the function of the 7.5- and 11-kDa proteins in B19 replication and/or pathogenesis has yet to be elucidated. In the present study, plasmids containing VP1, VP2 and NS1 were constructed for transfection into cultured HCECs and LoVo cells. Hundreds of differentially-expressed genes were identified in the HCECs and LoVo cells following VP1, VP2 and NS1 protein expression in different ontological pathways and functional GO groups. GO analyses revealed that the significant VP1-related ontology categories included that of immune response, immune system process, defense response and response to stimulus, while significant NS1-related ontology categories included organelle fission, nuclear division, mitosis, M-phase of the mitotic cell cycle, mitotic cell cycle, M-phase, cell cycle phase, cell cycle process and cell division. Pathway expression analysis identified that VP1-related pathways included cell adhesion molecules, antigen processing and presentation, cytokines and inflammatory response. Pathway expression analysis identified that NS1-related pathways included cell cycle, pathways in cancer, colorectal cancer, the wnt signaling pathway and focal adhesion. The functional GO categories and pathways associated with VP1 and NS1 that were identified in the present study were consistent with the functions of VP1 and NS1 reported previously (6,9,13,14,16–23,28–30). This indicates that NS1 has a significant role in the pathogenesis of B19 in colorectal carcinoma. In conclusion, the present study identified twelve differentially-expressed genes (BAX, EP300, BMP4, FZD1, IGF1, PPARG, PIAS4, RAC3, RUNX1T1, TCEB2, TCF7L2 and FOS) that were found to participate in general cancer pathways, and six genes (BAX, APC, RAC3, FZD1, TCF7L2 and FOS) that were found to specifically participate in colorectal cancer pathways. Furthermore, genes associated with cancer, including MYCL1, APCDD1, VTI1A, TP53INP2, TP53I11, TP53INP1, CRCX7, TMBIM1, LRP11, CCND1, FOSB, FOSL1, FZD4 and FZD10, were found to be differentially expressed. These may be the primary genes involved in regulating the pathogenesis of B19 in colorectal carcinoma. Moreover, NS1 may be the key molecule involved in the pathogenesis of B19 in colorectal carcinoma.
  30 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 2.  Parvovirus B19.

Authors:  Neal S Young; Kevin E Brown
Journal:  N Engl J Med       Date:  2004-02-05       Impact factor: 91.245

3.  Neutralizing linear epitopes of B19 parvovirus cluster in the VP1 unique and VP1-VP2 junction regions.

Authors:  T Saikawa; S Anderson; M Momoeda; S Kajigaya; N S Young
Journal:  J Virol       Date:  1993-06       Impact factor: 5.103

4.  Use of the dissociating enzyme thermolysin to generate viable human normal intestinal epithelial cell cultures.

Authors:  N Perreault; J F Beaulieu
Journal:  Exp Cell Res       Date:  1996-05-01       Impact factor: 3.905

5.  A cytotoxic nonstructural protein, NS1, of human parvovirus B19 induces activation of interleukin-6 gene expression.

Authors:  S Moffatt; N Tanaka; K Tada; M Nose; M Nakamura; O Muraoka; T Hirano; K Sugamura
Journal:  J Virol       Date:  1996-12       Impact factor: 5.103

6.  NS1 protein of parvovirus B19 interacts directly with DNA sequences of the p6 promoter and with the cellular transcription factors Sp1/Sp3.

Authors:  Ulla Raab; Karin Beckenlehner; Torsten Lowin; Hans-Helmut Niller; Sean Doyle; Susanne Modrow
Journal:  Virology       Date:  2002-02-01       Impact factor: 3.616

7.  The small 11-kDa protein from B19 parvovirus binds growth factor receptor-binding protein 2 in vitro in a Src homology 3 domain/ligand-dependent manner.

Authors:  M M Fan; L Tamburic; C Shippam-Brett; D B Zagrodney; C R Astell
Journal:  Virology       Date:  2001-12-20       Impact factor: 3.616

8.  Antibodies to parvovirus B19 NS-1 protein in infected individuals.

Authors:  A von Poblotzki; A Gigler; B Lang; H Wolf; S Modrow
Journal:  J Gen Virol       Date:  1995-03       Impact factor: 3.891

9.  Identification and characterization of a family of 11-kDa proteins encoded by the human parvovirus B19.

Authors:  J St Amand; C R Astell
Journal:  Virology       Date:  1993-01       Impact factor: 3.616

10.  Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists.

Authors:  Da Wei Huang; Brad T Sherman; Richard A Lempicki
Journal:  Nucleic Acids Res       Date:  2008-11-25       Impact factor: 16.971

View more
  2 in total

1.  The Pathogenic Aspects of Human Parvovirus B19 NS1 Protein in Chronic and Inflammatory Diseases.

Authors:  Sedigheh Jalali; Ali Farhadi; Gholamreza Rafiei Dehbidi; Shirin Farjadian; Sedigheh Sharifzadeh; Reza Ranjbaran; Noorossadat Seyyedi; Sepide Namdari; Abbas Behzad-Behbahani
Journal:  Interdiscip Perspect Infect Dis       Date:  2022-06-06

2.  Aberrantly Expressed Genes and miRNAs in Slow Transit Constipation Based on RNA-Seq Analysis.

Authors:  Shipeng Zhao; Qiang Chen; Xianwu Kang; Bin Kong; Zhuo Wang
Journal:  Biomed Res Int       Date:  2018-08-14       Impact factor: 3.411

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.